BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 6320

Title: 1H, 13C, 15N chemical shift assignments for extended 3' internal stem-loop RNA from S. cerevisiae U6 snRNA   PubMed: 15543154

Authors: Sashital, Dipali; Cornilescu, Gabriel; Butcher, Samuel

Citation: Sashital, Dipali; Cornilescu, Gabriel; McManus, C.; Brow, D.; Butcher, Samuel. "U2-U6 RNA folding reveals a group II intron-like domain and a four-helix junction"  Nat. Struct. Mol. Biol. 11, 1237-1242 (2004).

Assembly members:
U6 extended ISL, polymer, 32 residues, Formula weight is not available

Natural source:   Common Name: baker   Taxonomy ID: 4932   Superkingdom: not available   Kingdom: not available   Genus/species: Eukaryota Fungi

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):
U6 extended ISL: GAGCAGUUCCCCUGCAUAAG GAUGAACCGUUC

Data sets:
Data typeCount
13C chemical shifts189
15N chemical shifts14
1H chemical shifts272

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1U6 extended ISL1

Entities:

Entity 1, U6 extended ISL 32 residues - Formula weight is not available

1   GAGCAGUUCC
2   CCUGCAUAAG
3   GAUGAACCGU
4   UC

Samples:

sample_1: U6 extended ISL, [U-13C; U-15N], 1 mM

sample_conditions_1: pH: 6.9; temperature: 283 K

sample_conditions_2: pH: 7.5; temperature: 303 K

sample_conditions_3: pH: 6.9; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D NOESYsample_1not availablenot available
2D TOCSYsample_1not availablenot available
3D [1H-13C-1H] NOESY HMQCsample_1not availablenot available
3D [1H-13C-1H] HCCH-TOCSYsample_1not availablenot available
3D [1H-13C-1H] HCCH-COSYsample_1not availablenot available
J-Modulated CT-HSQCsample_1not availablenot available

Software:

SPARKY v3.105 -

NMR spectrometers:

  • Bruker DMX 600 MHz
  • Varian Inova 600 MHz
  • Bruker DMX 750 MHz
  • Varian Inova 800 MHz

Related Database Links: