BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 5170

Title: NMR Structure and Dynamics of the RNA Binding Site for the Histone mRNA Stem-Loop Binding Protein   PubMed: 11871662

Deposition date: 2001-10-03 Original release date: 2002-05-06

Authors: DeJong, E.; Marzluff, W.; Nikonowicz, E.

Citation: DeJong, E.; Marzluff, W.; Nikonowicz, E.. "NMR Structure and Dynamics of the RNA-binding Site for the Histone mRNA Stem-Loop Binding Protein"  RNA 8, 83-96 (2002).

Assembly members:
Histone mRNA, polymer, 28 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: .

Entity Sequences (FASTA):
Histone mRNA: GGCCCUUUUCAGGGCCCAGG GCCACCCA

Data sets:
Data typeCount
13C chemical shifts128
15N chemical shifts14
1H chemical shifts139

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all