BMRB Entry 7098
Click here to enlarge.
PDB ID: 2gm0
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR7098
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Linear dimer of stemloop SL1 from HIV-1 PubMed: 16603544
Deposition date: 2006-05-05 Original release date: 2007-02-07
Authors: Ulyanov, N.; Mujeeb, A.; Du, Z.; Tonelli, M.; Parslow, T.; James, T.
Citation: Ulyanov, N.; Mujeeb, A.; Du, Z.; Tonelli, M.; Parslow, T.; James, T.. "NMR structure of the full-length linear dimer of stem-loop-1 RNA in the HIV-1 dimer initiation site" J. Biol. Chem. 281, 16168-16177 (2006).
Assembly members:
RNA (35-MER), polymer, 35 residues, Formula weight is not available
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
RNA (35-MER): GACGGCUUGCUGAAGCGCGC
ACGGCAAGAGGCGUC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 137 |
| 15N chemical shifts | 11 |
| 1H chemical shifts | 181 |