BMRB Entry 5834
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5834
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of the HIV-1 frameshift inducing stem-loop RNA PubMed: 12888491
Deposition date: 2003-06-17 Original release date: 2003-09-12
Authors: Staple, David; Butcher, Samuel
Citation: Staple, David; Butcher, Samuel. "Solution Structure of the HIV-1 Frameshift Inducing Stem-loop RNA" Nucleic Acids Res. 31, 4326-4331 (2003).
Assembly members:
HIV-1 frameshift inducing stem-loop RNA, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: HIV Taxonomy ID: 12721 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
HIV-1 frameshift inducing stem-loop RNA: GGCCUUCCCACAAGGGAAGG
CC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 59 |
| 15N chemical shifts | 31 |
| 1H chemical shifts | 155 |