BMRB Entry 7403
Click here to enlarge.
PDB ID: 2qh2
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR7403
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of the CR7 terminal hairpin loop from human telomerase RNA PubMed: 17889661
Deposition date: 2007-08-30 Original release date: 2008-06-26
Authors: Feigon, J.; Theimer, C.; Chim, N; Breece, K.
Citation: Theimer, C.; Jady, B.; Chim, N.; Richard, P.; Breece, K.; Kiss, T.; Feigon, J.. "Structural and functional characterization of human telomerase RNA processing and cajal body localization signals" Mol. Cell 27, 869-881 (2007).
Assembly members:
Human_telomerase_RNA_CR7_terminal_hairpin_loop, polymer, 24 residues, Formula weight is not available
Natural source: Common Name: human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
Human_telomerase_RNA_CR7_terminal_hairpin_loop: GGAGUGCCUGAGCUGUGGCA
CUCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 191 |
| 15N chemical shifts | 54 |
| 1H chemical shifts | 178 |