BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 6975

Title: 1H chemical shift assignments for Bcl2MidG4

Deposition date: 2006-02-08 Original release date: 2006-04-27

Authors: Dai, Jixun; Chen, Ding; Jones, Roger; Hurley, Laurence; Danzhou, Yang

Citation: Dai, Jixun; Dexheimer, T.; Chen, Ding; Carver, M.; Ambrus, A.; Jones, Roger; Yang, Danzhou. "An intramolecular G-quadruplex structure with mixed parallel/antiparallel G-strands formed in the human BCL-2 promoter region in solution"  J. Am. Chem. Soc. 128, 1096-1098 (2006).

Assembly members:
Bcl2 middle G4 oligonucleotides, polymer, 23 residues, Formula weight is not available

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
Bcl2 middle G4 oligonucleotides: GGGCGCGGGAGGAATTGGGC GGG

Data sets:
Data typeCount
1H chemical shifts199

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all