BMRB Entry 19662
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19662
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: NMR structure of the I-V kissing-loop interaction of the Neurospora VS ribozyme PubMed: 24325625
Deposition date: 2013-12-05 Original release date: 2014-01-10
Authors: Bouchard, Patricia; Legault, Pascale
Citation: Bouchard, Patricia; Legault, Pascale. "Structural insights into substrate recognition by the neurospora varkud satellite ribozyme: importance of u-turns at the kissing-loop junction." Biochemistry 53, 258-269 (2014).
Assembly members:
RNA_(5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3'), polymer, 22 residues, 7049.290 Da.
RNA_(5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3'), polymer, 21 residues, 6721.066 Da.
Natural source: Common Name: Neurospora crassa Taxonomy ID: 5141 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Neurospora crassa
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA_(5'-R(*GP*AP*GP*CP*AP*GP*CP*AP*UP*CP*GP*UP*CP*GP*GP*CP*UP*GP*CP*UP*CP*A)-3'): GAGCAGCAUCGUCGGCUGCU
CA
RNA_(5'-R(*GP*CP*GP*GP*CP*AP*GP*UP*UP*GP*AP*CP*UP*AP*CP*UP*GP*UP*CP*GP*C)-3'): GCGGCAGUUGACUACUGUCG
C
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 186 |
| 15N chemical shifts | 67 |
| 1H chemical shifts | 231 |