BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

Home
Search
Validation Tools
Deposit Data
NMR Statistics
Spectroscopists' Corner
Programmers' Corner
Metabolomics
Educational Outreach
NMR Data Formats
Useful NMR Links
Site Map
FTP Access

BMRB Entry 7307

Chem Shift validation: AVS_full
BMRB number (explain)


NMR-STAR v3.1 file: bmr7307.str
NMR-STAR v2.1 file: bmr7307.str

Title: Backbone assignment and RDCs of L11 in complex with RNA   PubMed: 17169991

Authors: Jonker, Henry; Ilin, Serge; Grimm, Steffen; Wohnert, Jens; Schwalbe, Harald

Citation: Jonker, Henry; Ilin, Serge; Grimm, Steffen; Wohnert, Jens; Schwalbe, Harald. "L11 domain rearrangement upon binding to RNA and thiostrepton studied by NMR spectroscopy."  Nucleic Acids Res. 35, 441-454 (2007).

Assembly members:
ribosomal L11 protein, polymer, 141 residues, 15088 Da.
23S GAR RNA, polymer, 60 residues, 19258 Da.

Natural source:   Common Name: Thermotoga maritima   Taxonomy ID: 2336   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Thermotoga maritima

Experimental source:   Production method: recombinant technology

Entity Sequences (FASTA):
ribosomal L11 protein: MAKKVAAQIKLQLPAGKATP APPVGPALGQHGVNIMEFCK RFNAETADKAGMILPVVITV YEDKSFTFIIKTPPASFLLK KAAGIEKGSSEPKRKIVGKV TRKQIEEIAKTKMPDLNANS LEAAMKIIEGTAKSMGIEVV D
23S GAR RNA: GGGCAGGAUGUAGGCUUAGA AGCAGCCAUCAUUUAAAGAA AGCGUAAUAGCUCACUGCCC

Data sets:
Data typeCount
13C chemical shifts256
15N chemical shifts127
1H chemical shifts127
residual dipolar couplings127

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all