BMRB Entry 5349
Chem Shift validation: AVS_anomalous, AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR5349
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: PBX Homeodomain-DNA complex
Deposition date: 2002-04-19 Original release date: 2003-01-06
Authors: Sprules, Tara; Green, Nancy; Featherstone, Mark; Gehring, Kalle
Citation: Sprules, Tara; Green, Nancy; Featherstone, Mark; Gehring, Kalle. "Lock and Key Binding of the HOX YPWM Peptide to the PBX Homeodomain" J. Biol. Chem. 278, 1053-1058 (2003).
Assembly members:
PBX homeodomain, polymer, 82 residues, Formula weight is not available
DNA, polymer, 28 residues, Formula weight is not available
Natural source: Common Name: Mouse Taxonomy ID: 10090 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Mus musculus
Experimental source: Production method: recombinant technology Host organism: Escherichia coli
Entity Sequences (FASTA):
PBX homeodomain: MARRKRRNFNKQATEILNEY
FYSHLSNPYPSEEAKEELAK
KSGITVSQVSNWFGNKRIRY
KKNIGKFQEEANIYAAKTAV
TA
DNA: GCGCATGATTGCCCGGGCAA
TCATGCGC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 317 |
1H chemical shifts | 778 |
15N chemical shifts | 89 |
Additional metadata:
Related Database Links:
BMRB | 4357 4358 4359 |
PDB | 1B72 1LFU 1PUF |
DBJ | BAA96135 BAA96136 BAB83538 BAF84104 BAG10741 |
GB | AAA21832 AAA36484 AAA36764 AAA60031 AAB71191 |
PIR | B33061 |
REF | NP_001094151 NP_001128334 NP_001179697 NP_001191890 NP_001191892 |
SP | P40424 P41778 |
TPG | DAA32038 |
Download simulated HSQC data in one of the following formats:
CSV: Backbone
or all simulated shifts
SPARKY: Backbone
or all simulated shifts