BMRB Entry 17901
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17901
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Partial 1H, 13C, 15N Chemical Shift Assignments for the U6 Spliceosomal snRNA 5' Stem-Loop 30-mer Construct.
Deposition date: 2011-08-29 Original release date: 2011-09-28
Authors: Butcher, Samuel; Clos, Lawrence
Citation: Clos, Lawrence; Butcher, Samuel. "Partial 1H, 13C, 15N Chemical Shift Assignments for the U6 Spliceosomal snRNA 5' Stem-Loop 30-mer Construct." The BMRB entry is the only known published source for the data..
Assembly members:
U6_FSL_G1-29, polymer, 30 residues, Formula weight is not available
Natural source: Common Name: baker Taxonomy ID: 4932 Superkingdom: not available Kingdom: not available Genus/species: Eukaryota Fungi
Experimental source: Production method: enzymatic semisynthesis Host organism: Saccharomyces cerevisiae
Entity Sequences (FASTA):
U6_FSL_G1-29: GGUUCGCGAAGUAACCCUUC
GUGGACAUUU
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 17 |
| 15N chemical shifts | 12 |
| 1H chemical shifts | 36 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | U6 snRNA | 1 |
Entities:
Entity 1, U6 snRNA 30 residues - Formula weight is not available
Residue 1 was included for transcription purposes and should not be counted when comparing to S. cerevisiae U6 snRNA sequence.
| 1 | G | G | U | U | C | G | C | G | A | A | |
| 2 | G | U | A | A | C | C | C | U | U | C | |
| 3 | G | U | G | G | A | C | A | U | U | U |
Samples:
sample_1: U6 FSL G1-29, [U-13C; U-15N], 1.5 mM; DTT 10 uM; potassium phosphate 15 mM; H2O 90%; D2O 10%
sample_conditions_1: ionic strength: 15 mM; pH: 7.0; pressure: 1 atm; temperature: 283 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aliphatic | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aromatic | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
Software:
xwinnmr v3.5, Bruker Biospin - collection, processing
SPARKY v3.114, Goddard - chemical shift assignment, data analysis, peak picking
NMR spectrometers:
- Bruker Avance 750 MHz
- Bruker DMX 600 MHz