BMRB Entry 6756
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6756
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of domain 6 from the ai5(gamma) group II intron PubMed: 17200997
Deposition date: 2005-07-29 Original release date: 2007-03-29
Authors: Erat, Michele; Sigel, Roland
Citation: Erat, Michele; Zerbe, Oliver; Fox, Thomas; Sigel, Roland. "Solution Structure of Domain 6 from a Self-Splicing Group II Intron Ribozyme: A Mg(2+) Binding Site is Located Close to the Stacked Branch Adenosine" Chembiochem. 8, 306-314 (2007).
Assembly members:
Domain 6, polymer, 27 residues, 8787 Da.
MG, non-polymer, 24.305 Da.
Natural source: Common Name: Saccharomyces cerevisiae Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
Domain 6: GGAGCGGGGGUGUAAACCUA
UCGCUCC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 143 |
15N chemical shifts | 11 |
1H chemical shifts | 235 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | D6short | 1 |
2 | MAGNESIUM (II) ION | 2 |
Entities:
Entity 1, D6short 27 residues - 8787 Da.
1 | G | G | A | G | C | G | G | G | G | G | ||||
2 | U | G | U | A | A | A | C | C | U | A | ||||
3 | U | C | G | C | U | C | C |
Entity 2, MAGNESIUM (II) ION - Mg - 24.305 Da.
1 | MG |
Samples:
sample_1: Domain 6 0.6 ± 0 mM; D2O 99.999%; KCL 100 mM; EDTA 10 uM
sample_2: Domain 6 0.6 ± 0 mM; D2O 10%; H2O 90%; KCL 100 mM; EDTA 10 uM
sample_3: Domain 6, [U-13C; U-15N], 0.6 ± 0 mM; D2O 99.999%; KCL 100 mM; EDTA 10 uM
conditions_1: ionic strength: 1.1 M; pH: 6.8; temperature: 303 K
conditions_2: ionic strength: 1.1 M; pH: 6.8; temperature: 275 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H1H Noesy in D2O and H2O | not available | not available | not available |
2D 1H1H Tocsy | not available | not available | not available |
13C1H HSQC | not available | not available | not available |
15N1H HSQC | not available | not available | not available |
HCCH-Tocsy | not available | not available | not available |
HCCH-Cosy | not available | not available | not available |
Software:
No software information available
NMR spectrometers:
- Bruker AVANCE 700 MHz
- Bruker DRX 500 MHz