BMRB Entry 5321
Click here to enlarge.
PDB ID: 1l1w
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5321
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR structure of a SRP19 binding domain in human SRP RNA PubMed: 12153712
Deposition date: 2002-03-14 Original release date: 2002-05-20
Authors: Sakamoto, T.; Morita, S.; Tabata, K.; Nakamura, K.; Kawai, G.
Citation: Sakamoto, T.; Morita, S.; Tabata, K.; Nakamura, K.; Kawai, G.. "Solution Structure of a SRP19 Binding Domain in Human SRP RNA" J. Biochem. (Tokyo) 132, 177-182 (2002).
Assembly members:
helix 6 of signal recognition particle RNA, polymer, 29 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
helix 6 of signal recognition particle RNA: GGUGACCUCCCGGGAGCGGG
GGACCACCA
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 164 |