BMRB Entry 5170
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5170
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR Structure and Dynamics of the RNA Binding Site for the Histone mRNA Stem-Loop Binding Protein PubMed: 11871662
Deposition date: 2001-10-03 Original release date: 2002-05-06
Authors: DeJong, E.; Marzluff, W.; Nikonowicz, E.
Citation: DeJong, E.; Marzluff, W.; Nikonowicz, E.. "NMR Structure and Dynamics of the RNA-binding Site for the Histone mRNA Stem-Loop Binding Protein" RNA 8, 83-96 (2002).
Assembly members:
Histone mRNA, polymer, 28 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: .
Entity Sequences (FASTA):
Histone mRNA: GGCCCUUUUCAGGGCCCAGG
GCCACCCA
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 128 |
| 15N chemical shifts | 14 |
| 1H chemical shifts | 139 |