BMRB Entry 6633
Click here to enlarge.
PDB ID: 1zc5
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6633
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structure of the RNA signal essential for translational frameshifting in HIV-1 PubMed: 15907937
Deposition date: 2005-05-13 Original release date: 2005-08-18
Authors: Gaudin, C.; Mazauric, M.; Traikia, M.; Guittet, E.; Yoshizawa, S.; Fourmy, D.
Citation: Gaudin, C.; Mazauric, M.; Traikia, M.; Guittet, E.; Yoshizawa, S.; Fourmy, D.. "Structure of the RNA Signal Essential for Translational Frameshifting in HIV-1" J. Mol. Biol. 349, 1024-1035 (2005).
Assembly members:
HIV frameshift RNA signal, polymer, 41 residues, Formula weight is not available
Natural source: Common Name: Lentivirus Taxonomy ID: 11646 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
HIV frameshift RNA signal: GGCGAUCUGGCCUUCCUACA
AGGGAAGGCCAGGGAAUUGC
C
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 273 |
| 15N chemical shifts | 18 |
| 1H chemical shifts | 351 |