BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 6042

Title: NMR structure of the 30mer stemloop-D of coxsackieviral RNA   PubMed: 14962384

Deposition date: 2003-12-11 Original release date: 2004-11-30

Authors: Ohlenschlager, O.; Wohnert, J.; Bucci, E.; Seitz, S.; Hafner, S.; Ramachandran, R.; Zell, R.; Gorlach, M.

Citation: Ohlenschlager, O.; Wohnert, J.; Bucci, E.; Seitz, S.; Hafner, S.; Ramachandran, R.; Zell, R.; Gorlach, M.. "The Structure of the Stemloop D Subdomain of Coxsackievirus B3 Cloverleaf RNA and its Interaction with the Proteinase 3C"  Stucture 12, 237-248 (2004).

Assembly members:
SLD-RNA, polymer, 30 residues, Formula weight is not available

Natural source:   Common Name: COXSACKIEVIRUS B3   Taxonomy ID: 12072   Superkingdom: Viruses   Kingdom: not available   Genus/species: Enterovirus Human enterovirus B

Experimental source:   Production method: recombinant technology

Entity Sequences (FASTA):
SLD-RNA: GGCACUCUGGUAUCACGGUA CCUUUGUGUC

Data sets:
  • assigned_chemical_shifts
  • coupling_constants
Data typeCount
coupling constants14

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all