BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 7307

Title: Backbone assignment and RDCs of L11 in complex with RNA   PubMed: 17169991

Authors: Jonker, Henry; Ilin, Serge; Grimm, Steffen; Wohnert, Jens; Schwalbe, Harald

Citation: Jonker, Henry; Ilin, Serge; Grimm, Steffen; Wohnert, Jens; Schwalbe, Harald. "L11 domain rearrangement upon binding to RNA and thiostrepton studied by NMR spectroscopy."  Nucleic Acids Res. 35, 441-454 (2007).

Assembly members:
ribosomal L11 protein, polymer, 141 residues, 15088 Da.
23S GAR RNA, polymer, 60 residues, 19258 Da.

Natural source:   Common Name: Thermotoga maritima   Taxonomy ID: 2336   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Thermotoga maritima

Experimental source:   Production method: recombinant technology

Entity Sequences (FASTA):
ribosomal L11 protein: MAKKVAAQIKLQLPAGKATP APPVGPALGQHGVNIMEFCK RFNAETADKAGMILPVVITV YEDKSFTFIIKTPPASFLLK KAAGIEKGSSEPKRKIVGKV TRKQIEEIAKTKMPDLNANS LEAAMKIIEGTAKSMGIEVV D
23S GAR RNA: GGGCAGGAUGUAGGCUUAGA AGCAGCCAUCAUUUAAAGAA AGCGUAAUAGCUCACUGCCC

Data sets:
Data typeCount
13C chemical shifts256
15N chemical shifts127
1H chemical shifts127
residual dipolar couplings127

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1L11 protein1
2GAR RNA2

Entities:

Entity 1, L11 protein 141 residues - 15088 Da.

1-141, Thermotoga maritima

1   METALALYSLYSVALALAALAGLNILELYS
2   LEUGLNLEUPROALAGLYLYSALATHRPRO
3   ALAPROPROVALGLYPROALALEUGLYGLN
4   HISGLYVALASNILEMETGLUPHECYSLYS
5   ARGPHEASNALAGLUTHRALAASPLYSALA
6   GLYMETILELEUPROVALVALILETHRVAL
7   TYRGLUASPLYSSERPHETHRPHEILEILE
8   LYSTHRPROPROALASERPHELEULEULYS
9   LYSALAALAGLYILEGLULYSGLYSERSER
10   GLUPROLYSARGLYSILEVALGLYLYSVAL
11   THRARGLYSGLNILEGLUGLUILEALALYS
12   THRLYSMETPROASPLEUASNALAASNSER
13   LEUGLUALAALAMETLYSILEILEGLUGLY
14   THRALALYSSERMETGLYILEGLUVALVAL
15   ASP

Entity 2, GAR RNA 60 residues - 19258 Da.

1050-1109, based on Escherichia coli 23S rRNA (U1061A)

1   GGGCAGGAUG
2   UAGGCUUAGA
3   AGCAGCCAUC
4   AUUUAAAGAA
5   AGCGUAAUAG
6   CUCACUGCCC

Samples:

L11+RNA: ribosomal L11 protein, [U->95% 2D; U->98% 15N; U->98% 13C], 0.3 mM; 23S GAR RNA 0.5 mM; potassium phosphate 20 mM; potassium chloride 200 mM; complete; superase

25C: pH: 6.1; temperature: 298 K

35C: pH: 6.1; temperature: 308 K

Experiments:

NameSampleSample stateSample conditions
2D (1H,15N)HSQCL11+RNAnot availablenot available
3D HNCOL11+RNAnot availablenot available
3D HNCAL11+RNAnot availablenot available

Software:

NMRPipe, Delaglio et al. - processing

SPARKY v3, Goddard et al. - analysis & assignment

NMR spectrometers:

  • Bruker DRX 600 MHz
  • Bruker Avance 600 MHz

Related Database Links:

BMRB 5513
PDB 1EG0 1GIY 1JQM 1JQS 1JQT 1MJ1 1ML5 1MMS 1MVR 1OLN 1PN7 1PN8 1R2W 1R2X 1YL3 2B66 2B9N 2B9P 2JQ7 2K3F 487D
EMBL CAA77859
GB AAD35537 ABQ46490 ACB08837 ADA66341 AGL49376
REF NP_228264 WP_004081512 WP_011943108 YP_001244066 YP_001738520
SP A5IJW7 B1L939 P29395