BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 7098

Title: Linear dimer of stemloop SL1 from HIV-1   PubMed: 16603544

Deposition date: 2006-05-05 Original release date: 2007-02-07

Authors: Ulyanov, N.; Mujeeb, A.; Du, Z.; Tonelli, M.; Parslow, T.; James, T.

Citation: Ulyanov, N.; Mujeeb, A.; Du, Z.; Tonelli, M.; Parslow, T.; James, T.. "NMR structure of the full-length linear dimer of stem-loop-1 RNA in the HIV-1 dimer initiation site"  J. Biol. Chem. 281, 16168-16177 (2006).

Assembly members:
RNA (35-MER), polymer, 35 residues, Formula weight is not available

Natural source:   Common Name: HIV-1   Taxonomy ID: 11676   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus HIV-1

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
RNA (35-MER): GACGGCUUGCUGAAGCGCGC ACGGCAAGAGGCGUC

Data sets:
Data typeCount
13C chemical shifts137
15N chemical shifts11
1H chemical shifts181

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (35-MER), chain A1
2RNA (35-MER), chain B1

Entities:

Entity 1, RNA (35-MER), chain A 35 residues - Formula weight is not available

1   GACGGCUUGC
2   UGAAGCGCGC
3   ACGGCAAGAG
4   GCGUC

Samples:

sample_1: RNA (35-MER) 0.75 mM; potassium phosphate buffer 10 mM; NaCl 250 mM; MgCl2 0.1 mM; D2O 100%

sample_2: RNA (35-MER) 0.75 mM; potassium phosphate buffer 10 mM; NaCl 250 mM; MgCl2 0.1 mM; H2O 90%; D2O 10%

sample_3: RNA (35-MER), [U-13C; U-15N], 0.75 mM; potassium phosphate buffer 10 mM; NaCl 250 mM; MgCl2 0.1 mM; D2O 100%

sample_4: RNA (35-MER), [U-13C; U-15N], 0.75 mM; potassium phosphate buffer 10 mM; NaCl 250 mM; MgCl2 0.1 mM; H2O 90%; D2O 10%

sample_cond_1: ionic strength: 260 mM; pH: 6.4; pressure: 1 atm; temperature: 303 K

sample_cond_2: ionic strength: 260 mM; pH: 6.4; pressure: 1 atm; temperature: 288 K

Experiments:

NameSampleSample stateSample conditions
2D NOESYnot availablenot availablenot available
2D TOCSYnot availablenot availablenot available
3D 13C-separated NOESYnot availablenot availablenot available
non-decoupled constant-time 1H-13C TROSY-HSQCnot availablenot availablenot available
2D 1H-15N HSQCnot availablenot availablenot available

Software:

VNMR v6.1 - collection

NMRPipe v2.3 - processing

MARDIGRAS v3.21 - iterative matrix relaxation

SPARKY v3.110 - data analysis

DYANA v1.5 - refinement

miniCarlo - refinement

NMR spectrometers:

  • Varian Unity Inova 900 MHz