BMRB Entry 6042
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6042
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR structure of the 30mer stemloop-D of coxsackieviral RNA PubMed: 14962384
Deposition date: 2003-12-11 Original release date: 2004-11-30
Authors: Ohlenschlager, O.; Wohnert, J.; Bucci, E.; Seitz, S.; Hafner, S.; Ramachandran, R.; Zell, R.; Gorlach, M.
Citation: Ohlenschlager, O.; Wohnert, J.; Bucci, E.; Seitz, S.; Hafner, S.; Ramachandran, R.; Zell, R.; Gorlach, M.. "The Structure of the Stemloop D Subdomain of Coxsackievirus B3 Cloverleaf RNA and its Interaction with the Proteinase 3C" Stucture 12, 237-248 (2004).
Assembly members:
SLD-RNA, polymer, 30 residues, Formula weight is not available
Natural source: Common Name: COXSACKIEVIRUS B3 Taxonomy ID: 12072 Superkingdom: Viruses Kingdom: not available Genus/species: Enterovirus Human enterovirus B
Experimental source: Production method: recombinant technology
Entity Sequences (FASTA):
SLD-RNA: GGCACUCUGGUAUCACGGUA
CCUUUGUGUC