BMRB Entry 5919
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5919
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: The solution structure of the loop E region of the 5S rRNA from spinach chloroplasts PubMed: 12527295
Deposition date: 2003-08-25 Original release date: 2003-10-16
Authors: Vallurupalli, Pramodh; Moore, Peter
Citation: Vallurupalli, Pramodh; Moore, Peter. "The solution structure of the loop E region of the 5S rRNA from spinach chloroplasts" J. Mol. Biol. 325, 843-856 (2003).
Assembly members:
Loop E of 5S rRNA from spinach chloroplasts, polymer, 42 residues, 14468 Da.
Natural source: Common Name: Spinach Taxonomy ID: 3562 Superkingdom: Eukaryota Kingdom: Viridiplantae Genus/species: Spinacia oleracea
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
Loop E of 5S rRNA from spinach chloroplasts: GGGUGACGAUACUGUAGGCG
AGAGCCUGCGGAAAAAUAGC
CC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 110 |
| 15N chemical shifts | 20 |
| 1H chemical shifts | 253 |