BMRB Entry 34484
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34484
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Constitutive decay element CDE2 from human 3'UTR
Deposition date: 2020-01-27 Original release date: 2020-05-25
Authors: Schwalbe, H.; Binas, O.
Citation: Binas, O.; Tants, J.; Peter, S.; Janowski, R.; Davydova, E.; Braun, J.; Niessing, D.; Schwalbe, H.; Weigand, J.; Schlundt, A.. "Structural basis for the recognition of transiently structured AU-rich elements by Roquin" Nucleic Acids Res. ., .-. (2020).
Assembly members:
entity_1, polymer, 21 residues, 6690.004 Da.
Natural source: Common Name: Thermosinus carboxydivorans Nor1 Taxonomy ID: 401526 Superkingdom: Bacteria Kingdom: not available Genus/species: Thermosinus carboxydivorans
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGUGCCUAAUAUUUAGGCAC
C
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 94 |
1H chemical shifts | 159 |