BMRB Entry 7307

Chem Shift validation: AVS_full
BMRB number (explain)


NMR-STAR v3.1 file: bmr7307.str
NMR-STAR v2.1 file: bmr7307.str

Title: Backbone assignment and RDCs of L11 in complex with RNA   PubMed: 17169991

Authors: Jonker, Henry; Ilin, Serge; Grimm, Steffen; Wohnert, Jens; Schwalbe, Harald

Citation: Jonker, Henry; Ilin, Serge; Grimm, Steffen; Wohnert, Jens; Schwalbe, Harald. "L11 domain rearrangement upon binding to RNA and thiostrepton studied by NMR spectroscopy."  Nucleic Acids Res. 35, 441-454 (2007).

Assembly members:
ribosomal L11 protein, polymer, 141 residues, 15088 Da.
23S GAR RNA, polymer, 60 residues, 19258 Da.

Natural source:   Common Name: Thermotoga maritima   Taxonomy ID: 2336   Superkingdom: Bacteria   Kingdom: not available   Genus/species: Thermotoga maritima

Experimental source:   Production method: recombinant technology

Entity Sequences (FASTA):
ribosomal L11 protein: MAKKVAAQIKLQLPAGKATP APPVGPALGQHGVNIMEFCK RFNAETADKAGMILPVVITV YEDKSFTFIIKTPPASFLLK KAAGIEKGSSEPKRKIVGKV TRKQIEEIAKTKMPDLNANS LEAAMKIIEGTAKSMGIEVV D
23S GAR RNA: GGGCAGGAUGUAGGCUUAGA AGCAGCCAUCAUUUAAAGAA AGCGUAAUAGCUCACUGCCC

Data sets:
Data typeCount
13C chemical shifts256
15N chemical shifts127
1H chemical shifts127
residual dipolar couplings127

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Related Database Links:

BMRB 5513
PDB 1EG0 1GIY 1JQM 1JQS 1JQT 1MJ1 1ML5 1MMS 1MVR 1OLN 1PN7 1PN8 1R2W 1R2X 1YL3 2B66 2B9N 2B9P 2JQ7 2K3F 487D
EMBL CAA77859
GB AAD35537 ABQ46490 ACB08837 ADA66341 AGL49376
REF NP_228264 WP_004081512 WP_011943108 YP_001244066 YP_001738520
SP A5IJW7 B1L939 P29395