BMRB Entry 6320
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6320
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: 1H, 13C, 15N chemical shift assignments for extended 3' internal stem-loop RNA from S. cerevisiae U6 snRNA PubMed: 15543154
Deposition date: 2004-09-21 Original release date: 2004-11-16
Authors: Sashital, Dipali; Cornilescu, Gabriel; Butcher, Samuel
Citation: Sashital, Dipali; Cornilescu, Gabriel; McManus, C.; Brow, D.; Butcher, Samuel. "U2-U6 RNA folding reveals a group II intron-like domain and a four-helix junction" Nat. Struct. Mol. Biol. 11, 1237-1242 (2004).
Assembly members:
U6 extended ISL, polymer, 32 residues, Formula weight is not available
Natural source: Common Name: baker Taxonomy ID: 4932 Superkingdom: not available Kingdom: not available Genus/species: Eukaryota Fungi
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
U6 extended ISL: GAGCAGUUCCCCUGCAUAAG
GAUGAACCGUUC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 189 |
| 15N chemical shifts | 14 |
| 1H chemical shifts | 272 |