BMRB Entry 5962
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5962
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Chemical shifts assignments of domain 5 of the ai5gamma group II intron PubMed: 14745440
Deposition date: 2003-10-01 Original release date: 2004-03-07
Authors: Sigel, Roland; Sashital, Dipali; Abramowitz, Dana; Palmer, Arthur; Butcher, Samuel; Pyle, Anna Marie
Citation: Sigel, Roland; Sashital, Dipali; Abramowitz, Dana; Palmer, Arthur; Butcher, Samuel; Pyle, Anna Marie. "Solution structure of domain 5 of a group II intron ribozyme reveals a new RNA motif" Nat. Struct. Mol. Biol. 11, 187-192 (2004).
Assembly members:
Domain 5, polymer, 36 residues, 12297 Da.
Natural source: Common Name: Baker Taxonomy ID: 4932 Superkingdom: not available Kingdom: not available Genus/species: Eukaryota Fungi
Experimental source: Production method: cell free synthesis
Entity Sequences (FASTA):
Domain 5: GGAGCCGUAUGCGAUGAAAG
UCGCACGUACGGUUCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 97 |
| 15N chemical shifts | 41 |
| 1H chemical shifts | 272 |