BMRB Entry 5773
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5773
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of HIV-1 Stem Loop SL1 PubMed: 12559920
Deposition date: 2003-03-15 Original release date: 2003-05-01
Authors: Lawrence, D.; Stover, C.; Noznitsky, J.; Wu, Z.; Summers, M.
Citation: Lawrence, D.; Stover, C.; Noznitsky, J.; Wu, Z.; Summers, M.. "Structure of the Intact Stem and Bulge of HIV-1 Psi-RNA Stem Loop SL1" J. Mol. Biol. 326, 529-542 (2003).
Assembly members:
HIV-1 Stem loop SL1, polymer, 36 residues, 12363 Da.
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
HIV-1 Stem loop SL1: GGACUCGGCUUGCUGGAGAC
GGCAAGAGGCGAGUCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 237 |
| 1H chemical shifts | 272 |