BMRB Entry 5852
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5852
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR Structure of the Active Conformation of the Varkud Satellite Ribozyme Cleavage Site PubMed: 12782785
Deposition date: 2003-06-27 Original release date: 2003-09-12
Authors: Hoffmann, B.; Mitchell, G.; Gendron, P.; Major, F.; Andersen, A.; Collins, R.; Legault, P.
Citation: Hoffmann, B.; Mitchell, G.; Gendron, P.; Major, F.; Andersen, A.; Collins, R.; Legault, P.. "NMR Structure of the Active Conformation of the Varkud Satellite Ribozyme Cleavage Site" Proc. Natl. Acad. Sci. U. S. A. 100, 7003-7008 (2003).
Assembly members:
A mimic of the VS Ribozyme Hairpin Substrate, polymer, 23 residues, Formula weight is not available
Natural source: Common Name: Neurospora crassa Taxonomy ID: 5141 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Neurospora crassa
Experimental source: Production method: cell free synthesis
Entity Sequences (FASTA):
A mimic of the VS Ribozyme Hairpin Substrate: GAGCGAAGACGAAAGUCGAG
CUC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 153 |
| 15N chemical shifts | 69 |
| 1H chemical shifts | 212 |