BMRB Entry 6975
Click here to enlarge.
PDB ID: 2f8u
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6975
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: 1H chemical shift assignments for Bcl2MidG4
Deposition date: 2006-02-08 Original release date: 2006-04-27
Authors: Dai, Jixun; Chen, Ding; Jones, Roger; Hurley, Laurence; Danzhou, Yang
Citation: Dai, Jixun; Dexheimer, T.; Chen, Ding; Carver, M.; Ambrus, A.; Jones, Roger; Yang, Danzhou. "An intramolecular G-quadruplex structure with mixed parallel/antiparallel G-strands formed in the human BCL-2 promoter region in solution" J. Am. Chem. Soc. 128, 1096-1098 (2006).
Assembly members:
Bcl2 middle G4 oligonucleotides, polymer, 23 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
Bcl2 middle G4 oligonucleotides: GGGCGCGGGAGGAATTGGGC
GGG
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 199 |