BMRB Entry 28094
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR28094
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution NMR structure of 5'UTR of Stem loop B in DENV4 PubMed: 32807496
Deposition date: 2020-03-06 Original release date: 2020-08-18
Authors: Sharma, Shrikant; Varani, Gabriele
Citation: Sharma, Shrikant; Varani, Gabriele. "NMR structure of Dengue West Nile viruses stem-loop B: A key cis-acting element for flavivirus replication" Biochem. Biophys. Res. Commun. ., .-. (2020).
Assembly members:
DENV4, polymer, 41 residues, Formula weight is not available
Natural source: Common Name: Flavivirus Taxonomy ID: 11051 Superkingdom: Viruses Kingdom: not available Genus/species: Flavivirus not available
Experimental source: Production method: reverse transcriptase Host organism: Dengue virus
Entity Sequences (FASTA):
DENV4: GGUUUGUUUGAAUAGAGAGC
AGAUCUCUGGAAAAAUGAAC
C
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 265 |
15N chemical shifts | 18 |
1H chemical shifts | 327 |
Additional metadata:
Assembly:
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | 5_prime_UTR | 1 |
Entities:
Entity 1, 5_prime_UTR 41 residues - Formula weight is not available
1 | G | G | U | U | U | G | U | U | U | G | ||||
2 | A | A | U | A | G | A | G | A | G | C | ||||
3 | A | G | A | U | C | U | C | U | G | G | ||||
4 | A | A | A | A | A | U | G | A | A | C | ||||
5 | C |
Samples:
sample_1: DENV4, [U-99% 13C; U-99% 15N], 0.75 mM; sodium phosphate 20 mM
sample_conditions_1: ionic strength: 20 mM; pH: 6.0; pressure: 1 atm; temperature: 293 K
Experiments:
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-13C HSQC aromatic | sample_1 | isotropic | sample_conditions_1 |
Software:
SPARKY, Goddard - chemical shift assignment
NMR spectrometers:
- Bruker Avance 600 MHz
- Bruker Avance 800 MHz