BMRB Entry 5632
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5632
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of the p2b hairpin from human telomerase RNA PubMed: 12525685
Deposition date: 2002-12-19 Original release date: 2004-03-07
Authors: Theimer, C.; Finger, L.; Trantirek, L.; Feigon, J.
Citation: Theimer, C.; Finger, L.; Trantirek, L.; Feigon, J.. "Mutations Linked to Dyskeratosis congenita Cause Changes in the Structural Equilibrium in Telomerase RNA" Proc. Natl. Acad. Sci. U. S. A. 100, 449-454 (2003).
Assembly members:
human telomerase RNA, polymer, 30 residues, 9900 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
human telomerase RNA: GGGCUGUUUUUCUCGCUGAC
UUUCAGCCCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 201 |
| 15N chemical shifts | 25 |
| 1H chemical shifts | 262 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | telomerase RNA p2b hairpin | 1 |
Entities:
Entity 1, telomerase RNA p2b hairpin 30 residues - 9900 Da.
| 1 | G | G | G | C | U | G | U | U | U | U | |
| 2 | U | C | U | C | G | C | U | G | A | C | |
| 3 | U | U | U | C | A | G | C | C | C | C |
Samples:
sample_1: human telomerase RNA 1 mM; Na phosphate 10 mM; KCl 200 mM; NaN3 0.2%; EDTA 50 uM; H2O 95%; D2O 5%
sample_2: human telomerase RNA, [U-100% 13C; U-100% 15N], 1 mM; Na phosphate 10 mM; KCl 200 mM; NaN3 0.2%; EDTA 50 uM; H2O 95%; D2O 100%
sample_3: human telomerase RNA, [U-100% 13C; U-100% 15N], 1 mM
sample_cond_1: ionic strength: 200 mM; pH: 6.3; pressure: 1 atm; temperature: 278 K
sample_cond_2: ionic strength: 200 mM; pH: 6.3; pressure: 1 atm; temperature: 293 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D NOESY | not available | not available | not available |
| DQF-COSY | not available | not available | not available |
| 3D 13C-separated NOESY | not available | not available | not available |
| 3D 13C NOESY-HMQC | not available | not available | not available |
Software:
xwinnmr v2.6 - processing
AURELIA v3.108 - data analysis
X-PLOR v3.851 - refinement, structure solution
NMR spectrometers:
- Bruker DRX 500 MHz