BMRB Entry 6239
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6239
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Chemical shifts assignments for stem-loop VI of the VS ribozyme. PubMed: 15328609
Deposition date: 2004-06-15 Original release date: 2004-09-20
Authors: Dieckmann, Thorsten; Flinders, Jeremy
Citation: Flinders, Jeremy; Dieckmann, Thorsten. "The Solution Structure of the VS Ribozyme Active Site Loop Reveals a Dynamic 'Hotspot'" J. Mol. Biol. 341, 935-949 (2004).
Assembly members:
VSVI RNA, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: Neurospora crassa Taxonomy ID: 5141 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Neurospora crassa
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
VSVI RNA: GGUGACGCCGUAAGGCGCAG
CC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 139 |
15N chemical shifts | 1 |
1H chemical shifts | 183 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | VSVI RNA | 1 |
Entities:
Entity 1, VSVI RNA 22 residues - Formula weight is not available
1 | G | G | U | G | A | C | G | C | C | G | ||||
2 | U | A | A | G | G | C | G | C | A | G | ||||
3 | C | C |
Samples:
sample_1: VSVI RNA 1.5 mM
sample_2: VSVI RNA, [U-95% 13C; U-95% 15N], 1.2 mM
sample_3: VSVI RNA, [U-95% 15N], 1.5 mM
Ex-cond_1: pH: 6.0; temperature: 293 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
not available | not available | not available | Ex-cond_1 |
Software:
XWIN-NMR v3.5, Bruker - Acquisition, Processing
SPARKY v3.106, UCSF - Analysis (Peak Picking)
NMR spectrometers:
- Bruker DRX 600 MHz