BMRB Entry 26842

Name: NMR resonance assignments for the tetramethylrhodamine binding RNA aptamer 3 in complex with the ligand 5-carboxy-tetramethylrhodamine
Published: 2016-10-13

Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR26842

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry

Nicholas Rego and David Koes
3Dmol.js: molecular visualization with WebGL
Bioinformatics (2015) 31 (8): 1322-1324 doi:10.1093/bioinformatics/btu829

Select model:

I am color blind

Download raw data. Direct link to this display. Help

Title: NMR resonance assignments for the tetramethylrhodamine binding RNA aptamer 3 in complex with the ligand 5-carboxy-tetramethylrhodamine PubMed: 27730489

Deposition date: 2016-07-01 Original release date: 2016-10-13

Authors: Elke, Duchardt-Ferner; Juen, Michael; Kreutz, Christoph; Wohnert, Jens

Citation: Duchardt-Ferner, Elke; Juen, Michael; Kreutz, Christoph; Wohnert, Jens. "NMR resonance assignments for the tetramethylrhodamine binding RNA aptamer 3 in complex with the ligand 5-carboxy-tetramethylrhodamine" Biomol. NMR Assign. 11, 29-34 (2017).

Assembly members:
TMR-3_48nt, polymer, 48 residues, Formula weight is not available

Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available

Experimental source: Production method: reverse transcriptase Host organism: Escherichia coli

Entity Sequences (FASTA):
TMR-3_48nt: GGACGACUGAACCGAAAGGU UCUUGGCUGCUUCGGCAGAG GUACGUCC

Data sets:

assigned_chemical_shifts
- assigned_chem_shift_list_1

Data type	Count
13C chemical shifts	382
15N chemical shifts	157
1H chemical shifts	415
31P chemical shifts	3

Additional metadata:

Assembly
Samples and Experiments
Software
Spectrometers
Hide all

Entity Assembly ID	Entity Name	Entity ID
1	TMR-3_48nt	1

Samples:

unlabeled_sample: TMR-3_48nt 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 5 v/v; sodium chloride 10 mM; Na-Glutamate 130 mM; H2O 95 v/v

13C-15N_sample: TMR-3_48nt, [U-13C; U-15N], 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 5 v/v; H2O 95 v/v; sodium chloride 10 mM; Na-Glutamate 130 mM

15N_sample: TMR-3_48nt, [U-15N], 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 5 v/v; H2O 95 v/v; sodium chloride 10 mM; K-glutamate 130 mM

A-C-13C-15N_sample_H2O: TMR-3_48nt, [U-13C; U-15N]-Ade,Cyt, 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 5 v/v; H2O 95 v/v; sodium chloride 10 mM; K-glutamate 130 mM

G-U-13C-15N_sample_H2O: TMR-3_48nt, [U-13C; U-15N]-Gua,Ura, 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 5 v/v; H2O 95 v/v; sodium chloride 10 mM; Na-Glutamate 130 mM

A-C-13C-15N_sample_D2O: TMR-3_48nt, [U-13C; U-15N]-Ade,Cyt, 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 100 v/v; sodium chloride 10 mM; K-glutamate 130 mM

G-U-13C-15N_sample_D2O: TMR-3_48nt, [U-13C; U-15N]-Gua,Ura, 1.2 ± 0.1 mM; 5-Carboxy-Tetramethylrhodamine 1.4 ± 0.2 mM; D2O 100 v/v; sodium chloride 10 mM; Na-Glutamate 130 mM

283K: ionic strength: 0.41 M; pH: 7.5; pressure: 1 atm; temperature: 283 K

298K: ionic strength: 0.28 M; pH: 7.5; pressure: 1 atm; temperature: 283 K

Experiments:

Name	Sample	Sample state	Sample conditions
3D 1H-13C NOESY aromatic	13C-15N_sample	isotropic	298K
3D 1H-13C NOESY aliphatic	13C-15N_sample	isotropic	298K
3D 1H-13C NOESY aromatic	A-C-13C-15N_sample_H2O	isotropic	298K
3D 1H-13C NOESY aliphatic	A-C-13C-15N_sample_D2O	isotropic	298K
3D 1H-13C NOESY aromatic	G-U-13C-15N_sample_H2O	isotropic	298K
3D 1H-13C NOESY aliphatic	G-U-13C-15N_sample_D2O	isotropic	298K
2D 1H-1H NOESY	15N_sample	isotropic	283K
2D 1H-15N HSQC	15N_sample	isotropic	283K
2D 1H-15N HSQC NH2 only	15N_sample	isotropic	283K
SELLR HNN-COSY	15N_sample	isotropic	298K
HNN-COSY	15N_sample	isotropic	298K
amino HNN-COSY	15N_sample	isotropic	298K
H1/H8 13C-HMBC	G-U-13C-15N_sample_H2O	isotropic	298K
2D H5(C5C4N3)H3	G-U-13C-15N_sample_H2O	isotropic	298K
2D H5(C5C4N4)H4	A-C-13C-15N_sample_H2O	isotropic	298K
2D H(C)N aromatic	A-C-13C-15N_sample_D2O	isotropic	298K
2D H(C)N aliphatic	A-C-13C-15N_sample_D2O	isotropic	298K
2D H(C)N aromatic	G-U-13C-15N_sample_D2O	isotropic	298K
2D H(C)N aliphatic	G-U-13C-15N_sample_D2O	isotropic	298K
3D HCCH-TOCSY	A-C-13C-15N_sample_D2O	isotropic	298K
3D HCCH-TOCSY	G-U-13C-15N_sample_D2O	isotropic	298K
3D HCCH-COSY	A-C-13C-15N_sample_D2O	isotropic	298K
3D HCCH-COSY	G-U-13C-15N_sample_D2O	isotropic	298K
2D H(N)CO	G-U-13C-15N_sample_H2O	isotropic	298K
H6-C2/C4 lr13C-HSQC	unlabeled_sample	isotropic	298K
H5-N3 lr15N-HSQC	G-U-13C-15N_sample_H2O	isotropic	298K
TROSY relayed HCCH COSY	A-C-13C-15N_sample_D2O	isotropic	298K
2D H(C)P	A-C-13C-15N_sample_D2O	isotropic	298K
2D H(C)P	G-U-13C-15N_sample_D2O	isotropic	298K

Biological Magnetic Resonance Data Bank

BMRB Entry 26842

Title: NMR resonance assignments for the tetramethylrhodamine binding RNA aptamer 3 in complex with the ligand 5-carboxy-tetramethylrhodamine PubMed: 27730489

Additional metadata:

Assembly:

Entities:

Samples:

Experiments:

Software:

NMR spectrometers: