BMRB Entry 34083
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34083
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: G-quadruplex formed within promoters of Plasmodium falciparum B var genes
Deposition date: 2017-01-09 Original release date: 2018-02-23
Authors: Juribasic Kulcsar, M.; Plavec, J.
Citation: Juribasic Kulcsar, M.; Gabelica, V.; Plavec, J.. "Stabilizing interactions in long-loop G-quadruplex formed within promoters of Plasmodium falciparum B var genes" . ., .-..
Assembly members:
entity_1, polymer, 34 residues, 10664.855 Da.
Natural source: Common Name: malaria parasite P. falciparum Taxonomy ID: 5833 Superkingdom: Eukaryota Kingdom: not available Genus/species: Plasmodium falciparum
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: CAGGGTTAAGGGTATAACTT
TAGGGGTTAGGGTT
- assigned_chemical_shifts
Data type | Count |
1H chemical shifts | 301 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entities:
Entity 1, entity_1 34 residues - 10664.855 Da.
1 | DC | DA | DG | DG | DG | DT | DT | DA | DA | DG | ||||
2 | DG | DG | DT | DA | DT | DA | DA | DC | DT | DT | ||||
3 | DT | DA | DG | DG | DG | DG | DT | DT | DA | DG | ||||
4 | DG | DG | DT | DT |
Samples:
sample_2: UpsB-Q-1, DNA (34-MER) 1.6 mM; potassium chloride 150 mM
sample_3: UpsB-Q-1, DNA (34-MER) 1.8 mM; potassium chloride 150 mM
sample_1: UpsB-Q-1, DNA (34-MER), 8% 13C, 8% 15N, 1 mM; potassium chloride 150 mM
sample_conditions_1: ionic strength: 150 mM; pH: 7.0; pressure: 1 atm; temperature: 308 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | sample_2 | anisotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_3 | anisotropic | sample_conditions_1 |
2D 1H-13C HMBC | sample_2 | anisotropic | sample_conditions_1 |
2D 1H-15N HSQC | sample_1 | anisotropic | sample_conditions_1 |
1D 1H-15N HSQC | sample_1 | anisotropic | sample_conditions_1 |
Software:
VNMR, Varian - chemical shift assignment, collection, processing
SPARKY, Goddard - peak picking
AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement
NMR spectrometers:
- Agilent-Varian Uniform NMR System 800 MHz
- Agilent-Varian Uniform NMR System 600 MHz