BMRB Entry 30402
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30402
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Hybrid-2 form Human Telomeric G Quadruplex in Complex with Epiberberine PubMed: 29888501
Deposition date: 2018-02-07 Original release date: 2018-06-21
Authors: Lin, C.; Yang, D.
Citation: Lin, C.; Wu, G.; Wang, K.; Onel, B.; Sakai, S.; Shao, Y.; Yang, D.. "Molecular Recognition of the Hybrid-2 Human Telomeric G-quadruplex by Epiberberine: Insights into Conversion of Telomeric G-quadruplex Structures." Angew. Chem. Int. Ed. Engl. 57, 10888-10893 (2018).
Assembly members:
entity_1, polymer, 26 residues, 8200.269 Da.
entity_EWV, non-polymer, 336.361 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TTAGGGTTAGGGTTAGGGTT
AGGGTT
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 285 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
| 2 | entity_2 | 2 |
Entities:
Entity 1, entity_1 26 residues - 8200.269 Da.
| 1 | DT | DT | DA | DG | DG | DG | DT | DT | DA | DG | ||||
| 2 | DG | DG | DT | DT | DA | DG | DG | DG | DT | DT | ||||
| 3 | DA | DG | DG | DG | DT | DT |
Entity 2, entity_2 - C20 H18 N O4 - 336.361 Da.
| 1 | EWV |
Samples:
sample_1: DNA (26-MER) 880 uM; epiberberine 880 uM
sample_conditions_1: ionic strength: 100 mM; pH: 7; pressure: 1 atm; temperature: 298 K
sample_conditions_2: ionic strength: 100 mM; pH: 7; pressure: 1 atm; temperature: 288 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | anisotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | anisotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | anisotropic | sample_conditions_2 |
Software:
SPARKY, Goddard - chemical shift assignment, peak picking
InsightII, Accelrys Software Inc. - structure calculation
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement
NMR spectrometers:
- Bruker Avance 600 MHz