BMRB Entry 5559
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5559
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Partial 1H and 13C assignments for 3'-stem-loop of human U4 small nuclear RNA
Deposition date: 2002-10-15 Original release date: 2002-12-27
Authors: Comolli, L.; Ulyanov, N.; James, T.; Gmeiner, W.
Citation: Comolli, L.; Ulyanov, N.; Soto, A.; Marky, L.; James, T.; Gmeiner, W.. "NMR Structure of the 3' Stem-Loop from Human U4 snRNA" Nucleic Acids Res. 30, 4371-4379 (2002).
Assembly members:
single chain of RNA, polymer, 20 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
single chain of RNA: GACAGUCUCUACGGAGACUG
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 67 |
| 1H chemical shifts | 117 |