BMRB Entry 7377
Chem Shift validation: AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR7377
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Resonance assignments of the metal sensor CzrA in the apo-, Zn2- and DNA-bound (42 kDa) states PubMed: 19636838
Deposition date: 2007-03-16 Original release date: 2007-08-23
Authors: Arunkumar, Alphonse; Pennella, Mario; Kong, Xiangming; David, Giedroc
Citation: Arunkumar, Alphonse; Pennella, Mario; Kong, Xiangming; Giedroc, David. "Resonance assignments of the metal sensor CzrA in the apo-, Zn2- and DNA-bound (42 kDa) states" Biomol. NMR Assignments 1, 99-101 (2007).
Assembly members:
CzrA_Chain, polymer, 106 residues, 11988.69 Da.
DNA, polymer, 28 residues, Formula weight is not available
Natural source: Common Name: Staphylococcus aureus Taxonomy ID: 1280 Superkingdom: Bacteria Kingdom: not available Genus/species: Staphylococcus aureus
Experimental source: Production method: recombinant technology Host organism: Escherichia coli
Entity Sequences (FASTA):
CzrA_Chain: MAEQYSEINTDTLERVTEIF
KALGDYNRIRIMELLSVSEA
SVGHISHQLNLSQSNVSHQL
KLLKSVHLVKAKRQGQSMIY
SLDDIHVATMLKQAIHHANH
PKESGL
DNA: TAACATATGAACATATGTTC
ATATGTTA
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 360 |
| 15N chemical shifts | 114 |
| 1H chemical shifts | 271 |
Additional metadata:
Related Database Links:
| BMRB | 15177 7376 |
| PDB | 1R1U 1R1V 2KJB 2KJC 2M30 4GGG |
| DBJ | BAA36687 BAB43231 BAB58307 BAB95934 BAF68321 |
| EMBL | CAG41214 CAG43856 CAI81718 CAQ50573 CBI50151 |
| GB | AAC32484 AAW38447 ABD21735 ABD31419 ABQ49963 |
| REF | NP_372669 NP_375252 NP_646886 WP_000003755 WP_000003756 |
Download simulated HSQC data in one of the following formats:
CSV: Backbone
or all simulated shifts
SPARKY: Backbone
or all simulated shifts