BMRB Entry 27053
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR27053
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR chemical shift assignments of a 22mer G-quadruplex formed within the KRAS proto-oncogene promoter region PubMed: 28330874
Deposition date: 2017-03-23 Original release date: 2017-03-31
Authors: Salgado, Gilmar; Marquevielle, Julien; Kerkour, Abdelaziz; Mergny, Jean-Louis
Citation: Kerkour, Abdelaziz; Marquevielle, Julien; Ivashchenko, Stefaniia; Yatsunyk, Liliya; Mergny, Jean-Louis; Salgado, Gilmar. "High-resolution 3D NMR structure of the KRAS proto-oncogene promoter reveals key features of a G-quadruplex involved in transcriptional regulation" J. Biol. Chem. 292, 8082-8091 (2017).
Assembly members:
KRAS22RT, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
KRAS22RT: AGGGCGGTGTGGGAATAGGG
AA
- assigned_chemical_shifts
- spectral_peak_list
Data type | Count |
1H chemical shifts | 218 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | G4 within promoter region | 1 |
Entities:
Entity 1, G4 within promoter region 22 residues - Formula weight is not available
1 | DA | DG | DG | DG | DC | DG | DG | DT | DG | DT | ||||
2 | DG | DG | DG | DA | DA | DT | DA | DG | DG | DG | ||||
3 | DA | DA |
Samples:
sample_KRAS22RT: KRAS22RT 2.5 mM; KCl 90 mM; KPi 20 mM
sample_conditions_1: ionic strength: 110 mM; pH: 6.65; pressure: 1 atm; temperature: 293 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | sample_KRAS22RT | isotropic | sample_conditions_1 |
Software:
SPARKY, Goddard - chemical shift assignment
NMR spectrometers:
- Bruker Avance 700 MHz