BMRB Entry 5528
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5528
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of the complementary RNA promoter of influenza a virus PubMed: 12771209
Deposition date: 2002-09-13 Original release date: 2003-07-07
Authors: Park, C.-J.; Bae, S.-H.; Varani, G.; Lee, M.-K.; Choi, B.-S.
Citation: Park, C.-J.; Bae, S.-H.; Lee, M.-K.; Varani, G.; Choi, B.-S.. "Solution Structure of the Influenza A Virus cRNA Promoter: Implications for Differential Recognition of Viral Promoter Structures by RNA-dependent RNA Polymerase" Nucleic Acids Res. 31, 2824-2832 (2003).
Assembly members:
complementary RNA promoter of influenza virus, polymer, 25 residues, Formula weight is not available
Natural source: Common Name: influenza A virus Taxonomy ID: 11320 Superkingdom: not available Kingdom: not available Genus/species: influenzavirus A not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
complementary RNA promoter of influenza virus: GGAAGCAGGCUUCGGCCUUG
UUUCC
- assigned_chemical_shifts
| Data type | Count |
| 31P chemical shifts | 13 |