BMRB Entry 17592
Chem Shift validation: AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR17592
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Backbone assignments of Anabaena Sensory Rhodopsin Transducer with DNA PubMed: 21683709
Deposition date: 2011-04-13 Original release date: 2011-06-22
Authors: Wang, Shenlin; Kim, So Young; Jung, Kwang-Hwan; Ladizhansky, Vladimir; Brown, Leonid
Citation: Wang, Shenlin; Kim, So Young; Jung, Kwang-Hwan; Ladizhansky, Vladimir; Brown, Leonid. "A eukaryotic-like interaction of soluble cyanobacterial sensory rhodopsin transducer with DNA." J. Mol. Biol. 411, 449-462 (2011).
Assembly members:
ASRT, polymer, 124 residues, Formula weight is not available
DNA, polymer, 20 residues, Formula weight is not available
Natural source: Common Name: Anabaena variabilis Taxonomy ID: 1172 Superkingdom: Bacteria Kingdom: not available Genus/species: Anabaena variabilis
Experimental source: Production method: recombinant technology Host organism: Escherichia coli
Entity Sequences (FASTA):
ASRT: SLSIGRTCWAIAEGYIPPYG
NGPEPQFISHETVCILNAGD
EDAHVEITIYYSDKEPVGPY
RLTVPARRTKHVRFNDLNDP
APIPHDTDFASVIQSNVPIV
VQHTRLDSRQAENALLSTIA
YANT
DNA: ATGACCTTTAGGAGGAAAGA
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 306 |
| 15N chemical shifts | 93 |
| 1H chemical shifts | 93 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | Anabaena Sensory Rhodopsin Transducer | 1 |
| 2 | DNA | 2 |
Entities:
Entity 1, Anabaena Sensory Rhodopsin Transducer 124 residues - Formula weight is not available
| 1 | SER | LEU | SER | ILE | GLY | ARG | THR | CYS | TRP | ALA | ||||
| 2 | ILE | ALA | GLU | GLY | TYR | ILE | PRO | PRO | TYR | GLY | ||||
| 3 | ASN | GLY | PRO | GLU | PRO | GLN | PHE | ILE | SER | HIS | ||||
| 4 | GLU | THR | VAL | CYS | ILE | LEU | ASN | ALA | GLY | ASP | ||||
| 5 | GLU | ASP | ALA | HIS | VAL | GLU | ILE | THR | ILE | TYR | ||||
| 6 | TYR | SER | ASP | LYS | GLU | PRO | VAL | GLY | PRO | TYR | ||||
| 7 | ARG | LEU | THR | VAL | PRO | ALA | ARG | ARG | THR | LYS | ||||
| 8 | HIS | VAL | ARG | PHE | ASN | ASP | LEU | ASN | ASP | PRO | ||||
| 9 | ALA | PRO | ILE | PRO | HIS | ASP | THR | ASP | PHE | ALA | ||||
| 10 | SER | VAL | ILE | GLN | SER | ASN | VAL | PRO | ILE | VAL | ||||
| 11 | VAL | GLN | HIS | THR | ARG | LEU | ASP | SER | ARG | GLN | ||||
| 12 | ALA | GLU | ASN | ALA | LEU | LEU | SER | THR | ILE | ALA | ||||
| 13 | TYR | ALA | ASN | THR |
Entity 2, DNA 20 residues - Formula weight is not available
| 1 | DA | DT | DG | DA | DC | DC | DT | DT | DT | DA | |
| 2 | DG | DG | DA | DG | DG | DA | DA | DA | DG | DA |
Samples:
sample_1: ASRT, [U-100% 13C; U-100% 15N; U-50% 2H], 1 mM; H20 90%; D20 10%; Tris 50 mM; NaCl 50 mM
sample_2: ASRT, [U-100% 15N], 1 mM; H20 90%; D20 10%; Tris 50 mM; NaCl 50 mM
sample_conditions_1: ionic strength: 50 mM; pH: 7.2; pressure: 1 atm; temperature: 308 K
sample_conditions_2: ionic strength: 50 mM; pH: 7.2; pressure: 1 atm; temperature: 298 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_2 |
| 3D HNCO | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCA | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCACB | sample_1 | isotropic | sample_conditions_1 |
| 3D HN(CO)CA | sample_1 | isotropic | sample_conditions_1 |
| 3D 1H-15N NOESY | sample_1 | isotropic | sample_conditions_1 |
| 3D HN(CO)CACB | sample_1 | isotropic | sample_conditions_1 |
| 3D HN(CA)CO | sample_1 | isotropic | sample_conditions_1 |
Software:
TOPSPIN, Bruker Biospin - collection, processing
CARA v1.8.4, Keller and Wuthrich - chemical shift assignment, data analysis
NMR spectrometers:
- Bruker Avance 600 MHz
Download simulated HSQC data in one of the following formats:
CSV: Backbone
or all simulated shifts
SPARKY: Backbone
or all simulated shifts