BMRB Entry 5371
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5371
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: U6 RNA chemical shifts PubMed: 11992125
Deposition date: 2002-05-09 Original release date: 2002-08-22
Authors: Butcher, Samuel
Citation: Huppler, Anna; Nikstad, Laura; Allmann, Anne; Brow, David; Butcher, Samuel. "Metal binding and base ionization in the U6 RNA intramolecular stem-loop structure" Nat. Struct. Biol. 9, 431-435 (2002).
Assembly members:
U6 RNA, polymer, 24 residues, Formula weight is not available
Natural source: Common Name: Baker Taxonomy ID: 4932 Superkingdom: not available Kingdom: not available Genus/species: Eukaryota Fungi
Experimental source: Production method: recombinant technology
Entity Sequences (FASTA):
U6 RNA: GGUUCCCCUGCAUAAGGAUG
AACC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 41 |
| 15N chemical shifts | 14 |
| 1H chemical shifts | 211 |