BMRB Entry 5632
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5632
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of the p2b hairpin from human telomerase RNA PubMed: 12525685
Deposition date: 2002-12-19 Original release date: 2004-03-07
Authors: Theimer, C.; Finger, L.; Trantirek, L.; Feigon, J.
Citation: Theimer, C.; Finger, L.; Trantirek, L.; Feigon, J.. "Mutations Linked to Dyskeratosis congenita Cause Changes in the Structural Equilibrium in Telomerase RNA" Proc. Natl. Acad. Sci. U. S. A. 100, 449-454 (2003).
Assembly members:
human telomerase RNA, polymer, 30 residues, 9900 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
human telomerase RNA: GGGCUGUUUUUCUCGCUGAC
UUUCAGCCCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 201 |
| 15N chemical shifts | 25 |
| 1H chemical shifts | 262 |