BMRB Entry 6062
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6062
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Assignments for the Negative Regulator of Splicing from Rous Sarcoma Virus residues 907 to 929 PubMed: 15317975
Deposition date: 2004-01-06 Original release date: 2004-10-29
Authors: Cabello-Villegas, Javier; Guiles, Keith; Soto, Ana; Yu, Ping; Beemon, Karen; Wang, Yun-Xing
Citation: Cabello-Villegas, Javier; Giles, Keith; Soto, Ana; Yu, Ping; Mougin, A.; Beemon, Karen; Wang, Yun-Xing. "Solution structure of the pseudo-5' splice site of a retroviral splicing suppressor" RNA 10, 1388-1398 (2004).
Assembly members:
RNA stem-loop, polymer, 23 residues, Formula weight is not available
Natural source: Common Name: Rous sarcoma virus Taxonomy ID: 11886 Superkingdom: Viruses Kingdom: not available Genus/species: alpharetrovirus Rous sarcoma virus
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA stem-loop: GGGGAGUGGUUUGUAUCCUU
CCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 153 |
| 15N chemical shifts | 15 |
| 31P chemical shifts | 17 |