BMRB Entry 19698
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19698
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution NMR structure of a preQ1 Class II riboswitch from Streptococcus pneumoniae PubMed: 24469808
Deposition date: 2013-12-20 Original release date: 2014-01-27
Authors: Kang, Mijeong; Eichhorn, Catherine; Feigon, Juli
Citation: Kang, Mijeong; Eichhorn, Catherine; Feigon, Juli. "Structural determinants for ligand capture by a class II preQ1 riboswitch." Proc. Natl. Acad. Sci. U.S.A. 111, E663-E671 (2014).
Assembly members:
RNA_(59-MER), polymer, 59 residues, 18903.389 Da.
7-DEAZA-7-AMINOMETHYL-GUANINE, non-polymer, 179.179 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA_(59-MER): GCUUGGUGCUUAGCUUCUUU
CACCAAGCAUAUUACACGCG
GAUAACCGCCAAAGGAGAA
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 399 |
| 15N chemical shifts | 20 |
| 1H chemical shifts | 620 |