BMRB Entry 6477

Name: Solution structure of the P2b-P3 pseudoknot from human telomerase RNA
Published: 2006-02-17

Click here to enlarge.

PDB ID: 1ymo
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6477
MolProbity Validation Chart

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry

Nicholas Rego and David Koes
3Dmol.js: molecular visualization with WebGL
Bioinformatics (2015) 31 (8): 1322-1324 doi:10.1093/bioinformatics/btu829

Select model:

I am color blind

Download raw data. Direct link to this display. Help

Title: Solution structure of the P2b-P3 pseudoknot from human telomerase RNA PubMed: 15749017

Deposition date: 2005-02-02 Original release date: 2006-02-17

Authors: Theimer, C.; Blois, C.; Feigon, J.

Citation: Theimer, C.; Blois, C.; Feigon, J.. "Structure of the human telomerase RNA pseudoknot reveals conserved tertiary interactions essential for function." Mol. Cell 17, 671-682 (2005).

Assembly members:
Telomerase RNA P2b-P3 pseudoknot, polymer, 47 residues, Formula weight is not available

Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens

Experimental source: Production method: enzymatic semi-synthesis

Entity Sequences (FASTA):
Telomerase RNA P2b-P3 pseudoknot: GGGCUGUUUUUCUCGCUGAC UUUCAGCCCCAAACAAAAAA GUCAGCA

Data sets:

assigned_chemical_shifts
- chemical_shift_set_1

Data type	Count
13C chemical shifts	273
15N chemical shifts	73
1H chemical shifts	336

Additional metadata:

Assembly
Samples and Experiments
Software
Spectrometers
Hide all

Entity Assembly ID	Entity Name	Entity ID
1	Telomerase RNA P2b-P3 pseudoknot	1

Samples:

sample_1: Telomerase RNA P2b-P3 pseudoknot 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%

sample_2: Telomerase RNA P2b-P3 pseudoknot 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; D2O 100%

sample_3: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N], 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%

sample_4: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N], 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; D2O 100%

sample_5: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-A, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%

sample_6: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-A, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; D2O 100%

sample_7: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-C, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%

sample_8: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-C, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; D2O 100%

sample_9: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-G, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%

sample_10: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-G, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; D2O 100%

sample_11: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-U, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%

sample_12: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-U, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; D2O 100%

sample_cond_1: ionic strength: 200 mM; pH: 6.3; pressure: 1 atm; temperature: 283 K

sample_cond_2: ionic strength: 200 mM; pH: 6.3; pressure: 1 atm; temperature: 293 K

Experiments:

Name	Sample	Sample state	Sample conditions
2D NOESY (11echo and watergate)	not available	not available	not available
2D NOESY	not available	not available	not available
2D TOCSY (presat)	not available	not available	not available
2D 15N-HMQC	not available	not available	not available
2D 15N-CPMG-NOESY	not available	not available	not available
2D JNN-HNN-COSY	not available	not available	not available
2D 13C-HSQC	not available	not available	not available
2D HCCH COSY	not available	not available	not available
3D HCCH-TOCSY	not available	not available	not available
2D 13C filtered/edited NOESYs	not available	not available	not available

Biological Magnetic Resonance Data Bank

BMRB Entry 6477

Title: Solution structure of the P2b-P3 pseudoknot from human telomerase RNA PubMed: 15749017

Additional metadata:

Assembly:

Entities:

Samples:

Experiments:

Software:

NMR spectrometers: