BMRB Entry 5655
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5655
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: U80G U6 ISL RNA Chemical Shifts PubMed: 12578359
Deposition date: 2002-12-05 Original release date: 2009-06-02
Authors: Sashital, Dipali; Allmann, Anne; Van Doren, Steve; Butcher, Samuel
Citation: Sashital, D.; Allmann, A.; Van Doren, S.; Butcher, S.. "Structural basis for a lethal mutation in U6 RNA" Biochemistry 42, 1470-1477 (2003).
Assembly members:
U6 ISL RNA, polymer, 24 residues, Formula weight is not available
Natural source: Common Name: Baker Taxonomy ID: 4932 Superkingdom: not available Kingdom: not available Genus/species: Eukaryota Fungi
Experimental source: Production method: recombinant technology
Entity Sequences (FASTA):
U6 ISL RNA: GGUUCCCCUGCAUAAGGAGG
AACC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 138 |
| 15N chemical shifts | 15 |
| 1H chemical shifts | 203 |