BMRB Entry 6543
Click here to enlarge.
PDB ID: 1z2j
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6543
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: HIV-1 frameshift inducing element RNA PubMed: 15927637
Deposition date: 2005-03-10 Original release date: 2006-11-06
Authors: Staple, David; Butcher, Samuel
Citation: Staple, David; Butcher, Samuel. "Soultion structure and thermodynamic investigation of the HIV-1 frameshift inducing element" J. Mol. Biol. 349, 1011-1023 (2005).
Assembly members:
HIV-1 frameshift induciting element RNA, polymer, 45 residues, Formula weight is not available
Natural source: Common Name: HIV Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: Not applicable Genus/species: HIV HIV
Experimental source: Production method: in vitro transcription
Entity Sequences (FASTA):
HIV-1 frameshift induciting element RNA: GGGAAGAUCUGGCCUUCCCA
CAAGGGAAGGCCAGGGAAUC
UUCCC
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 308 |
| 13C chemical shifts | 91 |
| 15N chemical shifts | 24 |