BMRB Entry 5553
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5553
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of influenza A virus C4 promoter PubMed: 12582241
Deposition date: 2002-10-10 Original release date: 2003-03-14
Authors: Lee, M.-K.; Bae, S.-H.; Park, C.-J.; Cheong, H.-K.; Cheong, C.; Choi, B.-S.
Citation: Lee, M.-K.; Bae, S.-H.; Park, C.-J.; Cheong, H.-K.; Cheong, C.; Choi, B.-S.. "A Single-nucleotide Natural Variation (U4 to C4) in an Influenza A Virus Promoter Exhibits a Large Structural Change: Implications for Differential Viral RNA Synthesis by RNA-dependent RNA Polymerase" Nucleic Acids Res. 31, 1216-1223 (2003).
Assembly members:
C4 promoter of influneza A virus, polymer, 31 residues, Formula weight is not available
Natural source: Common Name: Influenzavirus A Taxonomy ID: 197911 Superkingdom: Viruses Kingdom: not available Genus/species: Influenzavirus A not available
Experimental source: Production method: .
Entity Sequences (FASTA):
C4 promoter of influneza A virus: AGUAGAAACAAGGCUUCGGC
CUGCUUUCGCU
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 29 |
| 15N chemical shifts | 11 |
| 31P chemical shifts | 18 |