BMRB Entry 5243
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5243
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution Structure of the 17mer TF1 Binding Site PubMed: 11955617
Deposition date: 2001-12-21 Original release date: 2002-06-13
Authors: Liu, W.; Vu, H.; Kearns, D.
Citation: Liu, W.; Vu, H.; Kearns, D.. "1H NMR Study of a 17-mer DNA Duplex" Biochim. Biophys. Acta 1574, 93-99 (2002).
Assembly members:
17mer TF1 Binding Site, polymer, 34 residues, Formula weight is not available
Natural source: Common Name: Bacillus subtilis Taxonomy ID: 1423 Superkingdom: Eubacteria Kingdom: not available Genus/species: Bacillus subtilis
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
17mer TF1 Binding Site: CACTACTCTTTGTAGTGCAC
TACAAAGAGTAGTG
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 363 |