BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 17655

Title: Structure of Human Telomeric DNA in Crowded Solution

Deposition date: 2011-05-17 Original release date: 2011-08-02

Authors: Heddi, Brahim; Phan, Anh Tuan

Citation: Heddi, Brahim; Phan, Anh Tuan. "Structure of Human Telomeric DNA in Crowded Solution"  J. Am. Chem. Soc. ., .-..

Assembly members:
DNA_(5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*G)-3')_, polymer, 23 residues, 7287.750 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
DNA_(5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*G)-3')_: TAGGGTTAGGGTTAGGGTTA GGG

Data sets:
Data typeCount
1H chemical shifts175

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all