BMRB 1H Chemical Shift Entries

listed by the number of 1H chemical shifts in descending order

Number of entries returned: 12855

Retrieve entries as a: Compressed file

Query result listed by the number of 1H chemical shifts in descending order:

Accession number	System name	1H shifts	13C shifts	15N shifts	31P shifts	Protein	DNA	RNA
26960	MAP2c	2354	1807	464	0	X
19135	MAP2c	2005	1847	465	0	X
7114	E. coli maltose binding protein	1981	1605	373	0	X
19219	Yeast Rpn9	1818	1513	396	0	X
30275	Histone H2A, Polyubiquitin-B, E3 ubiquitin-protein ligase RNF169 (E.C.2.3.2.27)	1752	1268	319	0	X
16715	Vaccinia_Related-Kinase_1	1694	1170	337	0	X
16738	VRK1	1694	1170	337	0	X
17416	LpxC/CHIR-090	1689	1095	266	0	X
15578	MMP12_HUMAN	1664	1326	375	0	X
30080	Protein-export protein SecB, Alkaline phosphatase (E.C.3.1.3.1)	1663	3011	926	0	X
28042	ubiquitin receptor	1626	1165	207	0	X
17250	GNA1946	1597	1186	282	0	X
30528	26S proteasome non-ATPase regulatory subunit 4, Ubiquilin-2	1594	851	279	0	X
5627	A. aeolicus UDP-3-O-acyl-GlcNAc deacetylase in complex with TU-514	1559	902	266	0	X
17608	RLIP76-GAP-GBD	1527	1122	269	0	X
25432	TOG	1499	1120	253	0	X
19491	Galectin-3	1467	1260	336	0	X
18169	Ca-bound S100A4 in complex with non-muscle myosin IIA	1438	914	204	0	X
6807	Maltodextrin-binding protein (MBP)	1433	1035	360	0	X
15525	RLIP76	1429	1007	250	0	X
16063	ILK/PINCH complex	1426	787	265	0	X
4264	Phosphotransferase system, enzyme I	1426	1255	354	0	X
15369	ribosome-inactivating proteins (RIP)	1420	1009	241	0	X
27230	ELP40	1412	1236	414	0	X
19069	EFGP	1407	1036	245	0	X
6395	DivIB monomer	1404	973	242	0	X
25829	p75NTR DD:RhoGDI	1403	878	257	0	X
16481	pfLamA (50% Ca2+)	1396	1044	260	0	X
19551	hFKBP25 monomer	1394	945	229	0	X
6810	C'-RcsC	1389	1068	241	0	X
34101	Breakpoint cluster region protein (E.C.2.7.11.1)	1386	1008	210	0	X
34121	Lysostaphin (E.C.3.4.24.75)	1384	763	245	0	X
7105	SRY.B in complex with 16-mer DNA	1377	619	163	0	X	X
5823	RPA70(181-422) ssDNA binding domains	1372	1036	248	0	X
17126	Heparanase 158-417	1369	797	258	0	X
34226	CaM/Kv7.2-hAB Complex	1366	991	239	0	X
16058	Factor H-binding Protein	1365	932	257	0	X
6752	PH-PDZ tandem of alpha-syntrophin	1364	647	245	0	X
34326	Dosage compensation regulator (E.C.3.6.4.13)	1357	1015	280	0	X
30074	Dynein light chain Tctex-type 1	1356	808	268	0	X
16677	interferon-receptor complex	1351	0	285	0	X
17479	human_SBDS	1350	953	248	0	X
30326	Phosphoenolpyruvate-protein phosphotransferase (E.C.2.7.3.9)	1349	800	240	0	X
18853	LpoA_n-ter	1348	1036	265	0	X
11073	JHBP-JH III complex	1347	1049	242	0	X
30081	Protein-export protein SecB, Alkaline phosphatase (E.C.3.1.3.1)	1346	2334	618	0	X
17826	galectin-7	1332	1045	264	0	X
10145	Rho GTPase activating protein 5 variant	1329	990	222	0	X
27048	MS1	1328	1077	259	0	X
11010	Rac1/HR1b complex	1327	970	248	0	X
27078	ScLPMO10C	1323	1573	463	0	X
18521	Vta1-Vps60 complex	1315	926	232	0	X
30084	Protein-export protein SecB, Alkaline phosphatase (E.C.3.1.3.1)	1314	2350	622	0	X
16021	hJHBP	1313	1048	242	0	X
25958	p63/p73 hetero-tetramerisation domain	1310	950	218	0	X
26841	ID3	1302	1092	365	0	X
5316	gag	1298	1138	273	0	X
30082	Protein-export protein SecB, Alkaline phosphatase (E.C.3.1.3.1)	1296	2276	640	0	X
27989	trichobakin	1288	995	247	0	X
19047	BcII	1287	710	235	0	X
19048	BcII	1280	730	231	0	X
4700	Cdc42 + fragment of PAK	1276	741	224	0	X
25043	Most two C-terminal RNA Recognition Motif Domain of hnRNP L bound to two equivalents ACACA RNA	1276	700	223	0	X		X
25485	PRO Form of Human Matrilysin (proMMP-7)	1274	1003	237	0	X
16606	kI O18/O8 Y87H	1270	904	228	0	X
10144	Rho GTPase activating protein 5 variant	1270	955	215	0	X
16607	AL-09 H87Y	1269	906	229	0	X
15028	Trx-ArsC complex	1265	740	249	0	X
18044	eight-stranded (beta/alpha)-barrel	1262	904	217	0	X
7125	HbCO A	1261	856	270	0	X
4384	Capsid protein from Rous Sarcoma Virus	1261	1067	241	0	X
34037	Beta-nerve growth factor	1254	1008	246	0	X
30083	Protein-export protein SecB, Alkaline phosphatase (E.C.3.1.3.1)	1250	2362	666	0	X
15158	Bd37	1243	847	278	0	X
5686	HP1043	1242	872	208	0	X
15637	CXCL12/SDF1-alpha, CXCR4	1242	852	211	0	X
4030	apo-recoverin	1241	827	207	0	X
26740	CtErbB2	1241	994	267	0	X
15636	CXCL12/SDF1-alpha, CXCR4	1240	850	212	0	X
15635	CXCL12/SDF1-alpha, CXCR4	1240	850	212	0	X
27677	RBBP1 PWWP-ARID domain	1237	906	225	0	X
30375	Protein IMPACT homolog	1235	921	244	0	X
5770	Ca2+/calmodulin-glutamate decarboxylase peptide complex	1229	908	210	0	X
16108	single polypeptide	1227	365	258	0	X
30086	Protein-export protein SecB, Maltose-binding periplasmic protein	1214	2550	686	0	X
7242	Uroporphyrinogen-III-Synthase (URO-synthase)	1211	789	241	0	X
25556	MRG15-MRGBP complex	1210	925	217	0	X
4848	N-terminal domain of 5-enolpyruvyl shikimate-3-phosphate synthase	1206	906	218	0	X
34421	Double-stranded RNA-binding protein Staufen homolog 1/RNA Complex	1205	848	156	0	X		X
25242	Sk45mNoTag	1204	488	225	0	X
17738	HIV-1 CA	1204	902	214	0	X
10004	2'-5' RNA ligase-like protein	1202	898	192	0	X
17633	BC28.1	1197	671	224	0	X
17501	NP_344798.1	1197	834	208	0	X
18517	EDK-delta-Bd37	1196	693	208	0	X
4402	human prion protein hPrP(23-230)	1193	600	246	0	X
11012	p63BDB	1188	877	215	0	X
4311	human T-cell leukemia virus type I capsid monomer	1186	904	208	0	X
17711	SMN-Gemin2 complex	1183	909	206	0	X
4193	Adenylate kinase/AP5A complex	1182	859	220	0	X
19067	Solution structure of latherin	1181	917	205	0	X
19842	eIF4G HEAT2 domain	1181	889	207	0	X
30093	Two-component sensor histidine kinase, Circadian clock protein KaiB	1179	932	200	0	X
16632	Kalirin	1178	897	199	0	X
18462	Kaiso	1176	607	164	0	X	X
30353	Talin-1, Ras-related protein Rap-1b	1173	869	234	0	X
11061	APOBEC2	1171	837	183	0	X
17717	NMR Structure of Mouse ApoAI(1-216)	1167	660	230	0	X
19589	RhoGAP	1167	853	210	0	X
4553	Inserted domain of the leukocyte function associated antigen-1 in the presence of magnesium	1166	690	191	0	X
15607	At3g16450	1165	766	300	0	X
16237	OmpATb	1164	579	235	0	X
17784	PhyRSL-NepR complex	1163	831	212	0	X
25833	p75NTR DD:RIP2 CARD	1159	675	225	0	X
16613	SUD-MC	1159	675	201	0	X
34182	PC4 and SFRS1-interacting protein,Protein IWS1 homolog	1155	850	214	0	X
19290	NMR structure of human TDP-43 tandem RRMs in complex with UG-rich RNA	1155	864	182	11	X		X
26801	NFU1	1154	680	196	0	X
19836	E. coli Trigger Factor in complex with unfolded PhoA1-150	1154	565	479	0	X
19854	Mengovirus Leader Protein Bound to Ran GTPase	1150	899	294	0	X
19518	RLC/MyBS	1148	788	203	0	X
18682	LIP5-CHMP5	1147	651	228	0	X
17260	UCHL1 S18Y variant	1146	842	236	0	X
15290	Cog2p monomer	1145	846	205	0	X
4867	NUCLEOLIN RBD12/RNA COMPLEX	1144	628	192	0	X		X
19952	StAR D6	1143	878	201	0	X
25766	Zmp1	1140	804	221	0	X
19107	Phl p 5a	1140	936	217	0	X
4106	N-terminal Domain of Enzyme I	1140	769	29	0	X
18211	Lotus domains 2 and 3	1140	834	179	0	X
15393	H2A.Z-H2B-Chz1 complex	1139	979	251	0	X
16689	PshDsbA	1138	880	200	0	X
25554	nucleotide-free Ran GTPase	1137	874	294	0	X
27151	hGMPK	1137	812	196	0	X
19852	NUCLEOTIDE-FREE HUMAN RAN GTPASE	1137	874	294	0	X
17202	Tandem SH2 domains of Spt6	1136	611	207	0	X
18934	Binary complex of African Swine Fever Virus Pol X with MgdGTP	1135	796	180	0	X
16213	MESD	1133	599	190	0	X
6159	DdCAD-1 monomer	1132	629	229	0	X
19045	BID-BAK complex	1131	556	176	0	X
34201	Histone chaperone ASF1, histone acetyltransferase Rtt109 C-terminus (E.C.2.3.1.48)	1130	750	176	0	X
6241	josephin domain of ataxin-3	1129	814	203	0	X
16266	Pfu RPP29-RPP21 complex	1127	909	204	0	X
18000	MRG	1125	870	204	0	X
18303	PfPMT	1125	893	253	0	X
19689	SiCYS	1125	788	201	0	X
27876	PilF 294-482 + c-di-GMP	1123	852	177	0	X
6295	flavin domain of methane monooxygenase reductase	1120	935	247	0	X
30085	Protein-export protein SecB, Maltose-binding periplasmic protein	1118	2282	602	0	X
15063	ThTPase_mouse	1118	876	229	0	X
34347	PROTEIN	1118	934	237	0	X
16678	Sensory Rhodopsin II	1116	1004	239	0	X
25482	GTP:adenosylcobinamide-phosphate guanylyltransferase (CobY)	1112	705	156	0	X
4101	cutinase	1110	905	230	0	X
15932	Procaspase-8	1110	922	209	0	X
17127	IGF-II in complex with the mutant form of human domain 11	1110	768	215	0	X
27313	HusA monomer	1107	622	201	0	X
15615	F0F1	1104	791	192	0	X
5576	nbd-min001	1103	649	194	0	X
6148	Prx VI monomer	1102	586	202	0	X
30450	Alginate biosynthesis protein AlgF	1098	815	190	0	X
11147	High mobility group protein B1	1098	769	168	0	X
15061	intein precursor polypeptide	1097	788	194	0	X
15935	Pfu RPP29d17-RPP21V14 complex	1091	838	171	0	X
6823	HRV14-3C	1091	802	184	0	X
30590	Uncharacterized protein, Polyubiquitin-B, Anaphase-promoting complex subunit 2	1090	758	221	0	X
4854	N-terminal domain of 5-enolpyruvyl shikimate-3-phosphate synthase	1090	867	195	0	X
4070	FimC	1088	864	227	0	X
5756	fluorescein-binding lipocalin	1088	809	185	0	X
5577	sodium/potassium-transporting ATPase alpha-1 chain (E.C.3.6.3.9)	1087	659	187	0	X
17521	BamC	1086	941	243	0	X
4099	S100B-Ca(2+)-p53_peptide_complex	1086	594	186	0	X
19325	26S proteasome subunit monomer	1086	811	208	0	X
25379	PsbP	1084	749	194	0	X
25040	most two C-terminal RNA Recognition Motif Domain of hnRNP L	1083	587	216	0	X
18728	UP1	1083	801	198	0	X
18663	The third member of the eIF4E family represses gene expression via a novel mode of recognition of the methyl-7 guanosine cap mo	1083	620	207	0	X
17080	Shc-PTB complex with Integrin beta3	1082	720	181	0	X
34376	Rhomboid family serine protease	1081	773	192	0	X
30150	Bcl-2-like protein 1	1081	647	209	0	X
27301	Scm3	1081	754	203	0	X
4267	apo-HNGAL Human Neutrophil Gelatinase-Associated Lipocalin	1080	737	188	0	X
6742	ataxin-3 josephin domain	1079	750	199	0	X
15313	single polypeptide chain	1079	801	199	0	X
34248	Pre-rRNA-processing protein TSR2, 40S ribosomal protein S26-A	1079	631	200	0	X
18667	Solution structure of eIF4E3 in complex with m7GDP	1077	831	203	0	X
4376	VATN VCP-like ATPase of Thermoplasma N-domain	1077	785	183	0	X
15925	FLNa18-19	1075	761	174	0	X
17418	Pab PolII intein	1074	585	183	0	X
4564	Bovine prion protein fragment 23-230	1073	483	226	0	X
19735	TIA-1 RRM2,3 monomer	1073	767	198	0	X
19598	WHEP repeats	1072	768	211	0	X
15803	RalB-RLIP complex	1071	759	193	0	X
6202	yUbc1	1069	804	190	0	X
19835	E. coli Trigger Factor in complex with unfolded PhoA220-310	1065	481	444	0	X
30332	Tyrosine-protein kinase ABL1 (E.C.2.7.10.2)	1065	834	180	0	X
30300	Ubiquitin, DNA repair protein REV1 (E.C.2.7.7.-)	1065	802	173	0	X
18547	MiR12	1064	783	201	0	X
25767	Vta1NTD-Did2(176-204) complex	1062	688	185	0	X
6280	double-stranded RNA-binding domains of adenosine deaminase acting on RNA	1060	613	222	0	X
5232	Cdc13 DNA-binding domain /telomeric ssDNA complex	1060	823	184	0	X	X
19604	complex of calmodulin with minimal binding domain from HIV-1 matrix protein	1059	632	197	0	X
16119	SBDS	1059	979	216	0	X
17510	protein ligand complex	1059	791	177	0	X
18180	HmR11	1057	803	197	0	X
16195	AKAP13-PH	1056	818	189	0	X
16638	NHERF1_(150-358)	1055	758	174	0	X
5483	N-acetylmuramyl-L-alanine amidase	1054	630	202	0	X
7119	32324 monomer	1054	789	171	0	X
6745	HnRNP F RRM12	1053	443	190	0	X
19731	peptidyl-tRNA hyrolase from Vibrio cholerae	1053	826	182	0	X
27460	repetitive domain spider dragline silk	1052	860	309	0	X
5345	LACTOSE OPERON REPRESSOR/DNA Complex	1051	458	138	0	X	X
7414	MMP12_HUMAN	1051	760	200	0	X
16675	protein-glutaminase	1049	797	205	0	X
17382	Raf-1 kinase inhibitor protein	1047	755	181	0	X
5668	3-methyladenine DNA glycosylase I	1046	786	193	0	X
18709	HMG-box/p53	1046	749	159	0	X
19394	human Polymerase iota UBM1-Ubiquitin Complex	1045	582	184	0	X
11175	F-actin binding protein	1044	651	180	0	X
5054	Diadenosine 5',5'''-P1,P4 tetraphosphate hydrolase complexed with ATP	1044	752	177	0	X
6644	assembly_AlgH	1040	804	193	0	X
15924	FLNa16-17	1040	591	183	0	X
17264	calmodulin IQ motif complex	1040	713	193	0	X
19775	CPEB1RRM12	1040	563	212	0	X
6546	CGI-126 monomer	1039	615	171	0	X
18011	Tb24	1038	817	201	0	X
17686	L1ORF1p	1038	697	153	0	X
34336	Condensin complex subunit 2, Structural maintenance of chromosomes protein	1036	695	224	0	X
5398	3-methyladenine DNA glycosylase I	1036	779	183	0	X
16465	CaM-peptide	1036	758	191	0	X
17850	yCaM_GS_CNA1	1036	757	199	0	X
25127	putative phosphoglycolate phosphatase	1035	696	230	0	X
15230	RalB-GMPPNP	1035	776	178	0	X
5177	chick cofilin	1033	713	172	0	X
18574	wild-type Lipase A	1032	753	195	0	X
15411	Single polypeptide chain	1031	774	203	0	X
16630	stnIIY111N	1028	750	195	0	X
15243	TCTP monomer	1026	757	180	0	X
19766	Heterotrimeric pre-mRNA Retention and Splicing Complex	1026	705	180	0	X
4282	XRCC1 N-terminal domain	1025	766	187	0	X
4321	p55 monomer in complex with CoA	1025	668	175	0	X
27017	CaMCaN	1023	798	199	0	X
27170	Polypeptide chain	1019	630	177	0	X
34140	Protein NRD1	1017	453	182	0	X
16912	delta	1017	752	183	0	X
19413	KpDsbA	1016	596	185	0	X
10336	Thioredoxin-like protein 1	1014	752	183	0	X
17736	AHSA1-like protein CHU_1110	1013	757	182	0	X
17251	SARS-CoV main protease N-terminal domain	1013	762	198	0	X
4110	double stranded RNA binding domain of PKR	1013	577	176	0	X
18883	TICAM-1 TIR domain	1013	750	186	0	X
30638	Alkaline phosphatase,Chaperone protein DnaJ 2 (E.C.3.1.3.1)	1012	799	599	0	X
17863	Rv0899	1011	919	218	0	X
18575	variant XI LipA	1010	741	195	0	X
15835	BpR195	1010	738	175	0	X
16840	darcin	1010	781	186	0	X
17390	OR32	1009	584	173	0	X
16173	p23t	1009	678	191	0	X
19417	PaDsbA	1009	591	176	0	X
5628	C-terminal domain [276-437] of the human EF1Bgamma subunit from elongation factor 1	1008	560	167	0	X
18135	GLYCOSYLATED HUMAN INTERFERON ALPHA-2A [WITH GALNAC AT THR 106]	1007	731	178	0	X
6121	CUG-BP	1005	748	201	0	X
15927	StnI	1005	559	184	0	X
18882	TICAM-2 TIR domain	1003	696	169	0	X
6782	YbiA	1003	737	170	0	X
4081	Interferon-alpha-2a	1003	724	172	0	X
17111	Mupirocin_didomain_ACP	1001	660	180	0	X
18165	Enterohaemorrhagic E. coli (EHEC)	1001	584	158	0	X
25402	SNX3FL	1001	729	165	0	X
11053	the West Nile virus NS2B(K96A)-NS3 protease	999	543	197	0	X
16929	TerD-CA2+	999	806	203	0	X
25489	PRO Form of Human Matrilysin (proMMP-7) in Complex with Anionic Membrane	998	62	224	0	X
34308	Carbonic anhydrase 2 (E.C.4.2.1.1)	998	1006	263	0	X
19221	proteasome related subunit C terminal domain	998	785	187	0	X
30245	UPF0297 protein EF_1202	996	750	176	0	X
16276	SO2144	996	709	176	0	X
11036	KAP1 PHD Bromodomains	996	618	188	0	X
6688	Rv1980c (monomer)	995	832	199	0	X
6125	enolase-phosphatase E1	994	859	228	0	X
25488	PRO Form of Human Matrilysin (proMMP-7) in Complex with Zwitterionic Membrane	994	62	223	0	X
15684	lipocalin	994	647	175	0	X
27165	Fyn SH3SH2 monomer	994	750	179	0	X
25358	periplasmic domain of a cellulose-sensing trans-membrane anti-sigma factor	993	741	180	0	X
28046	RalA.PNP	993	583	177	0	X
6883	Ufd1	991	755	187	0	X
5010	DNA Polymerase X	991	725	178	0	X
15893	CuA center	991	685	163	0	X
7081	LANP N-terminal domain (monomeric polymer)	990	713	168	0	X
30458	Mixed lineage kinase domain-like protein	990	696	174	0	X
18298	NusG	989	549	147	0	X
5876	p47 monomer	989	563	182	0	X
25562	PR domain from PRDM16	988	737	168	0	X
30002	Cellular tumor antigen p53,CREB-binding protein (E.C.2.3.1.48)	988	531	162	0	X
19609	Protein-RNA Ternary Complex	987	575	184	0	X		X
19999	osteopontin monomer	987	902	257	0	X
4775	SPINDLE ASSEMBLY CHECKPOINT PROTEIN MAD2	986	601	192	0	X
17670	AaR96	986	744	179	0	X
18228	TpbA monomer	985	542	172	0	X
15922	PPIL1/SKIP	984	519	186	0	X
4340	major urinary protein	984	771	183	0	X
18320	PhoRadA intein	984	708	162	0	X
11083	Acidic leucine-rich nuclear phosphoprotein 32 family member B	983	739	173	0	X
17771	CaM-OLFp complex	983	689	176	0	X
4206	fibronectin	982	579	178	0	X
18526	HR3504C	981	700	152	0	X
27239	Trigger factor	981	1107	981	0	X
6551	DNA excision repair protein ERCC-1, DNA repair endonuclease XPF (E.C.3.1.-.-)	980	575	165	0	X
17610	GppNHp-bound H-RasT35S mutant protein	979	719	184	0	X
16992	RKIP	979	720	172	0	X
17161	Rna14p/Rna15p	979	744	166	0	X
18001	AIP	979	737	163	0	X
10239	Amyloid beta A4 protein and Amyloid beta A4 precursor protein-binding family B member 2	978	725	179	0	X
25502	Peptidyl-prolyl cis-trans isomerase A	977	445	173	0	X
17232	PlyG (E.C.3.5.1.28)	976	530	183	0	X
17323	HR6188A	976	721	172	0	X
10237	Amyloid beta A4 precursor protein-binding family B member 2 and Amyloid beta A4 protein	974	727	178	0	X
4722	Shikimate Kinase	974	694	168	0	X
6004	Cofilin, non-muscle isoform	974	534	164	0	X
25760	GNPTAB	973	679	179	0	X
4797	EqtII monomer	972	681	176	0	X
25232	F231L mutant ERCC1-XPF dimerization region	971	695	172	0	X
5352	xylanase of Bacillus agaradhaerens	971	847	211	0	X
28028	E2-Conjugating Enzyme	970	684	157	0	X
18417	H6-hBASP1	969	798	240	0	X
17389	HR5554A	969	569	162	0	X
25834	FHA domain of TbPar42	968	724	172	0	X
18942	alpha-1 integrin I-domain in complex with GLOGEN triple helical peptide	968	740	189	0	X
19164	cerebral dopamine neurotrophic factor (CDNF)	968	709	149	0	X
4310	calmodulin:SL3 Enhancer Factor2-1 complex	967	577	144	0	X
4648	Phosphoglycerate Mutase (E.C.5.4.2.1)	967	615	188	0	X
25135	MLKL N-terminal domain	967	690	169	0	X
11351	Protein neuralized	966	733	173	0	X
7360	DsbA oxidoreductase	966	533	176	0	X
25188	YTH Domain of YT521-B in complex with N6-Methyladenosine containing RNA	966	683	155	0	X		X
15837	IRON(II) TRANSPORT PROTEIN A	966	547	164	0	X
30610	Induced myeloid leukemia cell differentiation protein Mcl-1	965	548	175	0	X
16685	MreC	965	566	170	0	X
16085	ACP single polypeptide chain	965	725	169	0	X
30322	Alpha-lytic protease (E.C.3.4.21.12)	965	540	222	0	X
19654	human Mcl-1	965	548	175	0	X
7359	DsbA oxidoreductase	965	526	182	0	X
7103	H98S ARD	964	708	190	0	X
17191	MvR76	964	712	170	0	X
27744	PaIF3	964	677	171	0	X
27579	Pin1	964	545	168	0	X
17576	gamma-S-WT	963	727	183	0	X
26717	NcLPMO9C	963	860	220	0	X
5480	Calmodulin-olfactory channel peptide complex	963	664	157	0	X
25153	holo FldB	963	750	185	0	X
25259	hypothetical protein NP_344732.1 from Streptococcus pneumoniae TIGR4	962	565	175	0	X
25239	La-RRM1	962	822	195	0	X
11507	an inhibitor protein of DL-endopeptidases	962	716	163	0	X
27284	SWHNOX-HEME-CO	961	657	179	0	X
15542	yajI	961	535	182	0	X
15356	HR2869A	960	708	155	0	X
7286	CG7054	960	743	182	0	X
25985	A3B CTD	960	481	199	0	X
18637	rNa-FAR-1	960	708	156	0	X
16441	ATP-bound N-MNK	960	675	193	0	X
5194	Synaptotagmin I	958	715	161	0	X
15624	CaMCaNp	957	696	179	0	X
7219	hUev1a	957	599	170	0	X
18681	LIP5(MIT)2	956	522	185	0	X
19776	CPEB4RRM12 in complex with RNA	955	521	177	0	X		X
17524	hr55460a	955	695	156	0	X
25513	TSPO A147T variant in complex with PK11195	955	588	171	0	X
15614	complex	954	540	170	0	X
11086	Microtubule-associated protein RP/EB family member 3	954	711	161	0	X
30569	Eukaryotic elongation factor 2 kinase (E.C.2.7.11.20)	954	712	183	0	X
4027	S. aureus DHFR(F98Y)-NADPH-TMP ternary complex	954	673	165	0	X
19681	E. coli LpoB	953	756	197	0	X
27146	hpEst3	952	676	183	0	X
19608	mitochondrial translocator protein (TSPO) in complex with its high-affinity ligand PK11195	952	738	169	0	X
19106	TICAM-1	951	692	174	0	X
7025	VAP-A:OSBP Complex	951	652	160	0	X
30063	Calmodulin, Eukaryotic elongation factor 2 kinase (E.C.2.7.11.20)	951	737	183	0	X
5820	Thiopurine Methyltransferase	951	792	194	0	X
19108	human restriction factor APOBEC3A	950	502	203	0	X
17200	UHRF1 Tandem Tudor Domains/Histone H3 complex	950	644	160	0	X
17811	MsPTH	949	735	165	0	X
17701	ykud_no_mutations	949	732	187	0	X
27417	WBSCR27 in complex with SAM	949	779	214	0	X
17879	Atg8K26P	949	681	154	0	X
16971	TraI 381-569	949	655	179	0	X
18250	Bcl-XL	948	733	183	0	X
7121	UPF0301 protein HD_1794	948	564	156	0	X
4270	Ca2+/calmodulin - 26-residue peptide from rat Ca2+/calmodulin dependent protein kinase kinase complex	947	601	153	0	X
18356	ADF like UNC-60A Protein	946	719	162	0	X
16362	monomer	946	412	178	0	X
5981	ternary complex of human DHFR with trimethoprim and NADPH	946	706	204	0	X
25545	MyUb (1080-1122) of human Myosin VI with K63-diUb	945	698	156	0	X
7056	DPDE	945	716	166	0	X
6454	sdia	945	574	158	0	X
30004	CREB-binding protein,Cellular tumor antigen p53 (E.C.2.3.1.48)	945	509	153	0	X
15329	hr387	944	755	179	0	X
18238	APOPTOSIS ACTIVATING PHOTOSWITCHABLE BAK PEPTIDE BOUND to BCL-XL	943	636	183	0	X
11001	Cu(I)HSco2	943	650	182	0	X
16278	SO2144	943	502	167	0	X
34247	Pre-rRNA-processing protein TSR2	942	560	173	0	X
16124	RppH	941	717	187	0	X
16107	btr324b	941	669	178	0	X
17582	gamma-S-G18V	941	710	178	0	X
18388	CtCBM11	941	689	176	0	X
18650	RelA-TAD/CBP-TAZ1 complex	940	531	175	0	X
17246	DOMAIN_OF_A_CELL_WALL_SURFACE_ANCHOR_FAMILY_PROTEIN	940	660	172	0	X
18627	VILIP-3 monomer	939	599	174	0	X
5299	MITOTIC SPINDLE ASSEMBLY CHECKPOINT PROTEIN MAD2A/PEPTIDE	939	749	213	0	X
5659	Human Rhinovirus-14 3C Protease monomer	939	683	159	0	X
19834	New Cyt-like delta-endotoxins from Dickeya dadantii - CytC protein	939	727	215	0	X
11041	Human ATP7B	937	681	184	0	X
5680	CFP-10 in complex with unlabelled ESAT-6	937	533	194	0	X
27095	CaM NaV1.2 IQ motif	936	800	187	0	X
16440	human Menkes protein	936	671	188	0	X
15303	bb-PDI monomer	935	685	223	0	X
15685	EGF2 - MIC1 complex	935	764	180	0	X
10238	Amyloid beta A4 protein and Amyloid beta A4 precursor protein-binding family B member 2	934	696	170	0	X
4318	glutaredoxin 2	933	788	193	0	X
17311	DHFR.NADPH	933	592	173	0	X
27033	TvCyP2 monomer	933	750	175	0	X
4386	REGULATOR OF G-PROTEIN SIGNALING 4	932	666	159	0	X
15961	M2AP	932	735	180	0	X
11057	the microtubule-binding domain of dynein heavy chain 9	931	500	149	0	X
6658	FLIX3	931	701	183	0	X
4064	human fibroblast collagenase	930	716	158	0	X
25391	tumor protein monomer	929	709	165	0	X
34161	Calmodulin-1, Transient receptor potential cation channel subfamily V member 5	929	482	181	0	X
10055	Glia maturation factor gamma	929	684	161	0	X
15361	mmp-20	928	579	161	0	X
11094	Fibroblast growth factor receptor substrate 3, ALK tyrosine kinase receptor	928	610	141	0	X
36077	Heat shock 70 kDa protein 1A	928	781	197	0	X
11348	KIAA1787 protein	927	706	170	0	X
19977	human HCN2 CNBD in the cAMP-unbound state	927	624	149	0	X
19945	FldA in complex with flavin	927	739	184	0	X
36161	Heat shock protein SSA1	926	732	176	0	X
15207	yajg	926	750	177	0	X
17279	rat epididymal lipocalin 12	926	728	182	0	X
18229	complex between the PH domain of the Tfb1 subunit from TFIIH and Rad2	926	690	173	0	X
11146	Eukaryotic translation initiation factor 5	925	677	159	0	X
4683	dNumb PTB	925	624	161	0	X
25712	dehydroascorbate reductase 3A from Populus trichocarpa	925	542	207	0	X
5742	COX assembly protein	925	398	176	0	X
16619	Diva (Boo)	924	699	162	0	X
5396	ternary complex DHFR-trimethoprim-NADPH	924	0	172	0	X
7189	Cj1258 monomer	924	677	165	0	X
25893	PARP-1_F3	924	545	162	0	X
18415	human C-type lectin domain family 4 member D	923	673	169	0	X
17523	Norwalk virus protease	923	683	177	0	X
17646	Anamorsin	922	703	184	0	X
34131	Nuclear receptor coactivator 1 (E.C.2.3.1.48), Signal transducer and activator of transcription 6	922	645	164	0	X
16174	Rv0287-Rv0288 complex	922	487	197	0	X
15470	Calmodulin-Munc13-1	921	666	191	0	X
7086	hypothetical protein tm1012	921	663	147	0	X
15049	PCBP2 KH1+KH2	920	626	172	0	X
15032	FimF	920	675	192	0	X
15912	Itk SH3 and Itk SH2 domains	920	744	187	0	X
15727	La NTD complexed with 5'UUUU	920	768	180	0	X
16273	OCRL bridges clathrin-mediated membrane	919	674	163	0	X
10236	peptide from Amyloid beta A4 protein, Amyloid beta A4 precursor protein-binding family B member 2	919	552	136	0	X
6199	5,10 methenyltetrahydrofolate synthetase	918	737	163	0	X
7023	REF2-I double domain	918	576	171	0	X
4091	basic fibroblast growth factor	918	686	151	0	X
6275	Metal-response element-binding transcription factor-1	918	748	161	0	X
10165	Protein phosphatase 1, regulatory (Inhibitor) subunit 3B	917	689	164	0	X
26582	Cyanobacterialchrome GAF domain	917	689	179	0	X
6253	gammaS-crystallin	917	761	195	0	X
34022	Uncharacterized protein	916	693	145	0	X
4263	PTB domain of Drosophila Numb protein/GPpY_peptide complex	916	638	171	0	X
26552	PfIMP1 monomer	916	693	145	0	X
5181	Xylanase 10A, second family 4 carbohydrate binding module	916	712	183	0	X
16646	RBD1,2 domains from human nucleolin	915	725	180	0	X
17838	Molecular Level Interaction of the Human Synaptotagmin I C2B domain with Inositol Hexaphosphate	915	597	142	0	X
16442	At3g03773.1	914	671	140	0	X
15981	Cgi121	914	700	154	0	X
15457	1655-1822	912	708	172	0	X
16934	PBS domain	912	671	156	0	X
25799	human I-type lectin domain-glycan complex	912	623	154	0	X
6840	monomer	911	430	167	0	X
17653	SAP30 and PAH3	910	699	174	0	X
17747	LpR145J	910	676	143	0	X
16404	Human ubiquitin-conjugating enzyme E2G2 isoform 1	910	715	165	0	X
18277	KmAtg10	909	688	162	0	X
25385	Ssa1 substrate binding domain	909	727	176	0	X
18167	PsbP	908	647	177	0	X
4076	Outer Surface Protein A	908	1041	254	0	X
36288	Luciferase	908	689	177	0	X
18411	putative protein disulfide isomerase	908	695	147	0	X
19984	BlLPMO10A	907	675	177	0	X
7070	monomer	906	687	163	0	X
17447	MUP11	906	714	170	0	X
34050	Gag protein	905	0	183	0	X
6298	ASF1 anti-silencing function 1 homolog A	905	668	166	0	X
4577	RIBOSOMAL PROTEIN S4 DELTA 41	904	712	173	0	X
7231	Heme-binding protein 1	904	565	172	0	X
15315	DDR2-DS	903	633	166	0	X
27608	MapZ	903	641	163	0	X
18632	MS1	903	663	150	0	X
34379	Sortase A (E.C.3.4.22.70)	903	663	149	0	X
30423	Bcl-2-related ovarian killer protein	903	535	163	0	X
17960	Bubr1N Blinkin complex	903	715	162	0	X
34122	Stage 0 sporulation protein J	902	642	150	0	X
5202	CNP catalytic domain	902	590	200	0	X
17595	Nob1	901	704	160	0	X
34104	RISC-loading complex subunit TARBP2/RNA Complex	900	515	149	0	X		X
18045	EMAP2	900	518	139	0	X
34103	RISC-loading complex subunit TARBP2/RNA Complex	900	515	149	0	X		X
16683	REF2-I/HSV-1 ICP27 peptide	899	627	159	0	X
6336	AP4A hydrolase with ATP	899	652	157	0	X
15625	VBS3	899	521	171	0	X
19737	C terminal fragment of the neuronal isoform of the polypyrimidine tract binding protein (nPTB)	899	472	194	0	X
16037	BlrP1_BLUF	899	677	154	0	X
4089	peptide deformylase	898	487	160	0	X
16726	myristoylated NCS1	898	0	176	0	X
6942	myristoylated NCS-1	898	654	176	0	X
16810	PgR37A	897	667	169	0	X
16629	SlyD	897	655	161	0	X
19806	hypothetical protein ZP_02064002.1 from Bacteroides ovatus ATCC 8483	896	497	158	0	X
6753	split PH1 domain of alpha-syntrophin	896	483	162	0	X
4092	Core binding factor b subunit	895	653	165	0	X
11504	SPOC domain of the human transcriptional corepressor SHARP in complex with SMRT	895	723	163	0	X
30285	human Tsg101 UEV in complex with tenatoprazole	894	521	143	0	X
4814	Locust apolipophorin-III	894	324	159	0	X
15595	yst0336	894	627	155	0	X
16014	TAZ1/STAT2 complex	893	515	145	0	X
17353	androcam	893	662	161	0	X
4378	calcium loaded un-myristoylated rat frequenin	893	721	182	0	X
5319	cellular retinol-binding protein type I	893	0	159	0	X
11423	Flagellar hook-length control protein	892	669	162	0	X
15574	KP-TerB	892	684	156	0	X
18151	CdnL	892	539	166	0	X
15950	E.Coli SlyD	892	676	168	0	X
15385	F104W cTnC	891	513	158	0	X
7172	C-terminal domain of twinfilin	891	667	153	0	X
6502	XPF/ERCC-1 heterodimer	891	622	172	0	X
16708	BRUNOL-3	891	798	197	0	X
5605	SAM22	890	630	157	0	X
6748	The Ki67FHA/hNIFK(226-269)3P complex	889	520	168	0	X
19246	GAP-43	889	703	219	0	X
34200	RNA polymerase II-associated protein 3	889	615	142	0	X
10089	Numb protein	888	666	162	0	X
5038	HsUbc2b	888	479	150	0	X
6256	TM1509 monomer	888	624	154	0	X
18013	MS1	888	642	159	0	X
30345	TAR DNA-binding protein 43	888	654	161	0	X
34395	Adaptin ear-binding coat-associated protein 1, AP-2 complex subunit mu	888	475	140	0	X
19807	NMR structure of hypothetical protein ZP_02069618.1 from Bacteroides uniformis ATCC 8492.	887	496	157	0	X
27265	human Cyclophilin A	887	677	167	0	X
5991	Murine Ets-1 deltaN301	887	657	156	0	X
25590	Fag s 1	886	652	150	0	X
19777	CPEB4RRM12 in free state	886	463	181	0	X
26774	ribosomal protein S1	886	662	157	0	X
7351	KIAA0252_PROTEIN	886	631	157	0	X
17354	high calcium androcam	886	587	162	0	X
17403	HlyB-C39	885	657	169	0	X
10250	Signal-transducing adaptor protein 1	885	673	143	0	X
15091	mApoAI216	885	641	194	0	X
27853	c-di-GMP bound PilF159-302	885	658	147	0	X
17045	KSR1 CA1 monomer	885	621	159	0	X
4265	Dynein light chain 1	884	709	209	0	X
15964	ERp18	884	589	149	0	X
4262	DIHYDROFOLATE REDUCTASE	884	0	168	0	X
19866	AbpA	884	687	170	0	X
15322	monomer	884	669	168	0	X
16061	HybE	883	662	159	0	X
18978	Ph1500: a homohexameric protein centered on a 12-bladed beta-propeller	883	674	131	0	X
19826	sortase A from S. aureus in complex with benzo[d]isothiazol-3-one based inhibitor	883	660	148	0	X
17481	SeR147	882	634	155	0	X
19837	E. coli Trigger Factor in complex with unfolded PhoA365-471	882	445	345	0	X
7059	Pyrazinamidase	882	679	178	0	X
19768	hDkk4	882	683	185	0	X
34218	ER quality-control lectin	882	690	147	0	X
4360	system_rabphilin_3_C2B	882	561	153	0	X
17953	NMR Structure of protoporphyrin-IX bound murine p22HBP	881	639	166	0	X
34030	Peroxisomal biogenesis factor 19	881	486	145	0	X
34219	ER quality-control lectin	881	676	148	0	X
25839	YgaU	881	658	160	0	X
10264	signal transducing adaptor molecule 2	880	703	162	0	X
36078	Heat shock 70 kDa protein 1A	880	765	187	0	X
17363	DomB	880	647	164	0	X
16538	Pdcd4 MA-3M	880	658	157	0	X
34077	Guanylate cyclase soluble subunit beta-1 (E.C.4.6.1.2)	880	717	188	0	X
18976	Ca-containing EF-hand protein	879	663	159	0	X
15798	Tpx monomer	879	647	155	0	X
25993	Human gammaC-crystallin	879	664	179	0	X
11544	ARMADILLO REPEAT PROTEIN SELF-ASSEMBLED COMPLEX (YIIM2-MAII)	879	632	186	0	X
19220	proteasome related subunit N terminal domain	879	670	170	0	X
16809	Itk SH3 and Itk SH2 domains	879	715	179	0	X
25439	Bud31p protein	878	509	167	0	X
6626	Plant Tom20	877	620	159	0	X
11294	RWD domain containing protein 2	877	634	147	0	X
17031	SLR0335	877	650	156	0	X
11594	The Acidic String of the Nucleotide Excision Repair Factor XPC	876	680	165	0	X
16737	NMB1343	876	590	157	0	X
17899	MS1	876	689	208	0	X
5051	MTH1692	875	309	175	0	X
18394	uncharacterized thioredoxin-like protein BVU_1432	875	662	157	0	X
25381	E. coli threonylcarbamoyl-AMP synthase TsaC	874	723	168	0	X
18518	LC3B OPTN-LIR Ptot complex structure	874	548	141	0	X
6643	human prolactin	874	719	140	0	X
25240	Twinstar from Drosophila melanogastor	874	652	146	0	X
7008	Sodium/calcium exchanger 1	874	483	148	0	X
25104	CYCLOPHILIN A COMPLEXED WITH A FRAGMENT OF CRK-II	874	670	167	0	X
17421	C6orf130	874	649	161	0	X
16444	SC35	874	668	155	0	X
18387	thiol:disulfide interchange protein	874	676	149	0	X
7339	MLP-like protein 28	873	665	156	0	X
15720	Solution structure of Arabidopsis thaliana protein At1g70830, a member of the major latex protein family	873	665	156	0	X
6934	Wzb monomer	873	592	163	0	X
4334	ARID domain of dead-ringer protein	873	567	148	0	X
18612	HisRS	872	503	147	0	X
19066	Solution structure of the FimH adhesin carbohydrate-binding domain	872	694	171	0	X
17139	ARC92VBD	872	584	156	0	X
17160	CBP21	872	652	179	0	X
16317	human interleukin-33	872	548	151	0	X
4830	fibronectin fragment 6f11f22f2	872	0	165	0	X
18989	CgR160	871	643	156	0	X
5532	Tumor Susceptibility gene 101 protein/Gag Polyprotein	871	646	147	0	X
15558	fat globule-EGF-factor 8-L	870	595	173	0	X
16956	AlgE6R3	870	664	175	0	X
25798	human Siglec-8	870	620	158	0	X
4985	flavodoxin-like domain of the Escherichia coli sulfite reductase	870	663	166	0	X
26059	AF9 yeats domain in complex with histon H3 acetylation at K18	870	666	123	0	X
18321	CRKL	870	882	232	0	X
26577	Cyanobacteriochrome GAF6012g4	870	643	167	0	X
30474	Designed orthogonal protein DHD13_XAAA_A, Designed orthogonal protein DHD13_XAAA_B	870	625	146	0	X
15247	POTRA	870	669	159	0	X
30551	Thioredoxin-like fold domain-containing protein MRL7L, chloroplastic	870	503	139	0	X
19554	Domain 2 of E. coli ribosomal protein S1	870	668	174	0	X
34181	PC4 and SFRS1-interacting protein,Histone-lysine N-methyltransferase 2A (E.C.2.1.1.43)	869	627	159	0	X
25652	PTBRRM1-SL23H complex	869	535	119	0	X		X
5072	CD3 Epsilon and gamma Ectodomain Fragment Complex	868	564	160	0	X
25870	Holo form of Calmodulin-Like Domain of Human Non-Muscle alpha-actinin 1	868	517	151	0	X
18533	mptpa	868	516	159	0	X
30133	2''-aminoglycoside nucleotidyltransferase (E.C.2.7.7.46)	868	778	167	0	X
4636	Tumor necrosis factor receptor type 1 associated death domain protein	868	539	171	0	X
19001	OspE	868	653	163	0	X
25442	Heterodimeric complex composed of Snu17p/Ist3p(25-138) and Bud13p(215-255	867	527	148	0	X
7207	human zeta-COP	867	645	150	0	X
18372	OR137	867	612	141	0	X
4497	Heat shock cognate 70 kd protein 1	867	683	153	0	X
16446	monomer	866	600	184	0	X
6793	Protein Ysne	866	491	143	0	X
25342	NMR structure of the protein YP_193882.1 from Lactobacillus acidophilus NCFM in presence of FMN	866	607	161	0	X
6365	Protein BC4709	866	513	151	0	X
19521	BCL-xL containing the alpha1-alpha2 disordered loop	865	642	209	0	X
16097	CtR107	864	488	155	0	X
5630	ER75 monomer	864	612	161	0	X
15597	Px monomer	864	537	155	0	X
6936	VirB7/VirB9	864	634	151	0	X
26060	AF9 yeats domain in complex with histone H3 crotonylation at K18	863	665	123	0	X
7310	cyclophilin D	863	461	160	0	X
15694	MIC4_Ap12	863	649	168	0	X
16371	DSY2949	863	486	142	0	X
36129	At3g55470	863	461	155	0	X
15128	RGS domain from human RGS14 protein	863	567	151	0	X
11330	Paf1/RNA polymerase II complex component	862	631	145	0	X
16764	CALMODULIN	862	621	158	0	X
6743	CcdA conformer a, b, and c homodimers	861	647	177	0	X
4345	L30-MRNA COMPLEX	861	648	138	0	X		X
15593	C6orf130	861	663	164	0	X
10318	KIAA1075 protein	861	653	148	0	X
17277	putative thioredoxin	861	650	149	0	X
19169	PG_2175	860	669	163	0	X
36101	DP1, General transcription factor IIH subunit 1	860	662	156	0	X
30722	E3 ubiquitin-protein ligase UHRF1 (E.C.2.3.2.27)	860	629	153	0	X
25026	NMR structure of putative beta-lactamase (NP_372339.1) from Staphylococcus aureus Mu50	860	484	164	0	X
15877	LC3/p62 complex	859	621	146	0	X
4129	Nereis diversicolor sarcoplasmic calcium-binding protein	859	0	179	0	X
18337	OR136	859	609	140	0	X
19422	Nosiheptide in Complex with TipAS	859	600	153	0	X
25791	kinase in complex with its regulatory protein	859	611	155	0	X
10164	Uncharacterized protein C6orf130	859	646	146	0	X
16270	Sortase A-substrate complex	859	636	157	0	X
27081	atg32	858	603	140	0	X
6330	AP4A hydrolase monomer	858	617	147	0	X
26753	Veev macro domain/ADP-ribose complex	858	651	153	0	X
4448	Diadenosine 5',5'''-P1,P4 tetraphosphate hydrolase	858	612	162	0	X
15797	monomer	858	654	157	0	X
15760	alpha-parvin CH2-paxillin LD1 complex	858	500	139	0	X
5942	hypothetical protein hi0004	858	620	157	0	X
18133	AK1	858	777	187	0	X
30243	RNA polymerase II transcription factor B subunit 1, Transcription factor p65	857	641	152	0	X
27411	TaLPMO9A	857	725	196	0	X
27133	UNG2	857	866	312	0	X
27852	apo tate PilF159-302	857	647	147	0	X
27978	hHR23A(223-363) monomoer	857	628	165	0	X
15312	Aquifex NusB monomer	856	656	143	0	X
27965	Cor a 1.0401	856	677	157	0	X
15112	holo-c2sod	856	679	178	0	X
19726	GLD-1 KH-QUA2 bound to 5'-CUACUCAUAU-3'	856	386	144	0	X		X
34307	Gamma-aminobutyric acid receptor-associated protein-like 2, Ubiquitin-like modifier-activating enzyme 5 (UBA5) LIR motif	856	612	147	0	X
5275	sialic acid binding domain of rhesus rotavirus VP4	856	573	168	0	X
5490	Pru av 1 E45W	855	558	156	0	X
6001	C5 C345C domain	855	510	157	0	X
7055	PTH monomer	854	730	171	0	X
18379	IIA(chb)-HPr complex	854	689	181	0	X
4671	Pru a 1	853	581	155	0	X
16841	Fibronectin 6FnI1-2FnII7FnI	853	498	186	0	X
17274	IIA(CHITOBIOSE)-HPr COMPLEX OF THE N,N'-DIACETYLCHITOBOISE BRANCE OF THE E. COLI PHOSPHOTRANSFERASE SYSTEM	853	689	181	0	X
10035	Hypothetical protein yk1067a12	852	633	165	0	X
30480	CatN, CatC	852	617	145	0	X
25871	Apo form of Calmodulin-Like Domain of Human Non-Muscle alpha-actinin 1	852	504	152	0	X
26558	FNIII7-8	852	682	170	0	X
6055	merB / Hg / DTT complex	852	670	178	0	X
6372	SARS N-protein	852	628	177	0	X
30130	Peptidase M23 (E.C.3.4.24.75)	851	474	138	0	X
7274	Hypothetical protein YdfO	851	680	168	0	X
6000	Drosophila Argonaute1 PAZ domain	850	515	152	0	X
19421	Promothiocin A in Complex with TipAS	850	600	157	0	X
18039	Solution structure ensemble of the two N-terminal apple domains (residues 58-231) of Toxoplasma gondii microneme protein 4	850	641	161	0	X
17070	talin domain C	850	484	166	0	X
16411	Rtt103 CTD interacting domain	850	570	150	0	X
17530	AHSA1-like protein RHE_CH02687 (1-152)	849	639	154	0	X
17927	putative thiol-disulfide oxidoreductase	849	644	153	0	X
27666	LARP4A	849	543	158	0	X
25387	bpsl1445	849	663	168	0	X
36179	Centrin, putative	849	368	145	0	X
4215	Staphylokinase	849	629	130	0	X
18389	CtCBM11	848	619	173	0	X
26010	Mycobacterium tuberculosis LppM (Rv2171) protein folded domain	848	461	169	0	X
17946	Dihydrofolate reductase from Moritella profunda	848	665	169	0	X
34115	Respiratory supercomplex factor 1, mitochondrial	847	623	149	0	X
5324	Calcium-Dependent Protein Kinase regulatory domains	847	452	160	0	X
27967	Cor a 1.0403	847	666	155	0	X
34058	Regulator of Ty1 transposition protein 103, THR-SER-PRO-SEP-TYR-SEP-PRO-THR-SER-PRO-SEP-TYR-SEP-PRO-THR-SER	847	487	147	0	X
5404	E. coli Peptide Deformylase	847	618	149	0	X
7167	RICH protein	847	633	212	0	X
5755	Phosphatase Regenerating Liver 2	847	672	159	0	X
17613	OR36	847	598	139	0	X
5800	Escherichia coli N utilization substance (339-495)	846	624	154	0	X
17822	QFMF	846	488	150	0	X
6371	Sin3a associated polypeptide p18	846	559	143	0	X
15568	NeR45A	846	650	153	0	X
17902	CCL2 (+carbohydrate)	846	621	163	0	X
34155	RNA-binding protein 40	846	607	139	0	X
7007	AT5G39720.1	846	660	162	0	X
17125	apo DHFR	846	564	152	0	X
16248	PknB-phosphorylated Rv1827	845	643	176	0	X
27235	C-terminal domain of chTOG	845	617	142	0	X
5701	SopE2 momomer	844	680	157	0	X
6369	Protein BH1534	844	501	148	0	X
34383	Betv1a	843	646	151	0	X
34300	Uncharacterized protein Rv2232	843	691	167	0	X
4284	Calmodulin-Ca2+-Pump-Peptide Complex	843	556	143	0	X
16348	DEAD RINGER-LIKE PROTEIN 1	842	587	134	0	X
18904	two domain PPIase SlpA from Escherichia coli	842	466	151	0	X
7004	Rpa0253 monomer	842	625	150	0	X
16991	NeR70A	842	642	153	0	X
30131	Peptidase M23 (E.C.3.4.24.75)	841	465	135	0	X
19971	CupS	841	647	156	0	X
6344	HR1958	841	645	145	0	X
11141	Vav-3 protein	841	635	140	0	X
10036	Protein CGI-38	841	629	154	0	X
27961	Cor a 1.0402	840	665	156	0	X
6283	coactosin like protein	840	0	154	0	X
4141	vnd/NK-2 homeodomain DNA complex	840	291	100	18	X	X
7180	UPF0301 protein SO3346	839	503	135	0	X
30196	Calmodulin, Nitric oxide synthase, inducible (E.C.1.14.13.39)	839	438	161	0	X
7150	Talin/integrin/PIPKIg chimera complex	839	283	108	0	X
17745	PFV RNase H	838	600	142	0	X
4053	staphylococcal nuclease	838	541	137	0	X
6565	Mrcp20k monomer	838	619	172	0	X
5878	region 1463-1617 of mouse 53BP1	838	641	146	0	X
18333	phosphorylated CRKL	837	701	235	0	X
5907	Ku80 CTD	837	601	155	0	X
18092	NeRF1	837	522	152	0	X
4052	staphylococcal nuclease	837	524	142	0	X
6341	At3g04780.1	837	627	171	0	X
16372	af2351	837	574	114	0	X
4668	FK506 binding protein from Methanococcus thermolithotrophicus	837	637	151	0	X
18037	ykud_imip	836	643	164	0	X
16329	DsbA monomer	836	672	168	0	X
15554	Eps15 EH2-Stonin2 complex	836	483	130	0	X
15598	Px monomer	835	528	146	0	X
6032	Coactosin (Mus musculus)	835	646	160	0	X
25919	LC3 FUNDC1 complex	835	533	132	0	X
18701	UNC-60B from Caenorhabditis elegans	835	646	144	0	X
10068	Transgelin	835	609	146	0	X
4849	BmPBP	835	623	155	0	X
5578	rat cellular retinol-binding protein I, bound to all-trans retinol	835	550	148	0	X
17044	Rtt103 CTD complex	835	393	137	0	X
17443	Solution structure of human ubiquitin conjugating enzyme Rad6b	835	581	140	0	X
16412	Rtt103 bound to CTD peptide	835	393	137	0	X
4682	Rat holo-cellular retinol-binding protein II	834	544	153	0	X
26780	IL36A	834	645	144	0	X
6966	cytochrome c552	834	0	144	0	X
4434	Human prion protein fragment 90-230	834	441	160	0	X
16485	THAP RRM1	834	351	84	0	X	X
6931	Lm-FABP in complex with oleate	833	10	0	0	X
5048	cellular retinol-binding protein type I	833	0	149	0	X
19078	fibrillin e2cb1	833	624	170	0	X
30100	Myosin-binding protein C, cardiac-type	832	582	147	0	X
34041	Regulator of Ty1 transposition protein 103, PRO-SER-TYR-SER-PRO-PTH-SER-PRO-SER-TYR-SER-PRO-THR-SER-PRO-SER	832	472	144	0	X
25802	CD302	832	627	151	0	X
5983	5,10-methenyltetrahydrofolate synthetase	832	739	187	0	X
30584	Myeloid-derived growth factor	832	630	149	0	X
18726	AcSp1-RP	832	487	165	0	X
5751	PCOLCE C-terminal domain	832	0	133	0	X
26016	Ca2+-bound C2 domain in complex with V5-pHM peptide	831	604	148	0	X
19282	lymphocyte receptor NKR-P1A	831	622	157	0	X
4599	heat shock cognate 70 kd protein 1	831	657	153	0	X
15757	monomer	831	527	161	0	X
15256	ApolPBP	831	620	150	0	X
18548	Fam96a	830	595	136	0	X
19955	tandem SH3 domain of CAP	830	551	132	0	X
27159	LRT2 monomer	829	638	164	0	X
18579	Methylated Histone Complex	829	598	137	0	X
34179	PC4 and SFRS1-interacting protein,LEDGF/p75 IBD-JPO2 M1	829	590	145	0	X
19586	Calmodulin bound to the target peptide of Endothelial Nitrogen Oxide Synthase phosphorylated at Thr495	829	397	145	0	X
18215	HsR50	829	704	169	0	X
26011	Hop TPR2A monomer	828	607	131	0	X
6787	rabphilin C2A domain	828	553	153	0	X
19614	basic-helix-loop-helix region of the transcriptional repressor HES-1	828	604	142	0	X
11084	Calponin-2	828	617	151	0	X
5794	Lck SH3-SH2 domain pair	827	618	156	0	X
26854	AsLOV2	827	644	166	0	X
18027	CaM bound to NOS peptides	826	431	162	0	X
17310	DHFR.TMP	826	440	161	0	X
15530	apo-Mj0056	826	552	113	0	X
15954	eIF5A	825	454	155	0	X
16098	Apo-form YjaB	825	622	146	0	X
4022	human carbonic anhydrase I	825	743	243	0	X
11516	AHA1 C-terminal domain	825	639	138	0	X
25435	Amylase binding Protein A	825	640	177	0	X
6332	myosin light chain	824	664	155	0	X
18047	NP_814968.1	824	484	146	0	X
25062	OR462	823	602	136	0	X
6578	bcl-xl /Bad BH3 peptide (NLWAAQRYGRELRRMSDEFVDSFKK)complex	823	632	162	0	X
17957	BA42	823	638	145	0	X
19974	BA42 protein	823	638	145	0	X
30659	Fermitin family homolog 2, Paxillin	823	506	150	0	X
34236	Major prion protein	823	473	153	0	X
11247	Ubiquitin ligase protein RNF8	823	608	147	0	X
27192	Rab5a	822	632	165	0	X
17364	PTB Domain of TENC1 in complex with the peptide of DLC1	822	484	133	0	X
26949	ERD10	822	661	237	0	X
30019	E3 ubiquitin-protein ligase UHRF1 (E.C.6.3.2.-), Spacer	822	421	152	0	X
16743	HuPrP(90-231 M129 Q212P)	822	610	147	0	X
4938	mouse doppel	821	590	154	0	X
17890	CCL2 (free)	821	605	161	0	X
17477	Mouse MFG-E8 C2 Domain	821	573	160	0	X
6821	Superoxide dismutase [Cu-Zn] (E.C.1.15.1.1)	821	497	158	0	X
5884	HMG box containing protein 1 (AXH domain only)	821	618	142	0	X
17258	Pineapple Cystatin	820	549	144	0	X
5833	mob1	820	581	142	0	X
16881	polyketide cyclase SCO5315	820	654	175	0	X
25869	LptE	819	587	162	0	X
25599	Sds3 in complex with Sin3A	819	631	154	0	X
6923	FKBP38	819	610	138	0	X
4313	ARD	818	639	176	0	X
4879	Sortase	818	642	147	0	X
6054	the methylated N-terminal 16kDa domain of Ada Protein	818	602	147	0	X
25832	CPR3	818	673	164	0	X
19225	GM_CBM21	818	422	144	0	X
16065	RelE:RelBc complex	817	496	127	0	X
11095	Fibroblast growth factor receptor substrate 3 and ALK tyrosine kinase receptor	817	603	146	0	X
15991	Core Binding Domain	817	419	126	0	X
27040	Bet v 1.0102	817	620	152	0	X
16957	KvAP	817	424	136	0	X
34394	Adaptin ear-binding coat-associated protein 1	817	485	140	0	X
6391	mmp12	816	663	169	0	X
6847	trxy	816	600	147	0	X
17110	IGF2R	815	592	154	0	X
4335	calerythrin	815	627	181	0	X
4812	weak toxin WTX	815	0	0	0	X
4681	Rat apo-cellular retinol-binding protein II	815	545	152	0	X
19153	IGF2R	815	597	151	0	X
15167	YehR	814	611	147	0	X
4158	Ribonuclease alpha-sarcin	814	0	154	0	X
12024	cellulosomal double-dockerin	814	615	163	0	X
15683	YiaD	814	596	161	0	X
11087	Unc-112-related protein 2	814	608	134	0	X
25852	CaM-eNOS	814	415	144	0	X
11570	SrtA_AX_bocLPAT	814	642	152	0	X
25899	RockCC	814	620	148	0	X
30327	Regulator of Ty1 transposition protein 103	814	459	144	0	X
11295	Protein C21orf6	814	613	147	0	X
15383	ClpC N-domain	813	621	169	0	X
27688	IL36B2	813	646	156	0	X
19928	BamA-P4P5	813	654	175	0	X
17569	.	813	393	148	0	X
5284	A54 I-FABP	813	0	148	0	X
15423	a single polypeptide chain	812	680	206	0	X
17694	GH84A_CBM32-1	812	597	158	0	X
6255	Ribosomal Protein L16	812	624	134	0	X
16970	Bem1p SH3-CI domain with Ste20p	812	546	122	0	X
6731	BofC	812	617	140	0	X
4094	human Interleukin 4	811	605	144	0	X
6900	Pdcd4 C-terminal MA-3 (319-449)	811	435	130	0	X
16585	SNase140	811	579	135	0	X
15127	RegB	811	452	160	0	X
16380	gi-13879369	811	471	153	0	X
15279	EH domain of EHD1 in presence of Ca+2	811	602	131	0	X
19446	SSB	810	701	178	0	X
5513	Thermotoga maritima Ribosomal protein L11	810	604	137	0	X
16376	OR8w187r	810	614	139	0	X
36048	Mutator mutT protein (E.C.3.6.1.55)	810	586	134	0	X
5083	Epidermal-type fatty acid binding protein	810	0	152	0	X
16388	NsR431C	810	612	154	0	X
30000	DE NOVO DESIGNED PROTEIN OR258	810	594	130	0	X
19626	rsahit	810	596	149	0	X
18426	human prion protein	810	461	150	0	X
5285	T54 I-FABP	810	0	146	0	X
15734	Phosphodiesterase 5	810	636	151	0	X
18188	CohA2	810	640	151	0	X
4641	HUMAN PRION PROTEIN (MUTANT E200K)	809	593	162	0	X
17509	YP_557733.1	809	462	159	0	X
17780	Human prion protein with E219K protective polymorphism	809	461	148	0	X
6967	cytochrome c552	809	0	144	0	X
4706	CELLULOSE BINDING DOMAIN N2 FROM C. FIMI ENDOGLUCANASE C	808	484	155	0	X
5541	Lm-FABP	808	0	126	0	X
7248	Mesd(12-155)	808	564	136	0	X
6120	Hypothetical protein CC1736	808	589	144	0	X
17688	TfR85A	808	631	149	0	X
18281	Strawberry	808	609	144	0	X
17611	Rmet_5065	808	624	159	0	X
18249	CcmG	807	639	156	0	X
17304	OR28	807	481	132	0	X
25540	NSsCT-Tfb1PH complex	807	597	143	0	X
6726	CalC monomer	807	596	156	0	X
25132	VEEV macro domain	806	629	147	0	X
5579	rat cellular retinol-binding protein I, ligand free	806	551	143	0	X
6603	ykuV	806	599	146	0	X
16039	OdhI	806	0	145	0	X
15996	complement component C7	805	578	159	0	X
26853	LytU	805	467	136	0	X
30543	Caspase recruitment domain-containing protein 9	805	632	140	0	X
17289	Stromal_Interaction_Molecule_2	805	431	141	0	X
16015	TAZ2/STAT1 complex	805	434	142	0	X
16267	tungsten formylmethanofuran dehydrogenase subunit D	805	604	142	0	X
19152	holo YqcA	805	627	158	0	X
11102	Protein disulfide-isomerase A3	805	611	132	0	X
17714	human prion protein mutant HuPrP(90-231, M129, V210I)	804	459	149	0	X
25347	53BP1 tandem Tudor domains in complex with a p53K370me2 peptide	804	585	116	0	X
6563	arsenate reductase	804	534	149	0	X
30087	Protein-lysine N-methyltransferase (E.C.2.1.1.-)	803	631	154	0	X
27687	Pru p 1.0101	803	615	150	0	X
34259	RNA-binding protein FUS/RNA Complex	803	479	120	0	X		X
19213	TePixJ	803	645	171	0	X
4565	truncated catalytic domain of matrix metalloproteinase-2	803	610	144	0	X
17207	SnR168A	803	605	157	0	X
19256	FimH -heptyl-mannose complex	802	622	171	0	X
15851	Stromal interaction molecule 1	802	569	125	0	X
7089	Metalloelastase monomer	802	638	166	0	X
16188	Rv2175c	802	369	152	0	X
6696	PP5-TPR-peptide complex	801	563	138	0	X
25348	53BP1 tandem Tudor domains in complex with a p53K382me2 peptide	801	584	115	0	X
15804	TR8_protein	801	613	136	0	X
17742	ETV6 R458	801	574	141	0	X
6174	ThKaiA180C-CIIABD complex	801	484	127	0	X
16009	NpuDnaE intein	801	611	146	0	X
7142	prion protein	800	532	156	0	X
17275	thioredoxin	800	602	124	0	X
6382	prion protein	800	416	150	0	X
19268	HuPRP	800	425	160	0	X
34180	PC4 and SFRS1-interacting protein,Pogo transposable element with ZNF domain	800	584	133	0	X
6053	the N-terminal 16kDa domain of Ada Protein	800	586	145	0	X
26603	Microtubule-associated protein light chain 3C (LC3C)	800	593	131	0	X
10059	Flotillin 2	799	607	148	0	X
26800	VapC family toxin	799	625	143	0	X
4038	component IV glycera dibranchiata monomeric hemoglobin-CO	799	581	168	0	X
6953	Major prion protein	799	532	156	0	X
25859	complex between MMP-12 and synthetic triple-helical collagen	799	635	165	0	X
11333	RING finger and CHY zinc finger domain-containing protein 1	799	573	137	0	X
4202	Superoxide Dismutase	799	577	157	0	X
10120	Lamin A	798	568	158	0	X
10084	nuclear distribution gene C homolog	798	589	145	0	X
19354	Smoothened	798	556	125	0	X
34260	Protein NRD1, Helicase SEN1 (E.C.3.6.4.-)	798	470	150	0	X
36061	AmyP-SBD	798	530	151	0	X
25658	METAL-BINDING SITE OF THE MEMBRANE FUSION PROTEIN SILB	798	678	159	0	X
27875	proteasome proteins	798	549	143	0	X
15399	rpp I214V	798	532	156	0	X
25138	DRB4(1-153)	797	559	148	0	X
4188	C2 Domain of Cytosolic Phospholipase A2	797	576	140	0	X
36133	peptide from p73 tumor suppressor, Bcl-2-like protein 1	797	394	164	0	X
28016	Cor a 1.0404	797	636	151	0	X
15265	Orf c02003 protein	796	574	141	0	X
18433	mouse Rev1 CTD in complex with the RIR of Pol Kappa	796	460	132	0	X
5931	RNase H domain of the HIV-1 reverse transcriptase	796	587	150	0	X
5571	flavodoxin monomer	796	657	175	0	X
15242	a single polypeptide chain	796	608	134	0	X
34329	Sperm-associated antigen 1	796	555	143	0	X
4851	CDC4P from Schizosaccharomyces pombe	796	457	146	0	X
11105	Thioredoxin-related transmembrane protein 2	796	609	139	0	X
16318	CBP TAZ2/Adenoviral E1A Complex	795	424	131	0	X
18596	Eosinophil Cationic Protein	795	410	149	0	X
6340	AT3g03773 monomer	795	590	158	0	X
25567	YP_193882.1	795	551	140	0	X
5678	HNF6 protein	795	608	143	0	X
11463	Bromodomain of human BRPF1 in complex with histone H4K5ac peptide	795	550	130	0	X
17134	Domain 11 of the IGF2R	795	596	150	0	X
19709	HR8998C	794	584	147	0	X
25584	complex between the PH domain of the Tfb1 subunit from TFIIH and the N-terminal activation domain of EKLF (TAD1)	794	578	144	0	X
17287	M6P/IGF2_receptor	793	585	146	0	X
5211	SAP/SH2D1A bound to peptide n-Y-c	793	554	126	0	X
6914	WILSON DISEASE ATPASE	793	645	164	0	X
15584	STR220	793	586	139	0	X
6366	Hypothetical protein yqbG	793	483	127	0	X
26518	putative transfer protein TraH from Gram-positive conjugative plasmid pIP501	793	563	147	0	X
25016	Y125F mutant of eRF1 N-domain	793	441	146	0	X
6620	p22HBP monomer	793	470	154	0	X
7021	LpMip	793	663	178	0	X
6297	GCN2	793	575	134	0	X
25437	Endo T5-ZN+2	792	475	135	0	X
19538	IMS DOMAIN OF THE MITOCHONDRIAL IMPORT PROTEIN TIM21 FROM S. CEREVISIAE	792	451	129	0	X
7106	RGS18 monomer	792	601	134	0	X
30606	M protein	792	579	145	0	X
19117	Domain 11:IGF2 complex	792	558	150	0	X
34191	Microtubule-associated protein RP/EB family member 1	792	558	146	0	X
34224	RNA polymerase II-associated protein 3, Heat shock 70 kDa protein 1B	792	508	132	0	X
15335	SyR11	792	608	178	0	X
18550	V210I	791	460	132	0	X
5366	Vacuolar morphogenesis protein	791	575	127	0	X
18166	HR4403E	791	560	141	0	X
15855	Gadd45a	790	627	153	0	X
6047	Organomercurial Lyase	790	655	173	0	X
15020	exWIP-EVH1	790	578	139	0	X
17128	Domain 11 mutant	790	593	145	0	X
34223	RNA polymerase II-associated protein 3, Heat shock protein HSP 90-alpha	790	527	141	0	X
11311	Transforming growth factor-beta induced protein IG-H3	790	608	142	0	X
15388	F153W cTnC	790	509	154	0	X
16366	TM1076	789	621	133	0	X
17399	CBM3	789	583	147	0	X
15633	CXCL12/SDF1-alpha	789	554	132	0	X
25087	MPMV MA Y28F Y67F	789	575	141	0	X
19954	Nrd1p CID - Trf4p NIM complex	789	374	152	0	X
7228	UPF0107 protein AF0055	789	454	140	0	X
19098	Nop6	788	581	136	0	X
25020	E55Q mutant of eRF1 N-domain	788	444	146	0	X
17693	RRM domain of mRNA export adaptor REF2-I bound to HVS ORF57 peptide	788	535	153	0	X
15958	Shq1p	788	379	136	0	X
25266	decorin binding protein B	788	711	173	0	X
19111	USP25	787	603	162	0	X
17723	ChR145	787	616	152	0	X
6621	Interleukin-2	787	445	142	0	X
19957	DNA-MC1	787	78	103	0	X	X
25476	His_ST-Crl	787	570	131	0	X
4737	NusB	787	474	136	0	X
18653	Bacterial Intein-Like domain from Clostridium thermocellum	787	607	139	0	X
11365	PROTEIN	787	580	123	0	X
4039	synaptotagmin I C2A	786	615	134	0	X
17293	Zn-Dph4	786	525	135	0	X
17303	human liver fatty acid binding protein	786	0	140	0	X
6460	ywlE	785	596	146	0	X
5327	Hif-1alpha/CBP complex	785	467	154	0	X
34285	Activity-regulated cytoskeleton-associated protein	785	615	150	0	X
7272	RGS10	785	586	142	0	X
16773	CI-MPR domain5	785	570	153	0	X
25155	apo FldB	785	623	160	0	X
4330	ALPHA-BETA T CELL RECEPTOR (TCR) (D10)	785	107	209	0	X
6343	PA1324 (21-170)	784	614	154	0	X
18788	staphylococcal nuclease E43S mutant	784	567	138	0	X
5928	enth-vhs domain	784	585	129	0	X
25176	Filamin repeat 21 bound to integrin	784	400	133	0	X
19921	hIFABP-oleate complex	784	454	158	0	X
18613	Eph receptor	784	449	163	0	X
17302	human liver fatty acid binding protein	784	0	140	0	X
6438	CikA C-terminus	783	476	147	0	X
6226	EW29 monomer	783	591	133	0	X
17534	SpaI monomer	783	564	137	0	X
4821	DcuS	782	559	140	0	X
18628	MS1	782	586	145	0	X
25443	Heterodimeric complex composed of Snu17p/Ist3p(25-138) and Pml1p(22-42)	782	572	135	0	X
17974	PAT Pyk2 and Paxillin LD motif	782	438	143	0	X
19801	monomer1	782	577	146	0	X
18428	PilQ	781	721	209	0	X
15469	nsp3(513-651)	781	615	143	0	X
4251	Src homology domain 3 and 2	781	443	148	0	X
6901	DUSP DOMAIN OF HUSP1	781	586	136	0	X
15504	MxiM - MxiD complex	781	508	116	0	X
15179	Inhibitor-2	781	624	141	0	X
25157	Decorin Binding Protein A	781	682	155	0	X
19432	Cat r 1	781	507	166	0	X
6071	Coactosin like protein	781	584	162	0	X
27259	HuPrPG127V	780	532	147	0	X
25061	Structure of De novo designed Protein OR457	780	583	120	0	X
28058	4Ca.SPM	780	608	162	0	X
16811	SrtA	780	592	146	0	X
5689	Pheromone Binding Protein from Antheraea polyphemus	779	548	147	0	X
7395	RWD/GI domain	779	424	130	0	X
5145	human Doppel	778	406	150	0	X
25250	PrPdelta190-197	778	569	141	0	X
25995	human Rpn13 Pru domain	778	581	149	0	X
17809	AHSA1-like protein AHA_2358	778	592	158	0	X
5261	Nuclease A Inhibitor	778	589	141	0	X
6029	Type IA potassium translocating ATPase B chain	777	554	147	0	X
4919	ERp29 N-domain	776	251	129	0	X
5929	hypothetical rhodanase domain	776	559	142	0	X
34384	Tyrosine-protein phosphatase non-receptor type 11 (E.C.3.1.3.48), ITSM	776	514	125	0	X
18346	NP_390037.1 from Bacillus subtilis	776	432	141	0	X
4679	Human Collagenase-3	776	635	140	0	X
17318	YP_001092504.1	775	542	140	0	X
16364	Mb1858	775	586	150	0	X
17124	NP_888769.1	775	565	142	0	X
5280	cellular Qin winged helix domain	775	548	133	0	X
26048	H-NOX Monomer	775	603	149	0	X
19235	Aha1 dimer from Colwellia psychrerythraea	774	603	136	0	X
17493	MoCVNH-LysM module from the rice blast fungus Magnaporthe oryzae protein MGG_03307	774	407	168	0	X
11124	Calponin 1	774	565	144	0	X
16772	CI-MPR domain5	774	569	151	0	X
10090	hypothetical protein F20O9.120	774	569	130	0	X
15211	protein yxeF	774	542	131	0	X
26580	nuclear egress subunit M50 from murine cytomegalovirus	774	632	162	0	X
17734	PipB2	773	575	132	0	X
15603	LIPOPROTEIN SPR	773	580	135	0	X
4082	profilin	773	440	144	0	X
25690	eukaryotic elongation factor 1B monomer	773	579	137	0	X
5031	KaiA N-terminus	773	596	147	0	X
30605	M protein	773	569	146	0	X
5212	SAP/SH2D1A bound to peptide n-pY	773	557	133	0	X
19782	RodA	772	566	153	0	X
4041	synaptotagmin I C2A	772	611	134	0	X
11122	Smooth muscle cell associated protein-1, isoform 2	772	585	144	0	X
4791	HCV NS3 RNA helicase	772	577	143	0	X
15669	PH domain of GRP1	772	475	124	0	X
19624	circular sortase A	772	0	159	0	X
26840	GacSperi monomer	772	568	148	0	X
30478	Fatty acid-binding protein, liver	772	449	145	0	X
6645	hv-DHFR1	772	599	147	0	X
30477	Fatty acid-binding protein, liver	772	446	144	0	X
34361	Surface protein, mlp lipoprotein family	771	427	129	0	X
11578	complex between p53 transactivation domain 2 and TFIIH p62 PH domain	771	497	116	0	X
26660	src-lactose	771	552	140	0	X
27893	D99-LicT-CAT-PRD1 dimer	771	485	163	0	X
15740	protein K7 from the Vaccinia virus	771	612	145	0	X
34042	Adhesin protein	771	614	130	0	X
16880	UBM2 in Complex with Ubiquitin	771	432	130	0	X
17249	R2	771	606	160	0	X
4449	antifreeze protein type III intramolecular dimer RD3	771	259	140	0	X
5813	Potential copper-transporting ATPase	771	552	156	0	X
25350	PsbQ from spinacia oleracea	770	638	148	0	X
18826	C-terminal CFTR peptide and extended PDZ2 domain from NHERF1	770	508	132	0	X
15941	Methionine Sulfoxide Reductase	770	556	134	0	X
6313	Pheromone-binding protein	770	555	145	0	X
25968	Mal d 1.0101	770	614	152	0	X
15295	At3g28950.1	769	612	149	0	X
6783	RKIP	769	724	170	0	X
15560	RecA miniIntein	769	599	148	0	X
7276	Blo t 5	769	595	142	0	X
6284	DnaG-C	769	425	159	0	X
6003	Bundlin forming pilus subunit	768	610	148	0	X
18182	Vav2 and Arap3	768	455	111	0	X
5320	B-FABP	768	0	142	0	X
11251	Zinc finger FYVE domain-containing protein 21	768	593	137	0	X
18994	zNTD	768	538	138	0	X
4959	epsin ENTH domain	768	606	142	0	X
7270	x82	768	566	156	0	X
6052	HR969	768	583	143	0	X
17496	PA4608	768	573	153	0	X
16042	hb-FABP	767	369	143	0	X
4407	Gaip protein	767	452	125	0	X
10141	AP-1 complex subunit gamma-2	767	583	127	0	X
4717	C-terminal FtsZ binding domain of E. coli ZipA	767	611	136	0	X
6013	alpha-actinin-4 spectrin repeat 3	767	480	138	0	X
6711	Ubc7	767	645	147	0	X
11101	Protein disulfide-isomerase A4	767	600	137	0	X
5267	SdbA type II cohesin module	766	650	162	0	X
4417	Major Pollen Allergen Bet v 1-L	766	565	152	0	X
18671	complex between the Sgt2 homodimerization domain and the Get5 UBL domain	766	522	136	0	X
15914	Binder of Arl2	766	576	133	0	X
10147	Sperm flagellar protein 1	766	557	124	0	X
16007	TM1367	766	550	126	0	X
27264	HuPrPM129	766	505	130	0	X
17255	GIP/Glutaminase L peptide complex	766	388	136	0	X
4673	ileal lipid binding protein	765	0	0	0	X
19961	SUMO Dimer in Complex with SIM2-3 from RNF4	765	484	113	0	X
27477	ITCH C-lobe	765	571	130	0	X
16038	pOdhI	765	408	150	0	X
26697	CSE4 (CENP-A) protein	765	901	218	0	X
30325	Uncharacterized protein	765	445	152	0	X
5363	hERR2-DNA complex	764	322	98	0	X	X
15807	gpV	764	539	149	0	X
34202	Uncharacterized protein	763	557	122	0	X
30550	AAEL005772-PA	763	537	137	0	X
4152	Adenylate kinase from E. coli	763	381	200	0	X
27158	CHIKV macro domain	763	604	137	0	X
4301	Pathogenesis-related Protein P14a	763	408	156	0	X
15249	Cyclic Nucleotide Binding Domain (CNBD) in Complex with cAMP	762	589	139	0	X
16748	AafA-dsc	762	607	136	0	X
18154	YqcA from Escherichia coli	761	560	137	0	X
6573	vacuolar protein sorting factor 4A	761	402	131	0	X
10115	Oxysterol binding protein-related protein 8	761	573	132	0	X
10034	KIAA0970 protein	761	577	134	0	X
19395	human holo-PRL-3 in complex with vanadate	761	427	130	0	X
7131	IGF2R domain 11	761	595	147	0	X
15097	D6-HP	761	521	176	0	X
26909	E coli DNA polymerase III delta subunit (residues 1-140)	761	587	148	0	X
4173	stromelysin-1 subunit 1	760	0	151	0	X
6528	CbpA	760	563	119	0	X
19151	apo YqcA	760	587	138	0	X
7206	human RNase 7	759	522	118	0	X
15693	Pax8 paired Box Domain	759	558	151	0	X
5987	CBP TAZ1 domain and CITED2 CAD	759	481	145	0	X
4837	CYTOCHROME C''	759	0	0	0	X
16885	UBM1-Ubiquitin complex	759	423	131	0	X
15126	CmtB	759	579	149	0	X
15357	SNase complex	759	580	141	0	X
4945	Vam3p N-terminal domain	759	502	126	0	X
18982	CIC_polypeptid	758	390	124	0	X
25120	cTnC-cTnI[1-73]-cTnI[144-163]	758	615	162	0	X
16186	PSPTO_3016	758	561	124	0	X
18604	Solution structure of CCP modules 10-11 of complement factor H	758	568	123	0	X
19758	RPAP3	758	537	132	0	X
15038	pfFKBP35FKBD	757	514	129	0	X
4056	calmodulin W-7 complex	757	560	135	0	X
10083	Regulating synaptic membrane exocytosis protein 2	757	561	136	0	X
11011	CopA	757	416	149	0	X
18900	NMR structure of the catalytic domain from E. faecium L,D-transpeptidase	756	577	136	0	X
15240	ERCC1 central	756	443	125	0	X
6339	AT1g01470 monomer	755	580	146	0	X
17412	GABARAPL-1 and NBR1-LIR complex	755	506	110	0	X
17270	Brd3 in complex with GATA-1 C-tail	755	589	141	0	X
18312	PiCyp_A	755	665	171	0	X
15618	nsp3(527-651)	755	481	130	0	X
11508	Csk_SH2:Cbp_phosphopeptide complex	755	581	137	0	X
10073	putative elicitor-responsive gene	754	581	134	0	X
30321	Sorting nexin-25	754	535	131	0	X
19738	second bromodomain of Brd4 with Di-acetylated Twist peptide	754	454	118	0	X
16271	OCRL bridges clathrin-mediated membrane	753	424	131	0	X
1061	interleukin 1-beta	753	532	0	0	X
18553	ZirS C-terminal Domain	753	540	125	0	X
5516	Coxsackievirus and Adenovirus receptor	753	560	128	0	X
17267	uncharacterized thiredoxin-like protein	753	552	129	0	X
15440	HasB	753	546	125	0	X
16616	monomer	752	362	139	0	X
27612	MAYV macro domain in complex with ADP-ribose	752	456	140	0	X
19843	ternary complex of human ileal bile acid-binding protein with glycocholate and glycochenodeoxycholate	752	541	139	0	X
4818	N-Terminal Domain of MKP-3	752	498	160	0	X
17622	Solution structure of the closed conformation of human U2AF65 tandem RRM1 and RRM2 domains	752	497	187	0	X
18530	C7CCPs	752	569	132	0	X
6277	ubiquitin conjugatin enzyme 5B	752	519	144	0	X
25855	Zipcode-binding-protein-1 KH3(DD)KH4 domains in complex with the RNA target UCGGACU	751	403	0	0	X		X
1062	interleukin 1-beta	751	530	0	0	X
25854	Zipcode-binding-protein-1 KH3KH4(DD) domains in complex with the RNA target CACACCC	751	403	0	0	X		X
16569	cgr26a	751	573	155	0	X
16493	aFGF/MIHS complex	751	0	0	0	X
6236	APP770	751	545	129	0	X
16349	Tyrosine-protein kinase ABL2	750	547	145	0	X
5789	nitrogen regulatory enzyme IIA	750	653	161	0	X
16672	transmembrane domain of the n-acetylcholine receptor beta2 subunit	750	458	134	0	X
36119	DISC1_Ndel1	750	434	132	0	X
18313	A domain of talin	750	552	145	0	X
17749	entity	749	407	126	0	X
18716	HIV-1 myr(-) matrix protein in complex with 1,2-dioctanoyl-sn-phosphatidyl-L-serine	749	434	131	0	X
5374	protein of 2S albumin storage protein from Ricinus communis	749	0	126	0	X
6444	MMP12	749	318	157	0	X
34225	Non-structural 3 protease	748	519	137	0	X
6334	Mip (77-213) monomer	748	568	133	0	X
6390	R-module	748	571	166	0	X
4198	N-terminal domain of syntaxin 1A	748	518	128	0	X
18439	BRD4 second bromodomain with NF-kB-K310ac peptide	748	444	117	0	X
10113	SH2 and PH domain-containing adapter protein APS	747	556	125	0	X
25047	RRM-PEPTIDE and RES COMPLEX	747	427	132	0	X
11212	Myosin-binding protein C, slow-type	747	550	114	0	X
4965	L11	747	635	146	0	X
25001	aggregative adherence fimbriae	747	595	134	0	X
7298	Znf-UBP domain of Ubp-M	747	411	134	0	X
25831	complex of microRNA 20b pre-element with Rbfox RRM	746	566	115	0	X		X
25512	VirB9 C-terminal domain in complex with VirB7 N-terminal domain from Xanthomonas citri's T4SS	746	470	114	0	X
16788	NusG:NusE	746	410	120	0	X
15431	single polypeptide chain	746	582	141	0	X
7204	KP1966_monomer	746	587	142	0	X
10031	KIAA1617 protein	746	558	125	0	X
5850	protein tyrosine phosphatase (E.C.3.1.3.48)	746	439	153	0	X
18329	DBPA	746	633	156	0	X
34003	Major prion protein	745	427	143	0	X
19156	Hedgehog Autoprocessing Domain	745	581	134	0	X
17751	Diiron	745	404	126	0	X
16874	rat Lipocalin-Type Prostaglandin D Synthase	745	599	153	0	X
6597	Aryl hydrocarbon receptor nuclear translocator	744	545	133	0	X
15427	F104(FTR) cTnC	744	657	153	0	X
5819	CuA domain	744	553	138	0	X
10080	putative 42-9-9 protein	744	586	132	0	X
15084	CDA-BABP complex	744	596	123	0	X
11303	RING finger protein 25	743	567	129	0	X
15700	human_N-termal_doamin_of_pirh2	743	519	132	0	X
5165	Conserved Hypothetical Protein MTH1598	743	585	141	0	X
19195	alfa-actinin from parasite Entamoeba histolytica	743	537	136	0	X
16093	SRU_2040	743	431	131	0	X
10317	Pleckstrin homology domain-containing family A member 5	743	558	117	0	X
4325	dimeric B domain of protein A	743	0	0	0	X
15201	denatured OmpX	743	550	146	0	X
5570	DR0079	743	580	166	0	X
18911	NMR structure of the catalytic domain from E. faecium L,D-transpeptidase acylated by ertapenem	743	555	130	0	X
27305	RD3 monomer	743	521	142	0	X
4127	Origin DNA-binding domain of SV40 T-antigen	743	475	130	0	X
6081	troponin C	743	590	171	0	X
5347	RNase H domain of the HIV-1 reverse transcriptase	742	552	139	0	X
18715	MA	742	434	131	0	X
11546	sin1	742	559	144	0	X
4307	Recombinant Syrian hamster prion protein	742	401	168	0	X
15557	ADF monomer	742	571	141	0	X
6231	hPAP	742	552	143	0	X
11113	Thioredoxin domain containing protein 1	742	564	131	0	X
6045	pfr13 monomer	742	533	117	0	X
17623	Model of human U2AF65 tandem RRM1 and RRM2 domains with eight-site uridine binding	742	375	184	0	X		X
4045	DNA Topoisomerase I	741	441	110	0	X
6142	PDF 147	741	421	135	0	X
10235	amyloid beta (A4) precursor protein-bindin, family B, member 2	741	567	136	0	X
16311	VEK-30/plasminogen kringle 2 complex	741	523	128	0	X
27307	RNase P protein monomer	741	547	115	0	X
6104	Calcium-dependent protein kinase SK5 (E.C.2.7.1.-)	741	531	157	0	X
10125	hypothetical protein RIKEN cDNA 2310016K04	741	547	124	0	X
17755	Reg I-alpha monomer	741	552	144	0	X
7249	His-15.5K	741	557	130	0	X
7122	Methylated-DNA--protein-cysteine methyltransferase (E.C.2.1.1.63)	740	580	147	0	X
10249	Pleckstrin	740	556	124	0	X
10026	MAP/microtubule affinity-regulating kinase 3	740	559	141	0	X
16789	usp7-ubl1	740	524	123	0	X
17090	YP_399305.1	740	513	130	0	X
26687	CaM34-iNOS	740	419	144	0	X
6739	Selenoprotein M	740	534	123	0	X
7061	Talin-1	740	441	123	0	X
11203	Calcyclin-binding protein	740	565	126	0	X
5999	Argonaute 2 PAZ domain	740	470	131	0	X
17370	protein BVU 1572(27-141)	740	549	132	0	X
34424	Iron-regulated protein FrpA	739	576	156	0	X
17735	sf3636	739	528	120	0	X
18802	SF1N	739	553	116	0	X
19752	LysGH15	739	560	136	0	X
18712	b-flap domain of RNA polymerase (B. subtilis)	738	409	138	0	X
5974	BopE	738	672	175	0	X
6310	hPPIL1 monomer	738	615	159	0	X
17272	Human PIWI-like 1 PAZ domain	738	456	138	0	X
25042	Second RNA Recognition Motif Domain of hnRNP L bound to ACACAC RNA	738	419	134	0	X		X
26661	src-6'-sialyllactose	738	515	125	0	X
17273	human PIWI-like 1 PAZ domain with ssRNA (5'-pUGACA)	738	456	138	0	X		X
34281	Major allergen Cor a 1.0401	738	572	127	0	X
16835	Atg8	737	521	113	0	X
27397	TolAIII-TolBp	737	523	140	0	X
36117	Ran guanine nucleotide release factor	737	569	160	0	X
18464	NCX3	737	572	135	0	X
15581	MPMV NTD CA	737	564	151	0	X
18480	major ampullate spidroin 1 N-terminal domain	737	537	152	0	X
16334	nonmyristoylated NCS1	737	502	175	0	X
19054	human apoptotic protein tBid	737	564	125	0	X
25989	E1A-12S monomer	737	673	222	0	X
16558	MAGI-1 PDZ1	737	555	125	0	X
6030	Type IA potassium translocating ATPase B chain	736	413	144	0	X
6693	BoR11	736	559	140	0	X
6869	DNA polymerase III subunit tau	736	501	135	0	X
30444	Bromodomain-containing protein 2	736	528	116	0	X
15802	general stress protein	736	525	131	0	X
15785	C2A	736	531	134	0	X
16628	MloK1 CNBD monomer	736	540	134	0	X
19736	1-C-Grx1	735	594	132	0	X
16954	NHR3/PKA(RIIa) Complex	735	470	134	0	X
15952	S100A13-C2A binary complex	735	529	134	0	X
11109	Protein disulfide-isomerase A4	735	575	122	0	X
6723	soluble apo-CcmE	735	369	126	0	X
16731	putative disulphide-isomerase	735	565	117	0	X
6515	At2g46140	735	638	164	0	X
15507	Mip-rapamycin complex	734	581	137	0	X
34216	Uncharacterized protein	734	538	126	0	X
5397	heterodimer of Z-domain and ZSPA-1 affibody	734	500	134	0	X
26657	MERS-CoV macro domain	734	578	158	0	X
25979	ADRM1-RPN2 complex	734	545	128	0	X
19876	YmoB. A modulator of biofilm formation	734	505	123	0	X
7269	fivar_doc	734	519	145	0	X
16307	Truncated hemoglobin	734	537	142	0	X
16734	PknB_PASTA34	734	378	148	0	X
5455	PRL-3	733	588	149	0	X
7256	Hydrogenase-1 operon protein hyaE	733	544	119	0	X
18028	CaM bound to NOS peptides	733	144	145	0	X
17066	N-Terminal PAS Domain of HERG K Channel	733	531	146	0	X
11337	RWD domain-containing protein 3	733	555	125	0	X
6797	OmlA	733	530	139	0	X
4248	Lymphoid enhancer-binding factor	733	309	88	0	X	X
16240	SlyD	732	609	148	0	X
36163	Bromodomain-containing protein 4	732	449	124	0	X
10101	2610208M17Rik protein	732	530	126	0	X
5504	Csk homologous kinase SH2 domain	732	352	122	0	X
17451	M2-1	731	533	129	0	X
30043	Macro domain (E.C.2.1.1.-,2.7.7.-,3.1.3.33,3.4.22.-,3.6.1.15,3.6.4.13,2.7.7.48)	731	441	136	0	X
4969	Bruc D4.4 VH fragment	731	360	140	0	X
7115	eIF4E	731	553	213	0	X
19927	Mayaro macro domain	731	441	136	0	X
7022	DUF589_monomer	731	606	151	0	X
16428	KlcA and ArdB proteins	731	559	149	0	X
6712	C4BP12	730	546	132	0	X
27051	Ixolaris	730	515	134	0	X
5897	homolog Bcl-2 Epstein Barr Virus	730	639	143	0	X
18539	protein_16	730	433	133	0	X
30126	La-related protein 7	729	520	121	0	X
15718	myoferlin	729	544	132	0	X
11076	MESD core region	729	460	133	0	X
16946	hERG1-135	729	522	141	0	X
6075	arsenate reductase monomer	729	526	147	0	X
15690	protein complex MNK1-Cu(I)-HAH1	729	564	137	0	X
16767	Reg IV	729	523	145	0	X
34294	Receptor-interacting serine/threonine-protein kinase 2 (E.C.2.7.11.1)	729	530	131	0	X
10251	Pleckstrin 2	729	550	124	0	X
6986	Phosphotyrosine binding domain of chicken tensin 1	729	385	135	0	X
16100	DR_A0006	729	431	118	0	X
25918	Erythrobacter litoralis PhyR response regulator REC domain	729	557	131	0	X
16260	PvFKBD	728	497	127	0	X
15059	MLP	728	485	163	0	X
17148	MS1	728	539	160	0	X
16732	PknB_PASTA12	728	392	146	0	X
16494	aFGF	728	0	0	0	X
4049	Urokinase-type plasminogen activator	728	398	122	0	X
30139	Zoocin A endopeptidase	728	575	160	0	X
15001	ADD domain	728	399	139	0	X
15716	AlgE6R1	728	542	155	0	X
6963	Second Kunitz domain of human WFIKKN1	728	0	0	0	X
15400	F153(FTR) cTnC	727	490	151	0	X
11329	Possible global transcription activator SNF2L2	727	528	115	0	X
6938	monomer region 51-160 of human KIN17	727	531	120	0	X
16637	PDZ2-270	727	495	123	0	X
6333	ABA-1A with oleic acid	726	446	129	0	X
18314	FOXO3a	726	512	124	0	X
11338	RWD domain-containing protein 1	726	552	130	0	X
5554	N-WASP EVH1 Domain-WIP complex	726	522	122	0	X
17485	mSin3A PAH2-Pf1 SID1 Complex	726	545	136	0	X
6023	calmodulin-protein phosphatase 2B peptide complex	725	565	142	0	X
5741	Dihydrofolate reductase	725	457	150	0	X
17512	primase CTD	725	565	135	0	X
4857	HPt-ArcB	725	513	134	0	X
18315	FOXO3a	725	512	124	0	X
11451	peptidyl-prolyl cis-trans isomerase	724	497	173	0	X
10107	microtubule-associated protein, RP/EB family, member 1	724	539	125	0	X
15433	holoLFABP	724	608	135	0	X
19791	Complex Between the Acidic Transactivation Domain of EBNA2 and the Tfb1/p62 subunit of TFIIH	724	441	121	0	X
34423	Secreted protein	724	344	127	0	X
15434	cpxLFABP	724	608	135	0	X
4252	Abl SH(32) complex	724	407	151	0	X
18842	complex between the PH domain of the Tfb1 subunit from TFIIH and Rad4	724	552	144	0	X
26912	Nrd1	724	625	138	0	X
30003	CREB-binding protein,Cellular tumor antigen p53 (E.C.2.3.1.48)	724	385	122	0	X
6980	BC009474	724	591	144	0	X
17254	GIP apo	723	502	131	0	X
16813	complex of Ubl and SH3	723	406	150	0	X
25243	Arsenate Reductase	723	542	138	0	X
27148	PACT-D3 homodimer	723	584	155	0	X
36013	DP1, General transcription factor IIH subunit 1	723	557	134	0	X
5058	GABARAP	722	527	105	0	X
17176	BT_0084 lipoprotein	722	546	128	0	X
6190	Cytochrome C oxidase assembly protein ctaG	722	330	136	0	X
4083	CheY	722	423	127	0	X
16733	PknB_PASTA23	722	387	139	0	X
10312	Solution structure of the PH domain of Protein kinase C, nu type from human	722	545	131	0	X
7107	kFABP	722	524	134	0	X
11468	THE BOMBYX MORI LYSOZYME	722	536	139	0	X
4984	CheW	722	628	146	0	X
19610	p300 Taz2:ETAD1 complex	721	558	134	0	X
18856	GtYybT PAS Homodimer	721	498	122	0	X
11569	MIP-MDM2	721	575	115	0	X
17392	complex of CBP bromodomain with small molucule J28	721	442	122	0	X
11029	Siz1 1-111	721	505	125	0	X
6208	hr532 monomer	721	401	126	0	X
4342	Frataxin	721	485	125	0	X
4519	Translation initiation factor 1A	721	515	131	0	X
30102	DNA damage-inducible protein 1	721	507	126	0	X
10131	pleckstrin homology domain-containing, family A	721	537	135	0	X
6995	g2 complexed with GDP	721	620	142	0	X
17551	cI-BABP-GCDA complex	720	472	129	0	X
15306	C2 domain of Smurf2	720	433	138	0	X
4920	ERp29 C-domain	720	224	127	0	X
34290	functional pRN1 primase/DNA Complex	720	376	104	0	X	X
19562	FRS2a PTB domain with neurotrophin receptor TrkB	720	419	134	0	X
15778	CHIPS-C5aR(P7-28S)	720	416	102	0	X
30575	Nephrocystin-1	719	518	122	0	X
5912	ATP-dependent DNA helicase II, 80 kDa subunit	719	535	121	0	X
5879	S.typhi type IVb pilin	719	563	152	0	X
18261	A72R	719	542	142	0	X
17713	Fpr4p(280-392)	719	532	120	0	X
16832	C-terminal domain from mtTyrRS	719	524	137	0	X
11108	Thioredoxin-like protein 2	719	554	128	0	X
6755	TA0743	718	360	111	0	X
25398	N-terminal domain from A. ventricosus minor ampullate spidroin (MiSp) at pH 5.5	718	469	145	0	X
4300	HPPK-AMPPCP complex	718	240	139	0	X
15707	split PH domain from Phospholipase C gamma 2	718	522	124	0	X
7170	sr482 monomer	718	510	125	0	X
6716	DNA primase (E.C.2.7.7.-)	718	581	134	0	X
17325	Engrailed 2	718	520	127	0	X
25914	RNF126 N-terminal zinc finger domain in complex with BAG6 Ubiquitin-like domain	718	548	136	0	X
19419	C-Ala domain of alanyl-tRNA synthetase	718	530	130	0	X
10126	Hypothetical KIAA1002 protein	718	531	121	0	X
15011	Spo0FY13A monomer	718	545	128	0	X
25306	OAA monomer	717	511	157	0	X
5589	VC0424	717	552	130	0	X
6960	CREB-binding protein	717	441	116	0	X
19043	Protein A binding by an engineered Affibody molecule	717	507	135	0	X
18599	FH11-12	717	550	125	0	X
25324	ligand-free OAA	717	511	157	0	X
7009	Sodium/calcium exchanger 1	716	410	134	0	X
16859	histone_N-terminal_H3/double_PHD_fingers complex	716	364	117	0	X
34422	Double-stranded RNA-binding protein Staufen homolog 1/RNA Complex	716	506	80	0	X		X
34428	RNA-binding protein 20/RNA Complex	716	501	123	0	X		X
5602	DR2356	716	535	133	0	X
25692	OVIS ARIES PRP	716	0	148	0	X
30295	Blasticidin M	715	621	140	0	X
15048	Rub184GDP	715	528	167	0	X
6806	Ztaq:anti-Ztaq	715	485	134	0	X
11422	CTP pyrophosphohydrolase	715	557	132	0	X
4327	N-terminal inhibitory domain of human tissue inhibitor of metalloproteinases-1	715	539	122	0	X
5011	Anabaena PCC 7119 apoflavodoxin	715	23	156	0	X
27634	Menangle virus Phosphoprotein, C-terminal region	715	513	127	0	X
19757	RPAP3	715	501	126	0	X
16258	RCL	715	634	146	0	X
4436	CYTOCHROME C3	714	0	0	0	X
15229	Translation initiation factor	714	0	0	0	X
17414	RecA	714	288	137	0	X
11201	KIAA1095 protein	714	519	139	0	X
6564	OSCP N-terminal domain	714	419	120	0	X
30517	Potassium voltage-gated channel subfamily KQT member 1	714	506	145	0	X
5393	N-terminal domain of the adenylyl cyclase associated Protein	714	542	173	0	X
6965	CuA domain	713	0	122	0	X
25125	Apo form of the Receiver Domain of Nitrogen Regulatory Protein C ( NTRC ) at 35C	713	542	124	0	X
10333	BK158_1	713	529	109	0	X
17332	vbs2b	713	522	148	0	X
16382	Alr3790	713	534	143	0	X
18235	N-dre2	713	466	127	0	X
19711	native split Npu DnaE intein	713	536	136	0	X
11062	lipocalin-type prostaglandin D synthase	713	465	165	0	X
18183	Vav2	713	431	116	0	X
15253	dihydrofolate reductase with folate bound	713	553	143	0	X
25400	lcFABP	713	512	136	0	X
18262	Major_ampullate_spidroin_1	712	418	142	0	X
17288	SaMazF	712	523	121	0	X
6744	C-terminal domain of RP2	712	494	127	0	X
16858	histone_H3_acet_lys_14/double_PHD_fingers complex	712	364	117	0	X
16072	SSP0047	712	547	120	0	X
25124	BeF3 activated Receiver Domain of Nitrogen Regulatory Protein C ( NtrC ) at 35C	712	549	126	0	X
16679	GNA 2132	712	524	133	0	X
17683	HR3023C	712	528	120	0	X
30186	PS1	712	377	129	0	X
18443	thioredoxin	712	547	121	0	X
16942	SR518	712	542	135	0	X
15715	MsrB2dS	712	516	132	0	X
11427	SAE2	711	542	124	0	X
4114	B-MYB	711	348	127	0	X
19599	hman EPRS R12 repeats	711	520	136	0	X
18459	N0 domain of Neisseria meningitidis Pilus assembly protein PilQ	711	518	133	0	X
15120	MMP3 complexed with NNGH	711	336	155	0	X
15412	Snu13p	711	549	130	0	X
27925	Protrusio domain monomer	711	552	127	0	X
5009	p13suc1	710	524	120	0	X
27442	Rpn5	710	557	144	0	X
25194	NisI	710	537	138	0	X
36176	26S proteasome regulatory subunit RPN5	710	557	144	0	X
10032	KIAA1798 protein	710	541	119	0	X
26765	Skp1	710	583	137	0	X
27453	Lpp1663	710	530	121	0	X
6149	complement contorl protein module pair 2-3 of complement receptor type 1	710	544	127	0	X
25230	Human FAAP20 UBZ-Ubiquitin Complex	710	522	122	0	X
25148	NTD-NUSA	710	530	121	0	X
6073	Hypothetical superoxide dismutase-like protein yojM	710	588	152	0	X
11126	Spectrin beta chain, brain 2	709	543	123	0	X
25028	NMR structure of the hypotheical protein Lreu_0056 from Lactobacillus reuteri	709	419	125	0	X
16336	NMB1076	709	406	129	0	X
16052	STAS domain of Rv1739c, a putative sulfate transporter of Mycobacterium tuberculosis	709	509	122	0	X
4562	Hen Egg White Lysozyme	709	407	0	0	X
7063	putative cytoplasmic protein	709	538	126	0	X
10074	synaptotagmin XIII	709	549	126	0	X
27856	RssB 1-125	709	507	126	0	X
11534	the GGQ domain of YaeJ protein	708	536	123	0	X
18412	phosphoprotein enriched in astrocytes 15A	708	472	132	0	X
17327	proteorhodopsin	708	783	223	0	X
5333	cytochrome c3	708	0	115	0	X
17853	DTA	708	663	193	0	X
30206	Bromodomain-containing protein 2, Stat3 peptide	708	448	100	0	X
16578	DSY1790	708	394	132	0	X
4370	Human Pancreatic Ribonuclease	707	0	143	0	X
16048	OLA-hb-FABP	707	388	141	0	X
16865	Tandem PHD finger of Human DPF3b	707	364	117	0	X
18636	MS1	707	544	139	0	X
16049	EIC-hb-FABP	707	388	141	0	X
19302	ERCC4 domain of human FAAP24	707	542	131	0	X
6864	tusp1	707	408	169	0	X
6431	II-III loop region of the skeletal dyhydropyridine receptor	707	510	110	0	X
17651	CheA	707	420	130	0	X
11296	RING finger protein 25	706	537	122	0	X
16047	ELA-hb-FABP	706	394	140	0	X
6529	Ber e 1 monomer	706	464	121	0	X
26553	Solution Structure of the Smarc Domain	706	333	110	0	X
17280	BvR159	706	551	125	0	X
5349	Extended PBX Homeodomain-DNA complex	706	317	89	0	X	X
16868	NusA	706	508	119	0	X
4841	mSin3B-PAH2 complexed to Mad1	706	439	114	0	X
10076	sidekick 2	706	546	123	0	X
15623	CaBP1	706	588	147	0	X
30523	Cell division protein FtsX	705	541	134	0	X
26985	tmRNA-binding protein	705	502	130	0	X
26992	NavII	705	503	149	0	X
18843	FUN-EGF3	705	512	136	0	X
11334	PHD finger protein 3	705	520	111	0	X
10092	interleukin-1 receptor-associated kinase 4	705	531	112	0	X
15989	Myb1	705	493	121	0	X
25137	EL_LovR	705	530	121	0	X
25210	PUTATIVE MEMBRANE PROTEIN IGAA HOMOLOG	705	524	111	0	X
17022	CmR116	705	512	131	0	X
5947	donor strand complemented AfaE-III	705	576	146	0	X
11142	Smoothelin splice isoform L2	705	531	123	0	X
18125	avidin	705	418	120	0	X
15611	ewr120 protein	704	506	141	0	X
15348	JARID1C	704	432	124	0	X
17283	Pae177	704	580	150	0	X
10057	nitrogen fixation cluster-like	704	508	124	0	X
6910	SMP-1	704	423	139	0	X
19321	cerato populin	704	528	135	0	X
6902	hFKBP38D	704	0	119	0	X
4214	Tissue Inhibitor of Metalloproteinases-2 (TIMP-2)	704	372	128	0	X
19625	TNPX	704	494	130	0	X
5685	RAP74/FCP1	703	572	139	0	X
11116	Protein disulfide-isomerase A6	703	550	123	0	X
15823	Atu0742	703	512	124	0	X
11388	Jumonji, AT rich interactive domain 1B	703	522	118	0	X
10149	Protein MICAL-2	703	529	123	0	X
4790	SNT PTB domain	703	354	110	0	X
17865	ViCin1-D1D2	703	499	114	0	X
4840	Adenylate kinase	702	333	178	0	X
15270	RP3097	702	515	121	0	X
10011	the SWIRM domain of human LSD1	702	525	119	0	X
17192	HR4495E	702	518	128	0	X
6403	Ovine Prion Protein Variant R168	702	353	131	0	X
17585	Rv0020c_Nter	702	342	140	0	X
16312	mul_A0064N	702	392	124	0	X
18432	Rev1	701	520	119	0	X
6132	poplar phloem peroxiredoxin	701	604	151	0	X
5162	SRm160	701	509	117	0	X
26021	Sr33 Coiled-coil domain	701	506	120	0	X
5822	RPA70(299-422) ssDNA binding domain	701	532	129	0	X
27536	CBMx	701	543	135	0	X
27785	dCUE	701	550	139	0	X
19042	Frataxin like monomer	700	365	121	0	X
11559	wild type hPin1 PPIase domain	700	507	127	0	X
11089	Pleckstrin homology domain-containing family A member 6	700	519	116	0	X
17393	CBP bromodomain with small molecule of HBS	700	430	122	0	X
10315	Rho GTPase activating protein 21	700	524	119	0	X
11090	Hydrocephalus-inducing protein homolog	700	521	119	0	X
4336	methylamine loaded form of the Glycine Cleavage System H-protein	700	413	129	0	X
15424	Cdc42(T35A) monomer	700	643	172	0	X
5788	CBP/p300-interacting transactivators with a glutamic acid/aspartic acid (ED)-rich tail/p300 complex	699	546	131	0	X
5564	kinase associated protein phosphatase kinase interaction domain	699	544	120	0	X
15197	CaBP1	699	593	145	0	X
6655	Zinc finger domains 1 and 2 of dsRBP-ZFa	699	528	141	0	X
11308	Protein arginine N-methyltransferase 3	699	542	112	0	X
34231	Histone acetyltransferase p300,Tumor protein 63 (E.C.2.3.1.48,2.3.1.-)	699	528	126	0	X
11560	C113D mutant human Pin1 PPIase domain	699	504	126	0	X
17312	Tah1 complex with C-terminus of Hsp90 (MEEVD)	699	535	117	0	X
5946	afaD-dsc	699	532	133	0	X
17900	BfR322	698	525	130	0	X
11106	midline 2 isoform 2	698	539	127	0	X
11078	Myeloid differentiation primary response protein MyD88	698	454	134	0	X
36014	Peptidyl-prolyl cis-trans isomerase NIMA-interacting 1 (E.C.5.2.1.8)	698	510	127	0	X
26638	apolipophorin III	698	625	185	0	X
10314	Pleckstrin homology domain-containing family B member 2	698	512	122	0	X
6990	Cerato-platanin	698	534	136	0	X
5222	tryparedoxin I	698	404	133	0	X
5540	flavodoxin monomer	698	546	144	0	X
34341	TasA anchoring/assembly protein	698	522	114	0	X
19968	tandem PHD fingers of CHD4	698	474	128	0	X
15800	galectin-1	698	371	141	0	X
15894	CuA center	698	482	104	0	X
17074	SynArsC	697	541	137	0	X
6312	flp monomer	697	557	132	0	X
11588	Human Pin1 PPIase C113S mutant	697	511	126	0	X
16559	MAGI-1 PDZ1 / E6CT	697	481	105	0	X
11587	Human Pin PPIase C113A mutant	697	505	125	0	X
26052	MapZ_QG	697	557	137	0	X
6272	MTH0776	697	463	110	0	X
16671	EH-domain proteins with specific NPF-containing partners	697	365	92	0	X
16507	MmPar3 PDZ3, MmVE-Cadherin	697	499	137	0	X
15977	CdnLC	696	499	119	0	X
17006	Atg19	696	491	118	0	X
5595	NosL	696	596	148	0	X
17806	YP_001302112.1	696	532	134	0	X
16861	Tandem PHD finger of Human DPF3b	696	364	117	0	X
6381	ovPrP,H168 monomer	695	360	130	0	X
25397	N-terminal domain from A. ventricosus minor ampullate spidroin (MiSp) at pH 7.2	695	504	140	0	X
17082	mouse prion protein with mutation F175A	695	479	135	0	X
30118	Endothelial PAS domain-containing protein 1	695	505	122	0	X
17599	Par-6	695	529	123	0	X
27753	CdiA-CT	695	421	136	0	X
7281	protein yjbR monomer	695	507	113	0	X
11100	Protein disulfide-isomerase A6	695	536	128	0	X
17849	yCaM_123	695	511	130	0	X
30276	Polyubiquitin-B, E3 ubiquitin-protein ligase RAD18 (E.C.2.3.2.27)	695	391	109	0	X
27755	CdiA-CT C49S C56S	695	418	138	0	X
19687	immune signalling subunit	695	408	144	0	X
25571	HIV-1 Core Packaging Signal	695	0	0	0			X
16723	mouse prion protein double mutant D167S, N173K	694	370	133	0	X
4466	Cu(I) Pseudoazurin	694	0	121	0	X
6383	eprp monomer	694	325	132	0	X
25907	reduced human cytochrome c	694	466	108	0	X
26517	TAM DOMAIN OF TIP5_BAZ2A	694	392	107	0	X
6971	PDI-b'	694	468	128	0	X
19372	Ani s 5 Anisakis simplex allergen	694	418	125	0	X
19727	HIFABP Ketorolac complex	694	434	126	0	X
19404	OR33_cns	694	504	110	0	X
19013	RRM domain of the hypothetical protein	694	532	131	0	X
4909	human galectin-3	694	275	124	0	X
16572	Lamin-B1	694	398	134	0	X
17973	onconase FLG variant	694	495	125	0	X
11398	HYPOTHETICAL PROTEIN (RIKEN cDNA 2810455B10)	694	501	131	0	X
15602	domain C of human PARP-1	693	446	141	0	X
19095	SsoSSB	693	505	133	0	X
19079	2A proteinase from a common cold agent, human rhinovirus RV-C02, strain W12	693	515	125	0	X
6465	pal-uyp	693	503	137	0	X
6364	PF0470 monomer	693	415	90	0	X
4242	Major Sperm Protein	693	410	132	0	X
19431	hypothetical protein	693	398	121	0	X
15723	nsp3(1066-1181)	693	519	114	0	X
18943	N-terminal domain of pneumococcal PhtD protein with bound Zn(II)	692	529	128	0	X
4299	6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase	692	240	127	0	X
6613	2A proteinase	692	573	125	0	X
26777	CheY3_BeF3_pH4.5	692	538	125	0	X
16102	BcR268F	692	511	123	0	X
5939	Spred2 EVH1 domain	692	353	127	0	X
19778	CPEB1RRM12 in complex with RNA	692	373	194	0	X		X
11120	Neogenin	691	531	130	0	X
16782	Photosystem II reaction center Psb28 protein	691	515	123	0	X
10319	KIAA0640 protein	691	508	109	0	X
18458	HIRAN domain	691	354	118	0	X
5748	p270 or Human SWI1	691	374	113	0	X
15646	sx23	691	605	151	0	X
17935	GATase subunit (monomer) of GMP Synthetase	691	395	185	0	X
17612	OR38	691	489	112	0	X
11188	InaD-like protein	690	502	128	0	X
15280	Dsbe_ox	690	541	134	0	X
6434	gpU	690	546	137	0	X
4062	myoglobin carbon monoxide complex	690	0	148	0	X
5623	matrix protein from Moloney Murine Leukemia Virus matrix protein	690	607	137	0	X
6269	chPrP (128-242)	690	355	135	0	X
15737	AcrA(61-210DD) glycosylated	690	387	117	0	X
16722	mouse prion protein double mutant D167S, N173K	690	367	134	0	X
17319	NP_253742.1	690	479	126	0	X
11490	Microtubule-binding domain	690	435	123	0	X
1379	flavodoxin	690	0	0	0	X
376	flavodoxin	690	0	0	0	X
16046	DHA-hb-FABP	690	384	138	0	X
17174	Mouse prion protein	690	369	135	0	X
17076	SynArsC	689	519	133	0	X
17992	Nicotinic_Acetylcholine_Receptor	689	334	127	0	X
18953	gammaM-crystallin	689	648	165	0	X
15628	PrsA-PPIase	689	484	110	0	X
3440	che Y protein	689	0	130	0	X
11246	Afadin 6	689	518	122	0	X
10042	KIAA1068 protein	689	521	122	0	X
18419	B2 domain of Neisseria meningitidis Pilus assembly protein PilQ	689	529	124	0	X
17991	Nicotinic_Acetylcholine_Receptor	689	334	127	0	X
5566	Phosphotyrosine binding domain of Shc	689	451	167	0	X
5482	DC 45-150	689	353	122	0	X
16180	EHD1/FNYESTNPFTAK complex	689	365	91	0	X
15895	apo form PCuA	689	479	104	0	X
27977	UBXD1-PUB domain	689	535	117	0	X
17752	hPRLR-D2	689	549	112	0	X
5866	Mutator mutT protein (E.C.3.6.1.-)	688	282	122	0	X
16562	ROSSMANN 2x2 FOLD PROTEIN	688	497	115	0	X
17213	Mouse prion protein (121-231) with the mutation Y169A	688	367	135	0	X
34365	Outer membrane protein AlkL	688	591	172	0	X
7267	HIV-1 unmyristoylated Matrix	688	453	132	0	X
16610	AsnRS	688	496	119	0	X
15897	PCuA	688	505	107	0	X
15896	copper loaded form PCuA	688	505	107	0	X
34126	MatA protein	688	393	120	0	X
25805	cyclic nucleotide-binding homology domain of hERG channel	687	508	125	0	X
16298	SH1003	687	511	116	0	X
16694	Human Polybromo/Histone 3 complex	687	379	113	0	X
6760	FRB domain	687	347	117	0	X
11182	Regulating synaptic membrane exocytosis protein 1	687	512	117	0	X
6615	BsLonSSD monomer	687	516	120	0	X
4435	CYTOCHROME C3	687	0	0	0	X
18615	Par17	687	662	153	0	X
19172	PTPN11 C-SH2 free	687	507	120	0	X
5122	cyclic N-terminal domain of DnaB helicase	687	0	122	0	X
17081	Prion with Y169G mutation	687	480	135	0	X
17741	ETV6 Q436	686	497	112	0	X
16353	Proto-oncogene tyrosine-protein kinase FER	686	500	115	0	X
34261	Lipopolysaccharide export system protein LptA, Thanatin	686	502	123	0	X
19904	PPIase domain of TbPar42	686	473	122	0	X
7160	metLYZ	686	0	0	0	X
19715	Receiver domain of ethylene receptor ETR1	686	539	136	0	X
10279	Docking protein 2	686	512	118	0	X
11235	Myosin-binding protein C, fast-type	686	515	114	0	X
5679	xylan-binding domain	686	515	151	0	X
16181	EHD1 with FNYESTGPFTAK	685	365	91	0	X
10278	Pleckstrin homology domain-containing protein family B member 1	685	518	129	0	X
16611	SUMO-1 Daxx SIM complex	685	493	120	0	X
4304	neuronal nitric oxide synthase PDZ domain complexed with a peptide	685	372	121	0	X
17656	P1_endolysin_Lyz	685	632	183	0	X
4563	Bovine prion protein fragment 121-230	685	356	129	0	X
17754	MucBP	685	513	127	0	X
7079	RP2812	685	497	124	0	X
16019	TM1081	685	403	118	0	X
6318	Thioredoxin h1	685	512	121	0	X
15452	profilin II	684	532	140	0	X
10253	Protein kinase C, D2 type	684	498	120	0	X
5989	Cytotoxin I	684	0	0	0	X
16249	NR3 dimer	684	517	148	0	X
434	interleukin 1-beta	684	0	144	0	X
6285	talin 755-889	684	520	141	0	X
15009	Spo0FI90A	684	523	127	0	X
16496	integrin alphaIIb beta3 transmembrane-cytoplasmic heterocomplex	684	528	140	0	X
16958	ZCCHC9 in complex with Zn	683	415	152	0	X
6738	Selenoprotein Sep15	683	496	122	0	X
27857	RbfA	683	522	114	0	X
16476	ATC0905	683	514	122	0	X
17109	Family D Sortase	683	528	128	0	X
19621	CNBHD	683	554	137	0	X
16807	DhR1A	683	372	134	0	X
15402	ccbp	683	538	132	0	X
17429	CpcC	683	522	113	0	X
34429	RNA-binding protein 20	683	518	119	0	X
18713	sC4	683	487	116	0	X
6094	Psi site of MLV	683	578	35	0			X
6093	CD44 antigen	683	435	164	0	X
25533	Ca-bound hN-1 8-11	682	524	161	0	X
5657	Methanobacterium thermoautotrophicum	682	390	119	0	X
6759	NEAT domain	682	565	123	0	X
18825	C-terminal CFTR peptide and extended PDZ1 domain from NHERF1	682	481	116	0	X
11187	InaD-like protein	682	499	121	0	X
34184	Transcription elongation factor SPT5	682	522	126	0	X
6794	LM_ICP	682	519	117	0	X
16711	NP_415897.1	682	387	131	0	X
18098	YT682A	682	488	111	0	X
16870	Human Tubulin Cofactor C	681	370	108	0	X
4894	MATERNAL EFFECT PROTEIN (STAUFEN)/RNA COMPLEX	681	345	93	4	X		X
11145	EHBP1 protein	681	520	114	0	X
27690	FKBP12 from M. tuberculosis monomer	681	517	133	0	X
6997	vSET complex with meK27 H3 Pept and cofactor product SAH	681	364	110	0	X
10128	second FNIII domain of DSCAML1 protein	681	503	130	0	X
10114	SET binding factor 1	681	520	118	0	X
11148	Nuclear factor of activated T-cells, cytoplasmic 4	681	509	119	0	X
17077	SynArsC	681	506	123	0	X
15681	PN2-3 module	681	483	109	0	X
6225	Tfb1	681	497	124	0	X
15810	PA1076	681	500	102	0	X
17750	N-terminal domain of E3 ligase HECW2	680	508	119	0	X
16179	EHD1 with FNYESTNPFTAK	680	365	91	0	X
11366	spliceosomal protein complex p14-SF3b155	680	516	112	0	X
6837	L27 Heterodimer From Lin-7 and Lin-2 Scaffold Proteins	680	493	145	0	X
16175	CquiOBP1	680	496	120	0	X
18447	yeast Tah1 in complex with the Hsp90 C-terminal tail	680	346	119	0	X
16183	Tammar Wallaby Prion Protein (121-230)	680	473	132	0	X
17490	C-terminal domain of Prp24	679	492	121	0	X
16251	syr103b_protein	679	480	118	0	X
19206	PcCBM36 monomer	679	544	131	0	X
18824	extended PDZ1 domain from NHERF1	679	479	119	0	X
11104	Protein disulfide-isomerase A4	679	518	112	0	X
17019	DAXX / Rassf1C complex	678	387	115	0	X
17087	Prion with Y169A, Y225A, Y226A mutation	678	363	135	0	X
11143	Protein MICAL-3	678	509	119	0	X
18465	OR157	678	483	105	0	X
17767	cl-BABP/SS complex	677	548	129	0	X
15926	DnaI N-domain	677	0	114	0	X
25969	minor DNA-uptake pilin ComP	677	513	115	0	X
10030	T-plastin	677	520	127	0	X
16016	TM0212	677	393	128	0	X
19214	Green Light-Absorbing State of TePixJ, an Active Cyanobacteriochrome Domain	676	547	145	0	X
25908	oxidized human cytochrome c	676	465	105	0	X
5224	C-terminal domain of human lamin A/C	676	492	127	0	X
25770	N_Est2	676	521	138	0	X
5599	Human Prolactin	676	668	170	0	X
11495	Microtubule-binding domain	676	419	127	0	X
15616	F1	676	517	132	0	X
18987	SACOL0876	676	487	109	0	X
6590	srx monomer	676	401	118	0	X
7303	NIX	675	512	129	0	X
17943	CGC-19	675	540	135	0	X
5310	phospholipase C gamma-1 C-terminal SH2 domain	675	460	133	0	X
11088	Dynamin-2	675	494	113	0	X
34007	Zinc finger HIT domain-containing protein 3, Nuclear fragile X mental retardation-interacting protein 1	675	488	125	0	X
18253	P1 endolysin Lyz	675	608	176	0	X
15429	LFABP-apo	675	566	123	0	X
5538	PWWP domain	675	364	104	0	X
5677	focal adhesion targeting domain of focal adhesion kinase	675	560	143	0	X
19173	PTPN11 C-SH2 bound	675	504	120	0	X
18473	L-PGDS/U-46619 complex	675	432	143	0	X
16426	murine Ets-1	675	503	119	0	X
27034	RCD1	675	500	123	0	X
10316	TBC1 domain family member 2	675	508	110	0	X
26047	Lysine dimethylated FKBP12	675	494	109	0	X
16126	HypA	675	498	126	0	X
16113	yppe	674	388	101	0	X
7220	ephrinB2 ectodomain monomer	674	561	154	0	X
7287	BRD7 Bromodomain	674	440	116	0	X
25251	PrPdelta193-196	674	138	146	0	X
17428	AIDA1 PTB domain	674	568	134	0	X
5315	Protein Yfia	674	499	120	0	X
5061	DNA-binding domain of ADR6	674	463	118	0	X
17005	trPRAI	674	503	137	0	X
10104	polynucleotide kinase 3'-phosphatase	674	502	122	0	X
6346	h. plexin-B1 RBD-W1830F	674	517	123	0	X
30185	PS1	674	361	108	0	X
6378	canine prion protein	674	359	122	0	X
16665	AeSCP-2-PA	674	376	112	0	X
36084	TRADD DD	674	384	126	0	X
7227	Hypothetical protein yppE	674	387	101	0	X
27754	CdiA-CT C21S C27S	674	424	138	0	X
6928	PCV2	674	498	125	0	X
27393	CRBD_LEPS	673	552	127	0	X
10129	sidekick 2 protein	673	514	115	0	X
26778	CheY3_noBeF3_pH4.5	673	511	126	0	X
4712	newt acidic FGF	673	530	132	0	X
17636	Grx domain	673	472	125	0	X
34057	CUGBP Elav-like family member 2/RNA Complex	673	335	114	0	X		X
19688	Tah1Pih1	673	490	105	0	X
16373	SPA4288	673	379	118	0	X
11127	biregional cell adhesion molecule-related/down-regulated oncogenes (Cdon)binding protein	673	506	107	0	X
26570	SOD1 monomer	673	546	136	0	X
17073	CBP in complex with p53 TAD	673	460	115	0	X
15661	hp1203	673	479	119	0	X
17374	ADF/Cofilin from Trypanosoma brucei	672	527	130	0	X
16306	Truncated hemoglobin	672	492	138	0	X
5378	Human prion protein fragment 121-230 with mutations Met166Cys and Glu221Cys	672	321	130	0	X
6944	eIF5(1-170)	672	567	148	0	X
30023	Sensory transduction regulatory protein	672	502	123	0	X
17934	AIDA1 PTB domain	672	561	134	0	X
11114	Protein disulfide-isomerase	672	519	109	0	X
7275	HIV-1 unmyristoylated Matrix bound to di-C4-PI(4,5)P2	672	446	131	0	X
11255	Nuclear receptor coactivator 5	672	499	117	0	X
18534	Ribonuclease III in complex with RNA (32-MER)	672	487	90	0	X		X
4527	NITROGEN REGULATION PROTEIN	671	391	112	0	X
18210	Conotoxin analogue [D-Ala2]BuIIIB	671	573	96	0	X
6946	g2 free	671	597	133	0	X
17918	TbPIN1	671	449	122	0	X
6410	grx1	671	514	127	0	X
6126	CG5884-PA	671	531	127	0	X
30209	Preproalbumin PawS1	671	482	109	0	X
50074	pheromone binding protein 2 [Ostrinia furnacalis]	671	527	137	0	X
6448	Hypothetical UPF0131 protein ytfP	671	508	127	0	X
10102	KIAA1568 protein	671	499	126	0	X
10265	Protein tyrosine phosphatase, receptor type, F	671	511	122	0	X
5068	hen egg white lysozyme	670	0	0	0	X
30098	Helicase-like transcription factor (E.C.3.6.4.-,6.3.2.-)	670	487	129	0	X
5814	C terminal domain of human VIAF	670	584	130	0	X
10311	Pleckstrin homology domain-containing protein family A member 6	670	502	116	0	X
18319	Y4_TM1-TM2	669	479	120	0	X
16648	UuR17A	669	508	120	0	X
7381	Alr1010_protein	669	532	127	0	X
15401	ccbp	669	532	127	0	X
7271	AF2241	669	501	122	0	X
18569	EVH1	669	371	137	0	X
16089	sso0164	669	478	112	0	X
25175	NisI	669	493	117	0	X
4078	App-D49 PLA2	669	462	129	0	X
6950	domain 3 of RAP	669	487	119	0	X
7014	nsp1	669	503	116	0	X
6607	Jumonji	668	495	120	0	X
25081	Fyn SH2 bound	668	497	115	0	X
4942	Recombinant RC-RNase L1	668	491	116	0	X
11107	Thioredoxin domain-containing protein 5	668	514	115	0	X
5821	RPA70(181-291) ssDNA binding domain	668	498	116	0	X
18487	YR313A	668	386	119	0	X
4620	prion protein	668	355	125	0	X
16502	aFGF-NTS	668	0	0	0	X
6875	acidic fibroblast growht factor	668	235	125	0	X
25172	Ca-bound hN-1 4-7	668	489	146	0	X
10006	FN3 domain of HYPOTHETICAL PROTEIN	668	508	103	0	X
30308	Troponin C, slow skeletal and cardiac muscles, Troponin I, cardiac muscle	668	505	111	0	X
4736	human prion protein variant M166V	668	355	126	0	X
10320	Filamin-B	668	520	107	0	X
25294	NP_809137.1 monomer	668	384	124	0	X
4880	calponin CH domain	667	497	119	0	X
16018	HtA	667	0	0	0	X
16614	a single polypeptide chain	667	457	126	0	X
4150	third extracellular N-terminal domain of gp130	667	392	107	0	X
16030	BPP2914	667	376	125	0	X
15334	NtrC4 Receiver domain dimer	667	384	115	0	X
15627	nDsbD	667	529	115	0	X
4379	human prion protein fragment 121-230	667	354	126	0	X
18197	angiogenin monomer	667	482	123	0	X
30025	SdrG	667	499	121	0	X
5625	cytochrome c3	666	0	0	0	X
18435	C-terminal domain of Tetrahymena telomerase protein p65	666	532	121	0	X
5998	ApaG/CorD protein	666	523	111	0	X
11111	Neogenin	666	514	112	0	X
34291	functional pRN1 primase/DNA Complex	665	303	104	0	X	X
5306	hypoxia inducible factor-1alpha/p300 complex	665	557	146	0	X
435	interleukin 1-beta	665	0	144	0	X
16536	Wilson Disease Associated Protein	665	523	141	0	X
34257	Hydrogenase maturation factor HypA	665	516	114	0	X
6475	Man5C CBM35 Mannan Binding Module	665	524	133	0	X
25945	Toca1	665	458	109	0	X
15139	NirD	665	491	119	0	X
11320	sh3 domain-binding glutamic acid-rich-like protein 2	665	484	110	0	X
19627	hypothetical protein BACUNI_03114 from Bacteroides uniformis ATCC 8492	665	380	113	0	X
25436	hnRNP C RRM in complex with the 5'-AUUUUUC-3' RNA	664	464	117	0	X		X
6692	AppA	664	349	128	0	X
30529	Troponin C, slow skeletal and cardiac muscles,Troponin I, cardiac muscle	664	391	114	0	X
15854	bile acid-based Gd(III)-chelate and bile acid protein complex	664	531	124	0	X
17965	NsR264	664	500	119	0	X
15644	Rds3	664	479	109	0	X
4302	protein disulfide isomerase a' domain	664	519	114	0	X
16389	NP_247299.1	663	367	113	0	X
5713	human prion protein	663	351	126	0	X
5389	Yfia	663	490	117	0	X
6508	Histone acetylatransferase PCAF (E.C.2.3.1.48)	663	408	107	0	X
10041	MYST histone acetyltransferase 1	663	506	116	0	X
25039	Second RNA Recognition Motif Domain of hnRNP L	662	366	129	0	X
18466	Wild-type FAS1-4	662	498	129	0	X
4186	CRABPII system	662	331	118	0	X
18485	Tb 1-C-Grx1 monomer	662	496	103	0	X
11190	InaD-like protein	662	509	123	0	X
6834	Huntingtin interacting protein B isoform 1	662	381	110	0	X
6176	Ubiquitin-like domain of tubulin-folding cofactor B	662	502	124	0	X
15642	NusG	662	498	122	0	X
17298	sso1118	662	510	113	0	X
4893	Recombinant RC-RNase 4	662	494	111	0	X
34256	Cell division coordinator CpoB	662	526	122	0	X
6873	C-PH domain	662	401	120	0	X
30421	Transcription antitermination protein NusB	661	543	147	0	X
25694	CXCL12-CXCR4	661	452	110	0	X
6331	SH2 domain	661	492	111	0	X
16563	Lin0431	661	474	117	0	X
11129	Rho guanine nucleotide exchange factor 6	661	509	117	0	X
11457	Solution structure of the second dsRBD	661	485	122	0	X
15116	HIV-1 V7R-myrMA	661	438	130	0	X
34185	Transcription elongation factor SPT5	661	516	124	0	X
4825	Recombinant RC-RNase 2	660	490	112	0	X
6058	Hypothetical Archaeglobus fulgidis protein AF2095	660	495	111	0	X
19530	BLM RQC	660	324	120	0	X
25067	NESG Target OR459	660	486	104	0	X
26776	CheY3_BeF3_pH7.25	660	509	117	0	X
6780	hi1506	660	520	129	0	X
6244	Mycoplasma Genitalium gi3844938	660	557	132	0	X
18908	Human programmed cell death 1 receptor	660	453	119	0	X
18990	protein	660	540	134	0	X
6943	chemosensory protein 1	660	477	114	0	X
7201	YqbF	659	477	121	0	X
17320	YP_926445.1	659	385	119	0	X
4964	barnase	659	496	118	0	X
18053	hs499	659	485	130	0	X
25453	Human galectin-8	659	537	129	0	X
4224	Myotrophin	659	385	119	0	X
5269	trHb	659	494	130	0	X
27683	MaSp1 L6-NTD	659	513	126	0	X
6540	Werner syndrome protein	658	604	149	0	X
5804	hen egg white lysozyme	658	0	0	0	X
17265	Fusion protein	658	429	128	0	X
11133	L-plastin	658	497	117	0	X
4380	Epithelial Cadherin	658	444	133	0	X
5406	cytochrome c	658	219	103	0	X
18364	GS13500A_assembly	658	392	130	0	X
4472	BeFx-activated CheY from E. coli	658	405	123	0	X
17029	Formin C potential GTPase binding domain	658	482	111	0	X
15881	PSA	658	470	138	0	X
5899	Sporulation initiation phosphotransferase F	658	413	131	0	X
16883	H-REV107N	658	518	116	0	X
30288	Troponin C, slow skeletal and cardiac muscles,Troponin I, cardiac muscle	658	503	114	0	X
17257	VirB7-Xac2622 monomer	658	518	122	0	X
6377	fPrP monomer	658	342	126	0	X
15281	CcR55	657	510	122	0	X
16662	AeSCP-2	657	375	113	0	X
27624	sigma4-Sc monomer	657	380	123	0	X
5297	N-terminal DNA-binding domain of Rep protein from a geminivirus	657	518	132	0	X
7002	Ede1 UBA-ubiquitin complex	657	500	124	0	X
25757	calmodulin-connexin36	657	596	152	0	X
25253	Y99E,N111D CAM-iNOS	656	0	144	0	X
10280	Oxysterol binding protein-related protein 11	656	497	123	0	X
5354	Human PAS Kinase PAS-A domain	656	502	120	0	X
6043	Pseudoazurin	656	497	124	0	X
16491	peptidyl-prolyl cis-trans isomerase/Cycloheximide-N-ethylethanoate complex	656	325	116	0	X
5220	Melanoma Inhibitory Activity Protein	656	386	115	0	X
15570	PAH1-Sap25	655	548	127	0	X
6507	Histone acetylatransferase PCAF	655	404	107	0	X
4915	Polyadenylate-binding protein 1	655	504	126	0	X
16472	TENC1	655	337	103	0	X
18467	FAS1-4_R555W	655	514	132	0	X
10099	KIAA1568 Protein	655	464	120	0	X
27705	GCAP5	654	579	160	0	X
6984	R1a CBD-A	654	476	130	0	X
5524	Toxin A C-terminal fragment	654	484	131	0	X
7396	ETO	654	388	111	0	X
4113	Vaccinia Glutaredoxin-1	654	491	115	0	X
5471	Malate Synthase G	654	2046	654	0	X
30020	beta-galactosidase 1	653	444	114	0	X
34452	cU3Sd	653	477	109	0	X
17632	Syk/Vav complex	653	355	95	0	X
11408	CUG-BP- and ETR-3-like factor 1/RNA Complex	653	463	118	0	X		X
6763	middle domain of human eRF1	653	459	136	0	X
1663	glucose permease	652	0	149	0	X
16283	VpR247	652	485	104	0	X
16517	BR7	652	519	118	0	X
25689	TolAIII	652	477	123	0	X
25987	transthyretin	652	381	114	0	X
15829	SaR32	652	502	117	0	X
6766	pa0128	652	488	120	0	X
15928	ARNT_PAS-B_Slipped_IB_Strand	652	492	122	0	X
16272	VpR247	652	486	104	0	X
18093	transmembrane domains of the a4b2 nAChR	651	567	127	0	X
15702	BP2786	651	532	132	0	X
11304	Neural cell adhesion molecule 2	651	487	114	0	X
25469	hnRNP C RRM in complex with 5'-UUUUC-3' RNA	651	428	117	0	X		X
17989	UUP protein C-terminal domain	651	478	113	0	X
25166	ectodomain of the B. subtilis RodZ	651	480	110	0	X
16236	Bruno_RRM3+	650	432	117	0	X
17290	hNLG3cyt	650	517	110	0	X
30128	De novo Beta Sheet Design Protein OR664	650	384	121	0	X
11112	Neogenin	650	511	115	0	X
17799	YP_001302112.1	650	488	124	0	X
5004	human interleukin-13	649	504	108	0	X
11065	4.1R FERM alpha-lobe domain	649	489	109	0	X
25660	Y48pCMF variant of human cytochrome c in its reduced state	649	423	95	0	X
4871	Bin1	649	581	161	0	X
10327	Tripartite motif protein 45	649	488	113	0	X
16691	SgR46	649	373	117	0	X
16379	human interleukin 1alpha	649	493	129	0	X
15944	Taz2-p53 TAD1	649	506	111	0	X
15010	Spo0FL66A monomer	649	476	124	0	X
4205	Ets-1 Pointed	649	485	116	0	X
11183	RIM binding protein 2	649	509	110	0	X
25828	RIP2 CARD	648	372	122	0	X
11098	Netrin receptor DCC	648	501	109	0	X
16997	SF1141	648	484	115	0	X
5838	S100B-NDR kinase peptide complex	648	380	92	0	X
17959	human HOIL-1L	648	513	121	0	X
6279	murine angiogenin 4	648	466	124	0	X
11197	InaD-like protein	648	481	111	0	X
16277	ATP7A	648	494	122	0	X
6406	TCR Va2.6Ja38	648	489	120	0	X
26993	NavII	648	489	146	0	X
16889	HIV-2 myrMA bound to di-C4-PI(4,5)P2	647	402	128	0	X
36005	Calmodulin	647	361	139	0	X
10267	PDZ domain-containing protein 1	647	481	120	0	X
6604	v-Src-SH2 complexed with PQpYEEIPI	647	481	120	0	X
34233	Histone acetyltransferase p300,Tumor protein p73 (E.C.2.3.1.48,2.3.1.-)	647	402	129	0	X
7020	RNA Polymerase II subunit	647	514	132	0	X
25638	C-terminal domain of the chromodomain helicase DNA-binding protein 1	647	467	111	0	X
11471	FKBP12-mTOR FRB domain-rapamycin complex structure	647	535	190	0	X
11575	PDZ domain	647	516	121	0	X
11405	CUG-BP- and ETR-3-like factor 1	647	474	114	0	X
6368	Hypothetical protein rps24e	647	364	113	0	X
18895	N-terminal MAP1B LC	647	489	124	0	X
6964	Rpa2829	647	540	133	0	X
19751	ORF2	646	416	119	0	X
26534	FtsXECL1 monomer	646	540	122	0	X
15791	SoR190	646	471	124	0	X
18081	apoCuA_polypeptide	646	477	117	0	X
27725	SurA_P2	646	495	116	0	X
15089	StR65	646	483	108	0	X
10300	Proto-oncogene tyrosine-protein kinase MER precursor	645	493	118	0	X
16945	chicken parvalbumin 3	645	431	120	0	X
18152	BA_SrtD	645	525	121	0	X
6376	TgMIC1-CT	645	550	131	0	X
10313	130-kDa phosphatidylinositol 4,5-biphosphate-dependent ARF1 GTPase-activating protein	645	477	111	0	X
19607	C-terminal domain of SRA1p	645	536	130	0	X
4492	guanylate cyclase activating protein 2	645	558	185	0	X
15848	YhhK_CoA	645	388	130	0	X
5779	HYPOTHETICAL PROTEIN HI1450	645	431	110	0	X
28037	FKBP12	645	496	111	0	X
6930	SNF RBD1	644	457	106	0	X
5373	IL5 dimer	644	450	115	0	X
6705	beta-parvalbumin	644	524	121	0	X
11288	Fibronectin type-III domain containing protein 3a	644	472	115	0	X
11499	WWE	644	467	112	0	X
5303	nitrogen regulation protein NR(I)	644	371	117	0	X
26769	CheY3_noBeF3_pH7.4	644	494	112	0	X
7250	HIV-1 unmyristoylated Matrix	644	429	131	0	X
10111	Nucleolar transcription factor 1	644	452	107	0	X
11248	LIM domain kinase 2	644	483	115	0	X
18445	yeast Tah1	644	327	0	0	X
25970	Acidic domain of SYNCRIP (24-140)	643	478	127	0	X
19967	CRRM domain	643	460	108	0	X
7247	di-Zn(II) DFsc	643	531	129	0	X
17515	INAD PDZ5 complexed with Kon-tiki peptide	643	335	109	0	X
4956	YajQ from E.coli	643	144	155	0	X
11128	biregional cell adhesion molecule-related/down-regulated oncogenes (Cdon)binding protein	642	490	113	0	X
16316	IntB phage-integrase-like protein	642	505	122	0	X
15846	Q812L6 PROTEIN	642	461	108	0	X
5100	Intramolecular complex of LMO2(LIM1) and ldb1(LID)	642	344	115	0	X
16955	calcium-bound CPV3	642	429	119	0	X
6177	Polypyrimidine tract-binding protein 1 domain 2	642	489	115	0	X
19851	Unknown protein YP_001712342.1 from Acinetobacter baumannii	642	362	115	0	X
5631	99-mer peptide of densin-180-like protein/phage-derived peptide	642	441	107	0	X
16796	Cdt1 binding domain(CBD) in complex with the MCM6 binding domain (MBD)	642	364	126	0	X
30398	RNA-binding protein Musashi homolog 2	642	477	107	0	X
7019	nsp3a	641	496	117	0	X
18758	First Catalytic Cysteine Half-domain	641	469	110	0	X
11563	The first RNA recognition motif domain	641	493	103	0	X
16594	atc0888	641	457	110	0	X
36181	Maltose-binding periplasmic protein,Trigger factor (E.C.5.2.1.8)	641	391	119	0	X
16365	YOR252W	641	514	133	0	X
16712	desulfothioredoxin	641	481	114	0	X
10321	Filamin-B	640	507	109	0	X
16713	desulfothioredoxin	640	489	114	0	X
16385	PF1109	640	498	114	0	X
16653	HtrA_PDZ	640	376	119	0	X
16439	factor H (modules 10-15)	640	508	127	0	X
4431	methane monooxygenase regulatory protein B	640	241	151	0	X
6518	DsrC	640	484	113	0	X
34013	BolA-like protein 1	640	465	126	0	X
26659	src	640	441	132	0	X
34120	Ribosome hibernation promotion factor	640	516	120	0	X
15864	pdcd5	639	477	114	0	X
34262	Calmodulin-1	639	602	151	0	X
19109	EH domain of EHD3 in presence of Ca2+	639	462	101	0	X
25195	putative arsenate reductase from Brucella melitensis	639	524	115	0	X
18244	complex of the central activation doamin of Gcn4 bound to the mediator co-activator domain 1 of Gal11/med15	639	487	102	0	X
19014	putative Ras interaction domain of AFD-1, isoform a from Caenorhabditis elegans	639	478	108	0	X
11573	BMX SH2 domain	639	468	116	0	X
17448	protein YP_546394.1	639	471	117	0	X
6150	fatty acid binding protein	639	525	135	0	X
6514	PA4608	639	486	108	0	X
17151	FKBP in complex with 1-{[(4-methylphenyl)thio]acetyl}piperidine	639	363	116	0	X
17368	MS2	639	480	113	0	X
17702	protein complex for DNA replication	639	363	125	0	X
5824	KaiA C-terminal domain	639	392	99	0	X
18260	R17	638	483	122	0	X
6949	d2 of RAP	638	488	110	0	X
25018	OR414	638	475	107	0	X
18566	TL-domain	638	511	119	0	X
6985	Hexim1 TBD dimer	638	447	112	0	X
5121	N-terminal domain of DnaB helicase	638	0	0	0	X
16478	UBA	638	445	109	0	X
6860	BC022030	638	482	124	0	X
15172	H6TA0095	637	201	109	0	X
6090	methionine sulfoxide reductase A	637	651	184	0	X
4438	Sterol carrier protein 2See	637	301	124	0	X
11491	the mitochondrial disease-related protein C12orf65	637	469	103	0	X
11181	KIAA1496 protein	637	473	112	0	X
19392	CARMA1/Bcl10/MALT1 Signalosome: Nucleation Induced Filamentous Assembly	637	466	116	0	X
26963	PA-ICP	637	380	105	0	X
16347	ATC0852	636	465	119	0	X
5026	CYTOCHROME C complexed with HEME C	636	0	0	0	X
17999	ATS	636	935	312	0	X
5506	double module	636	348	107	0	X
5843	expressed protein: At3g17210.1	636	493	111	0	X
4881	Azotobacter vinelandii C69A holoflavodoxin II	636	517	186	0	X
16129	CIP4	636	449	110	0	X
18095	FR824D	636	464	112	0	X
4100	Mrf-2	636	349	108	0	X
5787	RC-RNase 3	636	484	108	0	X
18823	PpdD	635	460	124	0	X
25984	palmitated SCP2L2	635	354	110	0	X
4156	Protein Disulfide Isomerase	635	469	116	0	X
25473	Pcf11	635	454	107	0	X
15114	HIV-1 L8A-myrMA	635	431	129	0	X
19526	SLED domain of Scml2	635	468	115	0	X
5874	p47 monomer	635	282	140	0	X
4429	ribosomal protein L7 from E. coli	635	0	120	0	X
15288	YobA 21-120	635	456	117	0	X
16790	CV0863	635	479	109	0	X
915	T4 lysozyme	635	0	166	0	X
17404	PTH-HA20 solution	635	541	183	0	X
6443	At5g01610	634	461	115	0	X
6248	MDM2	634	373	114	0	X
15154	protein-peptide complex	634	432	105	0	X
6606	RPA70A from S.cervisiae	634	317	115	0	X
10121	immature colon carcinoma transcript 1	634	455	117	0	X
10039	FYVE, RhoGEF and PH domain containing 6; ethanol decreased 4	634	489	112	0	X
17369	MS2	634	472	112	0	X
6095	CBP KIX domain and c-Myb	634	392	118	0	X
26026	PriC DNA replication restart protein	634	568	134	0	X
18717	Ska1-MTBD	634	536	118	0	X
5618	Diisopropylfluorophosphatase	634	1230	332	0	X
18111	T7 transcription factor Gp2-E. coli RNAp jaw domain complex	634	499	113	0	X
5159	Ran-binding domain 2 of RanBP2	633	452	133	0	X
11060	PH0470	633	395	115	0	X
19653	RRM domain from C. elegans SUP-12 + GGTGTGC DNA	633	420	99	0	X	X
6724	Der f 13	633	397	130	0	X
6415	hen egg white lysozyme	632	0	0	0	X
7302	SNX1-PX	632	551	123	0	X
27498	C-terminal domain of the P protein of the Nishigahara strain of rabies virus	632	477	121	0	X
19474	uninhibited ETV6 ETS domain	632	349	101	0	X
27458	MarH dimer	632	489	116	0	X
36086	Parvalbumin beta	632	458	113	0	X
10270	Contactin-1	631	488	119	0	X
5235	Human Lupus autoantigen protein	631	453	111	0	X
16032	NaV1.2 C-terminal EF-hand domain	631	344	101	0	X
15808	alpha-Actinin4 CH2 domain	631	443	114	0	X
16154	MM0293	631	464	119	0	X
16977	nsp7a	631	506	127	0	X
18404	Target Recognition Domain of Zoocin A	631	501	141	0	X
17905	GED_rrACBcs	631	490	111	0	X
15819	TR91A	631	475	103	0	X
4297	DnaB helicase N-terminal domain	631	453	112	0	X
16051	MM0293	631	463	119	0	X
11119	Neogenin	630	486	114	0	X
30313	IgA FC receptor	630	436	123	0	X
4161	IRF-2 DNA binding domain	630	432	118	0	X
11376	Tia1 protein	630	480	109	0	X
16040	onconase C87A/C104A	630	0	109	0	X
18552	TM4-Cx43CT monomer	630	413	132	0	X
15826	YFP Venus	630	663	199	0	X
16923	Smurf2 WW2 and WW3 bound to Smad7 PY	630	369	128	0	X
18096	nAChR	630	552	127	0	X
34173	RuvB-like protein 2 (E.C.3.6.4.12)	629	459	109	0	X
16147	Trx	629	423	101	0	X
18698	HR8614A	629	466	113	0	X
6282	turtle PrP monomer	629	302	113	0	X
5624	translation initiation factor IF2	629	374	107	0	X
16216	ITSN1	629	360	103	0	X
17911	Mpro-C	629	360	129	0	X
15813	E. coli Trigger Factor (TF) Ribosome Binding Domain (RBD)	629	469	115	0	X
18002	Kindlin-2	629	377	129	0	X
16082	FAPP1-PH	628	465	117	0	X
11264	Afadin	628	470	100	0	X
16498	CLOLEP_01837	628	475	113	0	X
6353	RFC p140 375-480 BRCT region : DNA complex	628	321	113	0	X	X
6874	CBP-SID domain in complex with SRC1-AD1 domain	628	352	108	0	X
15208	Churchill	628	454	113	0	X
27234	CAMSAP3 CKK domain	628	520	124	0	X
26903	P_delta[122-160]	627	592	193	0	X
19240	FKBP12	627	479	105	0	X
16396	CBD	627	414	109	0	X
5598	receptor associated protein-domain 1	627	460	102	0	X
11472	WWE domain in RNF146 with ATP	627	452	105	0	X
10255	ARAP2 protein	627	465	101	0	X
5461	Interleukin-2 tyrosine kinase src homology 2 domain	627	368	117	0	X
25484	p300 Taz2-p53 TAD2 Complex	627	442	99	0	X
17575	C domain of Rv0899	627	350	129	0	X
7309	HIV-1 myristoylated Matrix protein	627	432	129	0	X
17286	hRpn13	627	536	130	0	X
18161	OR134	626	458	108	0	X
6635	RA2	626	433	96	0	X
5094	chemosensory protein	626	0	116	0	X
4077	FK 506 Binding Protein bound to Ascomycin	626	470	98	0	X
15034	YFED3 monomer	626	462	111	0	X
18561	OR250	626	455	109	0	X
19380	RNAP_alpha_subunit_CTD	626	340	112	0	X
11091	HYDIN protein	626	484	107	0	X
17420	Chr148	626	548	140	0	X
11152	Integrin beta-4	626	471	113	0	X
15553	Gal_lectin	626	463	112	0	X
7322	apo-oncomodulin	626	445	118	0	X
25395	internal EH domain of gamma-synergin	626	382	86	0	X
11030	Siz1 1-105	626	467	122	0	X
19241	FKBP12	626	479	105	0	X
18495	Th205-316 dimer	626	1	0	0	X
4138	Rana catesbeiana RNase	625	0	0	0	X
18624	N-terminal domain of a plant Grx	625	483	111	0	X
26818	CHIP-TPR	625	479	124	0	X
6972	PDI-a'	625	422	115	0	X
26760	apo-EhCaBP6	625	345	123	0	X
16443	cytochrome c3	625	0	0	0	X
16161	BfR257C	625	329	108	0	X
17830	nDsbD-red	625	489	122	0	X
18578	Connexin45 Carboxyl Terminal Domain	625	505	123	0	X
7209	PilP	625	436	116	0	X
11258	RIKEN cDNA 2900073H19 protein	625	472	110	0	X
6133	YojN-HPt	624	524	121	0	X
15677	water-soluble analogue of KcsA	624	411	113	0	X
5758	YqgF	624	470	122	0	X
28038	FKBP12	624	491	107	0	X
15266	Connexin40 Carboxyl Terminal Domain	624	418	98	0	X
17211	Ste2p TM1-TM3 (G31-R161)	624	542	128	0	X
30201	Nucleoporin POM152	624	471	106	0	X
15782	DEN1ED3	624	442	102	0	X
26748	Met-1 Human Ang	624	469	112	0	X
11200	MAGUK p55 subfamily member 5	624	478	114	0	X
11270	FLJ35834 protein	624	494	104	0	X
26509	PHF6-ePHD1	624	464	127	0	X
25448	N-terminal domain of human TIG3	624	355	112	0	X
4719	Ras binding domain of rat AF6	624	483	124	0	X
30092	Two-component sensor histidine kinase	623	488	110	0	X
10075	sidekick 2	623	479	113	0	X
6541	Ca-bound calmodulin	623	591	158	0	X
5902	Hath domain of hepatoma-derived growth factor (hHDGF)	623	455	102	0	X
27518	Nb26	623	482	127	0	X
15437	S836 monomer	623	414	121	0	X
11306	Deltex protein 2	623	465	107	0	X
16250	human intersectin-1	623	352	112	0	X
19459	Recombinant CR1 fragment, domains 1-2	623	518	121	0	X
34172	ECF RNA polymerase sigma-E factor,ECF RNA polymerase sigma factor SigW,ECF RNA polymerase sigma-E factor/DNA Complex	623	405	102	0	X	X
4955	Cysteinyl-phosphorylated enzyme IIB	623	482	114	0	X
5606	HI0719 homotrimer	622	441	123	0	X
6866	Sorting nexin 22	622	462	112	0	X
5943	Fibroblast growth factor receptor	622	336	100	0	X
7147	Core-binding factor, ML1-ETO	622	326	96	0	X
16822	Bacillus anthracis dihydrofolate reductase	622	581	149	0	X
16888	HIV-2_myristoylated_matrix_protein	622	386	128	0	X
17405	IPSE/alpha-1	622	475	102	0	X
28052	MsrB	622	488	121	0	X
34127	MatB protein	622	349	124	0	X
18292	RBM39	622	476	120	0	X
19541	Structure of the Nucleoplasmin-like N-terminal domain of Drosophila FKBP39	621	290	104	0	X
6685	AlkB	621	618	167	0	X
17157	PARP-1 Finger 1	621	363	102	0	X
11097	Netrin receptor DCC	621	500	111	0	X
17299	thioredoxin	621	460	110	0	X
17165	WT	621	460	97	0	X
11215	T-cell lymphoma invasion and metastasis 1 variant	621	469	105	0	X
18877	CaBP4 polypeptide	621	542	159	0	X
16164	XcpT	621	387	116	0	X
16824	WASP/EspFU complex	620	444	111	0	X
5241	Thioredoxin	620	0	111	0	X
19353	AS69_ASyn	620	450	113	0	X
6725	Dengue envelope protein domain III	620	420	97	0	X
19056	IsdB N1	620	419	132	0	X
11599	eIF1	620	473	107	0	X
17007	Alpha-mannosidase_binding_domain_of_Atg34	620	455	106	0	X
17085	HLTF HIRAN domain	620	453	116	0	X
10094	Homeobox protein Cux-2	620	462	103	0	X
11232	Protein KIAA0319	620	475	107	0	X
12032	NS1 effector domain	620	482	120	0	X
6911	MAGI-1 PDZ1	619	369	104	0	X
6570	F-actin binding domain of human Bcr-Abl/c-Abl	619	499	137	0	X
10064	MEMBRANE ASSOCIATED GUANYLATE KINASE INVERTED-2 (MAGI-2)	619	467	109	0	X
4230	3-ketosteroid isomerase-19-nortestosterone-hemisuccinate	619	468	126	0	X
16846	Rv0899	619	511	118	0	X
10067	expressed protein	619	473	113	0	X
6315	TcUBP1	619	486	123	0	X
6442	PfTrx	619	409	108	0	X
17783	DamX SPOR domain	618	457	114	0	X
25326	carboxy-terminal domain of DNTTIP1	618	382	108	0	X
15193	MsrB1	618	436	113	0	X
5924	FAT domain of Focal adhesion kinase (920-1053)	618	358	129	0	X
16120	Atg8	618	475	106	0	X
25643	Amino-terminal domain of Latrodectus hesperus MaSp1 with neutralized acidic cluster	618	367	128	0	X
15913	IsdC	618	488	130	0	X
11198	synapse-associated protein 102	618	459	120	0	X
18431	mouse Rev1 C-terminal domain	618	363	100	0	X
4308	cytokine receptor common beta chain domain 4	618	0	111	0	X
26025	Q4DY78 monomer	618	451	106	0	X
10008	C-terminal FN3 domain of 1700129L13Rik protein	617	459	106	0	X
16413	C17orf37	617	457	115	0	X
19363	STIM1 CC1-CC2 homodimer in complex with two Orai1 C-terminal domains	617	425	105	0	X
5013	E6AP catalytic domain	617	492	118	0	X
27254	horse cytochrome c	617	453	99	0	X
25417	CadC1-159	617	482	156	0	X
16603	IscU	617	457	111	0	X
10046	Mitogen activated protein kinase kinase 5	617	473	108	0	X
27162	Spred1-EVH1	617	461	117	0	X
15200	ApoORP monomer	617	523	135	0	X
4189	cytochrome c	617	0	0	0	X
5228	ACTR in complex with the CREB binding protein, CBP	617	480	119	0	X
18837	VHH 18	617	422	124	0	X
18155	Neurolin Ig2	617	476	107	0	X
15057	Second bromodomain of Brd4 monomer	617	433	103	0	X
16467	AML1-ETO/HEB peptide complex	616	456	108	0	X
18876	Complex of MDM2(3-109) and p73 TAD(10-25)	616	384	111	0	X
15517	rat alpha-parvalbumin	616	436	108	0	X
17300	thioredoxin	616	473	110	0	X
17561	Unliganded Bovine Neurophysin	616	86	154	0	X
18901	C-terminal domain of the protein HCFC1	616	464	111	0	X
4255	Eukaryotic translation initiation factor 1	616	452	128	0	X
4249	Human NER factor XPA	616	500	120	0	X
15471	Peptidyl-tRNA hydrolase domain protein	616	446	116	0	X
25796	complex of PEP-19 bound to the C-domain of apo calmodulin	616	430	112	0	X
5687	protein S-824	616	414	119	0	X
6380	pig prion protein monomer	616	307	123	0	X
4140	EH1 domain of mouse Eps15	616	501	124	0	X
4491	Eps15	616	501	124	0	X
11208	Ephrin type-A receptor 8	616	454	108	0	X
17245	CCL21_SLC_6Ckine_Exodus-2	616	441	99	0	X
4446	thioredoxin	615	0	0	0	X
34235	Protein TonB	615	438	102	0	X
4295	Titin type I domain	615	0	101	0	X
16297	AIDA-1 SAM domain tandem	615	501	121	0	X
30456	Trigger factor (E.C.5.2.1.8)	615	280	331	0	X
30500	Unconventional myosin-VI, Clathrin light chain A	615	431	107	0	X
30205	HMWP2 nonribosomal peptide synthetase	615	466	105	0	X
25492	HIRAN	615	466	116	0	X
4878	Calreticulin P-domain	615	328	95	0	X
4288	mEps15-EH2	614	447	98	0	X
15735	AcrA	614	332	117	0	X
30397	Capsid protein	614	459	98	0	X
25130	LEDGF/p75 IBD in complex with MLL1 peptide (140-160)	614	372	89	0	X
11277	Rap guanine nucleotide exchange factor (GEF)-like 1	614	487	108	0	X
5126	Ciliary Neurotrophic Factor Receptor	614	451	122	0	X
18016	SSGCID	614	453	108	0	X
17105	NP_954075.1	614	353	113	0	X
11204	Harmonin	614	463	107	0	X
16979	ec0544	614	452	115	0	X
4980	bovine seminal ribonuclease monomer (N67D mutant)	614	0	129	0	X
19077	USP28 monomer	614	487	111	0	X
11191	InaD-like protein	614	458	106	0	X
25850	DA05	613	440	104	0	X
6927	spinophlin PDZ domain	613	447	110	0	X
4421	PhoB DNA-binding domain	613	316	103	0	X
16255	Nmul_A0922	613	353	107	0	X
6012	Sgt1 CS domain	613	497	115	0	X
16576	Protein BH0266 From Bacillus halodurans	613	358	113	0	X
17598	Solution Structure of PilP from Pseudomonas aeruginosa	613	367	107	0	X
15276	6aJL2	613	464	119	0	X
25041	First RNA Recognition Motif Domain of hnRNP L bound to CACACA RNA	613	363	102	0	X		X
11237	Myeloid/lymphoid or mixed-lineage leukemia protein 3 homolog	613	454	113	0	X
3078	microglobulin	612	0	0	0	X
11092	Mortality factor 4-like protein 1	612	439	98	0	X
25263	CUS-3id	612	461	119	0	X
10162	Filamin-B	612	453	100	0	X
36008	Small ubiquitin-related modifier 1	611	426	103	0	X
25927	Curli secretion specificity factor CsgE W48A/F79A mutant	611	470	116	0	X
10143	Filamin-B	611	477	106	0	X
17588	AVR3a4	611	458	110	0	X
17242	Thioredoxin C	611	351	104	0	X
27435	Decorator monomer	611	460	141	0	X
18429	OR188	611	435	95	0	X
15512	Palladin Ig3 domain	611	455	112	0	X
17170	tvMyb2_MRE-1	611	476	112	0	X
5104	MTH0637	611	418	103	0	X
36000	Small ubiquitin-related modifier 1	611	426	102	0	X
19991	iron-sulphur cluster	610	486	110	0	X
16357	TR5	610	434	100	0	X
30010	Myc box-dependent-interacting protein 1, CHIKV nsP3 peptide	610	334	105	0	X
6629	Outer membrane usher protein FimD	610	360	119	0	X
4834	S. aureus peptide deformylase	610	509	166	0	X
6211	Carnobacteriocin B2 immunity protein	610	470	112	0	X
15189	CD5d1	610	453	105	0	X
25288	TRIM19 B-box1 (B1) of human promyelocytic leukemia (PML)	610	362	108	0	X
17831	nDsbD-ox	610	475	119	0	X
17775	chimeric Af1503 HAMP- EnvZ DHp homodimer	610	456	112	0	X
16406	peptidyl-prolyl cis-trans isomerase	610	322	109	0	X
18887	hypothetical protein lmo0427	610	462	112	0	X
16002	Migfilin	610	321	108	0	X
18505	MHV N NTD	610	422	122	0	X
19398	Forkhead DNA binding domain of Brugia malayi DAF-16a	609	423	109	0	X
15902	Ta0387	609	467	117	0	X
18523	HSP12 SDS	609	425	111	0	X
18142	PHD zinc finger	609	392	105	0	X
17942	Complex of hDlg and E6	609	460	111	0	X
10038	Zinc finger protein 295	609	447	106	0	X
16375	NleG2-3	609	432	104	0	X
18012	N-terminal domain of human TIG3	609	452	103	0	X
16374	NleG2-3	609	432	104	0	X
16617	ATH	609	428	110	0	X
16315	putative phage integrase IntS	609	492	124	0	X
16635	N_delta	609	452	105	0	X
19231	PmrA	609	460	110	0	X
7300	COMMD1 N-terminal domain	608	439	108	0	X
10326	Filamin-B	608	465	104	0	X
18899	Doc monomer	608	488	116	0	X
15008	Spo0FH101A monomer	608	519	127	0	X
36026	Human Gelsolin protein domain 1	608	114	127	0	X
17021	MaR143A	608	460	121	0	X
16144	Bp-Ohr	608	517	139	0	X
4312	bromodomain	608	382	107	0	X
16370	Human Myotilin	608	458	113	0	X
6044	La protein	608	464	99	0	X
6114	BRCTc domain	608	470	111	0	X
5596	yggu	608	454	108	0	X
10328	Filamin-C	608	467	106	0	X
6140	At3g16450.1	607	805	291	0	X
4901	p62 N-terminal domain	607	316	108	0	X
17532	CaBP1	607	484	139	0	X
10130	NPL4 family protein	607	457	111	0	X
5044	NEURAL CELL ADHESION MOLECULE	607	324	111	0	X
11096	Netrin receptor DCC	607	468	101	0	X
25576	human SUMO1	607	433	104	0	X
30445	C-C motif chemokine 28	607	434	111	0	X
26844	procapsid	607	448	132	0	X
6732	derCD23	607	425	125	0	X
17137	YgaP	607	451	108	0	X
10148	Protein odd-skipped-related 2	607	456	89	0	X
19034	third RNA Recognition Motif (RRM) of U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2	607	367	102	0	X
19848	PA3793 from Pseudomonas aeruginosa	607	462	120	0	X
16862	CaBP1	607	484	139	0	X
5560	TM1290 conserved hypothetical protein	607	435	104	0	X
6580	socs3 bound to a phosphotyrosine peptide	607	478	146	0	X
15394	rpp mutation S173N	607	317	125	0	X
17597	Rv0577	606	772	221	0	X
18605	HR8682B	606	447	107	0	X
18905	RRM2 domain of the protein RBM10 from homo sapiens	606	446	124	0	X
19988	PR domain of FOG-1	606	474	109	0	X
17446	SAP97NPDZ1	606	567	181	0	X
16328	single chain polymers	606	315	126	0	X
5130	human lysozyme at 35 degree C	606	248	127	0	X
6582	ecBMPR-II	606	474	115	0	X
11118	Neogenin	605	471	102	0	X
6046	West Nile Virus I, strain 385-99, Domain III	605	444	110	0	X
11292	Receptor-type tyrosine-protein phosphatase delta	605	443	107	0	X
6361	DEK residues 78-186	605	447	112	0	X
34425	Protein TonB	605	453	109	0	X
17557	human ribosomal protein P1/P2 heterodimer	605	401	0	0	X
4720	Inhibitor-2 monomer	605	509	162	0	X
5185	vascular endothelial growth factor receptor-binding domain dimer in complex with peptide v107	605	444	97	0	X
15528	ePABP2-trp	605	460	124	0	X
18966	ComP	605	466	93	0	X
6439	PAS1 monomer	604	459	114	0	X
15943	yegP	604	440	120	0	X
25401	CCL28	604	434	110	0	X
7184	chemosensory protein CSP-sg4	604	438	118	0	X
30677	Organic hydroperoxide resistance protein	604	482	134	0	X
34110	RNA chaperone ProQ	604	493	126	0	X
4371	Recombinant Onconase/P30 protein	604	470	117	0	X
18761	FE65 PTB2	604	513	131	0	X
34399	Cystatin-C	604	449	99	0	X
6345	ykr049c	604	506	121	0	X
19382	hnRNP G RRM in complex with the RNA 5'-AUCAAA-3'	604	293	97	0	X		X
30195	Calmodulin	604	266	142	0	X
5719	La protein	604	470	103	0	X
17818	FKBP-type peptidyl-prolyl cis-trans isomerase	604	378	116	0	X
4339	FL30 PROTEIN	604	408	112	0	X
6210	HR2106 dimer	604	339	107	0	X
4087	E2	604	336	108	0	X
25343	Talin-F3 / RIAM N-terminal Peptide complex	603	0	90	0	X
10109	Glutamate Receptor Interacting Protein 1A-L Homolog	603	457	111	0	X
25640	INTERACTION OF CYTOCHROME C AND CARDIOLIPIN	603	396	103	0	X
4761	cytochrome c'	603	0	130	0	X
11268	Ubiquitin-like protein SB132	603	461	99	0	X
17158	PARP-1 Finger 2	603	366	110	0	X
30091	Circadian clock protein KaiB	603	466	97	0	X
4165	Tn916 integrase DNA complex	603	231	80	0	X	X
5921	TM1442	603	487	121	0	X
10160	Filamin-B	603	470	105	0	X
25942	Full-length WT SOD1	603	279	158	0	X
10254	FYVE, RhoGEF and PH domain containing protein 3	603	454	108	0	X
19618	transport protein	603	469	116	0	X
6503	apo v-Src SH2	602	456	120	0	X
30237	Interleukin-1 receptor-associated kinase 3 (E.C.2.7.11.1)	602	483	131	0	X
30331	Tyrosine-protein kinase ABL1 (E.C.2.7.10.2)	602	869	224	0	X
6510	AMA1 Domain II	602	483	140	0	X
11055	Grb2 SH2	602	273	103	0	X
4560	T4MOD	602	458	111	0	X
15480	w60g-b2m	602	0	0	0	X
18398	WNK1 Autoinhibitory Domain	602	438	97	0	X
25070	Rad18-UBZ/ubiquitin complex	602	438	106	0	X
34407	NEDD4-like E3 ubiquitin-protein ligase WWP2 (E.C.2.3.2.26)	602	446	109	0	X
10258	Ephrin type-B receptor 1	602	450	108	0	X
10058	Thioredoxin-like protein 2	602	452	101	0	X
11099	Netrin receptor DCC	602	467	108	0	X
17278	TgADF Monomer	601	478	109	0	X
17307	HIV-1 Capsid in complex with stapled peptide Inhibitor	601	377	94	0	X
11425	SPFH domain of human stomatin	601	453	122	0	X
10242	Interleukin-16	601	456	111	0	X
15176	Darpp-32	601	477	102	0	X
18094	AF4-Af9 fusion	601	446	108	0	X
4751	mouse lysozyme	601	0	127	0	X
19314	HR9151A	601	453	98	0	X
10268	Protocadherin-9	601	469	119	0	X
18507	beta2 carbohydrate module of AMP-activated protein kinase	601	397	103	0	X
26681	CaM1234	601	266	142	0	X
18290	SnR212	601	445	115	0	X
6799	MrR16	600	437	105	0	X
19453	SP17945A	600	325	108	0	X
4528	NITROGEN REGULATION PROTEIN C	600	363	113	0	X
17467	VRN1_B3b	600	514	122	0	X
18086	YjdK	600	304	103	0	X
27064	CD147	600	430	113	0	X
6051	methionine sulfoxide reductase B	600	465	127	0	X
25109	MAVS CARD	600	428	116	0	X
15540	C-terminal chromo domain	600	428	109	0	X
16066	RelE	600	409	94	0	X
16233	Eimeria tenella microneme protein 3 mar1a domain	600	481	121	0	X
6921	human cytochrome b5 with oxydized heme	599	461	103	0	X
16001	AraC-DBD	599	465	114	0	X
4973	Saratin	599	436	112	0	X
5361	TELOMERE REPEAT BINDING FACTOR 1/DNA Complex	599	186	67	0	X	X
18587	MHV nsp3a momoner	599	407	107	0	X
5629	MTH187	599	440	118	0	X
17732	Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA	599	70	80	0	X	X
17324	Mus81-winged helix domain	599	432	90	0	X
11506	human full-length vaccinia related kinase 1 (VRK1)	599	1305	349	0	X
10106	hypothetical protein RAFL09-47-K03	599	446	99	0	X
17729	C-Terminal domain of Ler	599	151	59	0	X	X
10093	Homeobox protein Cux-2	599	432	108	0	X
5093	RbfADelta25	599	442	108	0	X
4136	E. coli multidrug resistance protein E	599	283	113	0	X
18130	monomeric Pstrx2	598	476	106	0	X
16194	hnRNP F/AGGGAU G-tract RNA complex	598	283	114	0	X		X
17737	HopPmal_281_385	598	430	108	0	X
4777	cytochrome c552	598	422	107	0	X
5314	Grb14 SH2 domain/phosphorylated undecapeptide complex	598	232	112	0	X
6356	Yeast Frataxin homolog 1 protein	598	510	115	0	X
11121	Neogenin	598	463	108	0	X
16779	Lmo2-LIM2/Ldb1-LID	598	435	119	0	X
4999	nucleocapsid binding domain of the sendai virus phosphoprotein	598	437	101	0	X
15783	FGF-1	598	364	132	0	X
4471	cytochrome c552	597	448	106	0	X
6267	phospho-IIB-mannitol	597	453	120	0	X
18489	HR2876B	597	448	90	0	X
15662	amelogenin	597	641	142	0	X
18122	Photoactive Yellow Protein	597	544	132	0	X
19080	NS2B-NS3pro	597	568	195	0	X
11192	Myosin binding protein C, fast-type	597	460	104	0	X
11221	Ig-like domain of Obscurin-like protein 1	597	452	112	0	X
15083	SIGMA-54 RPON DOMAIN-DNA COMPLEX	597	208	61	0	X	X
15210	50s ribosomal protein l14e	596	432	95	0	X
18508	beta2 carbohydrate module of AMP-activated protein kinase bound to glucosyl-cyclodextrin	596	395	106	0	X
28047	RalA.GDP	596	0	171	0	X
11085	NEDD9 interacting protein with calponin homology and LIM domains	596	472	112	0	X
11389	Jumonji/ARID domain-containing protein 1D	596	445	95	0	X
5309	Fusion of the LIM binding domain of Ldb1 and the N-terminal LIM domain of LMO4	595	393	116	0	X
16305	NbSyn2 Monomer	595	432	130	0	X
7257	RRM domain of SR rich factor 9G8	595	444	109	0	X
16263	NLRP7 Pyd monomer	595	417	101	0	X
10263	Receptor-type tyrosine-protein phosphatase F	595	447	103	0	X
27643	WH DOmain of ORC2	595	434	114	0	X
10027	DnaA	595	459	110	0	X
25495	cNTnC-cTnIA162H	595	239	83	0	X
15849	MrR110B	594	450	105	0	X
25885	RBM24	594	450	104	0	X
5960	myristoylated HIV-1 matrix	594	500	130	0	X
17706	SRSF2	594	246	100	0	X		X
15498	UbcH7	594	602	150	0	X
27867	TGIF2-RD2a monomer	594	463	104	0	X
7193	PA1123	594	434	108	0	X
30492	Caspase recruitment domain-containing protein 9	594	449	96	0	X
5963	hypothetical protein hi1723	594	379	118	0	X
16231	Pathogen Recognition Domain from Plodia interpunctella	594	415	110	0	X
5688	cathelin-like domain of the protegrin-3 precursor	594	195	93	0	X
10060	C330018D20rik protein	593	434	94	0	X
7226	Conserved protein MTH1368	593	341	106	0	X
6393	human TSG-6	593	427	113	0	X
18733	NB7890A	593	336	115	0	X
10049	Transcription elongation factor S-II protein 3	593	433	100	0	X
25868	DA05R1	593	425	94	0	X
17018	DAXX helical bundle	593	428	96	0	X
16192	hnRNP F/AGGGAU G-tract RNA complex	593	258	102	0	X		X
17268	Thioredoxin_C	593	302	104	0	X
16887	HIV-2 unmyristoylated matrix protein	593	380	126	0	X
34344	Surface protein, mlp lipoprotein family	593	414	114	0	X
11257	ubiquitin-like 3	592	445	102	0	X
6611	receiver domain of NtrC4	592	360	109	0	X
10025	MAP/microtubule affinity-regulating kinase 3	592	436	102	0	X
18560	hs356_22_132	592	424	113	0	X
4109	rat CD2 domain 1	592	458	115	0	X
16863	KipI-N	592	394	111	0	X
4291	Cytochrome C3	592	0	0	0	X
7033	GSPT1/eRF3a(PAM2-2) - PABC complex	591	249	81	0	X
17546	Phytochrome	591	587	148	0	X
25743	Baz1a-bromodomain	591	338	112	0	X
6493	URNdesign	591	443	104	0	X
10071	RNA-binding protein Raly	591	442	108	0	X
16163	F0	591	442	118	0	X
4766	Vesl-1S	591	528	165	0	X
18878	Solution structure of the Hs. PSIP1 PWWP domain	591	408	90	0	X
30491	Caspase recruitment domain-containing protein 9	591	355	95	0	X
4333	FADD death domain	591	330	116	0	X
15717	CYANOBACTERIAL PHYTOCHROME GAF	591	587	148	0	X
6560	redesigned apocytochrome B562	591	331	110	0	X
7058	MICAL_1 CH monomer	590	426	115	0	X
6137	proBnIb monomer	590	0	0	0	X
257	thioredoxin	590	0	0	0	X
5722	complex between Ca2+/C-terminal domain of caltractin and 19-resiude peptide from Kar1p	590	317	79	0	X
4574	CIDE-N DOMAIN OF HUMAN CIDE-B	590	391	109	0	X
18317	sugarcane cystatin	590	419	116	0	X
18839	monomeric sugarcane canecystatin	590	419	116	0	X
10331	Filamin-C	590	446	108	0	X
5372	CYTOCHROME C	589	0	0	0	X
6919	MAN1 655-775 domain	589	414	99	0	X
18919	Full-length cytochrome b5 with heme B	589	157	101	0	X
5365	myocyte nuclear factor	589	184	89	0	X
27519	Nb11	589	448	126	0	X
5764	ALY	589	419	111	0	X
4381	Third EH domain of human Eps15	589	445	92	0	X
17398	A protein from fission yeast	589	379	105	0	X
5650	L23	589	413	100	0	X
19168	C-terminal domain of translation initiation factor IF-3	589	433	95	0	X
18118	BC040485	589	336	113	0	X
6625	PHPT1	589	475	113	0	X
15134	phl p 3	588	386	95	0	X
25171	MLL-IBD complex	588	533	148	0	X
15217	YKVR Monomer	588	353	101	0	X
34325	Type IV pilin PilE1	588	459	106	0	X
17263	Small archaeal modifier protein 1 from Methanosarcina acetivorans	588	443	101	0	X
16064	BF1650	588	408	108	0	X
15599	PHPT1 monomer	588	357	109	0	X
17014	ChxR monomer	588	452	111	0	X
4935	Signal Recognition Particle Protein SRP19	587	425	90	0	X
34167	Envelope Protein	587	474	110	0	X
17502	NUCLEAR AND CYTOPLASMIC POLYADENYLATED RNA-BINDING PUB1	587	451	100	0	X
18441	harmonin	587	322	91	0	X
11310	phosphoacetylglucosamine mutase	587	440	103	0	X
30388	Very low-density lipoprotein receptor	587	403	125	0	X
5792	CyaY	587	434	116	0	X
16882	Ubiquitin-Binding Motif	586	435	103	0	X
16193	hnRNP F/AGGGAU G-tract RNA complex	586	357	97	0	X		X
5887	nuclear transport factor 2	586	379	138	0	X
15478	M7	586	0	111	0	X
10123	Hepatoma-derived growth factor, related protein 3	586	438	91	0	X
5313	Gap Junction 43kDa Carboxyl Terminus	586	463	136	0	X
36021	Metabotropic GABA-B receptor subtype 1, Metabotropic GABA-B receptor subtype 3, isoform A	586	406	109	0	X
17674	FGF1-SSR128129E	586	359	129	0	X
25983	SCP2L2	586	355	110	0	X
7268	TCAD1 monomer	585	450	101	0	X
17907	HMG_ACPI	585	418	108	0	X
4788	Reps1 EH domain	585	286	93	0	X
4782	Polyandrocarpa lectin	585	404	125	0	X
25761	PC07372D	585	355	107	0	X
18278	FKBP12 from Aedes aegypti	585	423	104	0	X
25559	C-terminal domain of human polymerase Rev1 in complex with PolD3 RIR-motif	585	338	103	0	X
4779	Ligand Binding Domain of the Human TGF-beta type II receptor	585	477	105	0	X
25662	or446	585	422	99	0	X
25538	Mdmx-SJ212	584	401	96	0	X
11117	Ephrin type-A receptor 1	584	445	95	0	X
15960	FGF-1/IHP complex	584	357	130	0	X
4858	NUCLEOLIN RBD1	584	309	100	0	X
30537	Thioredoxin	584	505	124	0	X
34451	MacpD	584	445	110	0	X
5142	human lysozyme	584	374	127	0	X
5407	cytochrome c maturation protein E	584	417	115	0	X
17305	NLRP12 PYD monomer	584	402	102	0	X
4787	Apical Membrane Antigen 1	584	358	96	0	X
5377	Ca(2+)S100B-TRTK-12 peptide complex	584	400	95	0	X
5189	S100A11 homodimer	584	430	105	0	X
6552	redesigned apo-cytochrome b562	584	311	116	0	X
26042	BRD4 ET with LANA	584	350	96	0	X
16361	p62 PB1	584	352	88	0	X
26986	yTrx1	584	446	104	0	X
7178	putative chaperone	584	356	100	0	X
6786	MsrA	583	654	172	0	X
5842	IR24	583	448	116	0	X
6634	K45Q cytochrome c3	583	0	0	0	X
15585	ATU1810	583	416	100	0	X
19399	EKLF(22-40)/Ubiquitin Complex	583	339	101	0	X
11597	Monosiga brevicollis CRK/CRKL homolog (crka1) SH2 domain	583	440	101	0	X
256	thioredoxin	583	0	0	0	X
34139	sh3b domain	583	439	111	0	X
6337	AAH26994	583	419	104	0	X
4905	G88W110 fragment of staphylococcal nuclease	583	322	104	0	X
17707	SRSF2_RRM/RNA complex	583	268	97	0	X		X
15343	HR4730A	582	430	104	0	X
4149	gallium putidaredoxin	582	446	114	0	X
16006	TM1112	582	414	91	0	X
36006	Small ubiquitin-related modifier 1	582	399	105	0	X
4697	fMet-tRNA binding domain of initiation factor IF2	582	291	122	0	X
19569	Vps28C	582	433	105	0	X
17768	gp17	582	282	102	0	X
19433	YP_002937094.1	581	339	112	0	X
36007	Small ubiquitin-related modifier 1	581	399	105	0	X
18242	PYNOD PYD	581	428	93	0	X
30303	Transcription factor PU.1	581	464	113	0	X
6342	survivin dimer	581	450	102	0	X
17315	C-terminal dsRBD of the Fission Yeast DICER	581	316	100	0	X
5497	DsbD C-terminal domain	581	469	121	0	X
6392	human TSG-6	581	412	111	0	X
27869	cytochrome PccH	581	485	121	0	X
10256	Hypothetical protein KIAA1914	581	432	102	0	X
25956	Solution structure of oxidised and zinc-bound RsrA	581	327	92	0	X
30348	NleG5-1	581	438	97	0	X
5568	YML108W	581	425	92	0	X
11290	Fibronectin type-III domain containing protein 3a	580	437	93	0	X
25536	MDMX-057	580	413	95	0	X
10097	SH3 domain-binding glutamic acid-rich-like protein 3	580	430	110	0	X
10079	KIAA0561 protein	580	453	98	0	X
25085	rhodanese domain of YgaP	580	415	102	0	X
5862	TRADD death domain	580	381	122	0	X
34026	Neural cell adhesion molecule 1	580	331	101	0	X
17596	DewA	580	432	123	0	X
10082	calcipressin 1	580	448	91	0	X
18806	Miz58	579	429	98	0	X
4701	mouse p15(INK4B) tumor suppressor	579	260	120	0	X
11397	Kelch repeat and BTB domain-containing protein 4	579	435	107	0	X
11390	Ankyrin-1	579	409	112	0	X
4628	H14	579	0	0	0	X
15109	CPH domain	579	404	105	0	X
7054	XCC1710	579	468	107	0	X
16320	SSO6904	579	433	96	0	X
16205	apo HisJ	579	755	213	0	X
11281	UBX domain-containing protein 2	579	450	99	0	X
7112	FBNYV_M-Rep_(2-95)	579	415	99	0	X
4496	Tom20	579	416	101	0	X
16746	GmR58A	579	451	107	0	X
19012	hypothetical protein BT_0846	579	329	103	0	X
25577	human SUMO2	578	411	106	0	X
19891	Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 4	578	459	118	0	X
17554	tandem UBA of USP13	578	351	119	0	X
19938	putative thioredoxin (ECH_0218) in the oxidized state	578	352	117	0	X
18672	S4WYILD	578	418	105	0	X
15403	SFVmac Pol 1-101 6His	578	442	94	0	X
6161	Yeast linker histone globular domain I	578	334	94	0	X
4688	L18	578	343	111	0	X
19783	fourth constant immunoglobulin domain of nurse shark IgNAR	578	394	97	0	X
11032	the knotted tudor domain	578	431	96	0	X
36027	Human Gelsolin protein domain 1	578	377	126	0	X
30097	Protein DDI1 homolog 2	578	405	103	0	X
6198	TM1816 monomer	578	461	104	0	X
10334	Filamin-B	577	449	98	0	X
16872	Mcm10 C-terminal DNA binding domain	577	282	98	0	X
4184	eps15 homology domain	577	430	91	0	X
25411	MPMV MA T41I T78I	577	374	100	0	X
4373	UNC-89 PH domain	577	231	99	0	X
19798	6aJL2-R24G Amyloidogenic Light Chain Protein	577	392	104	0	X
16034	S100A5	577	393	93	0	X
15606	socsbox/elonginBC	577	639	202	0	X
27400	DR5 monomer	577	447	114	0	X
5880	product of RIKEN cDNA 3110009E22	577	452	108	0	X
30370	Uncharacterized protein YejG	577	439	106	0	X
16680	Nanog	577	396	81	0	X
15446	2cxxc	577	510	127	0	X
11229	Obscurin-like protein 1	577	442	97	0	X
11286	Synapse associated protein 1	577	440	99	0	X
18375	staphyloxanthin_protein	577	433	119	0	X
34015	myristoylated M-PMV matrix protein mutant	577	374	100	0	X
10091	Tubulin-folding protein TBCE	577	422	96	0	X
7116	92aa long hypothetical protein	576	420	89	0	X
6527	Km23 homodimer	576	442	100	0	X
25888	F1F2-DNA complex	576	272	200	0	X	X
19732	NLRC5 caspase recruitment domain (CARD)	576	429	99	0	X
16033	S100A5	576	392	92	0	X
5683	QR6	576	449	105	0	X
11561	a' domain of Protein Disulfide Isomerase (oxidized form)	576	449	110	0	X
18032	RPA2022	576	443	105	0	X
4839	Rous sarcoma virus protease delta LAM mutant	576	433	106	0	X
25986	transthyretin	576	308	102	0	X
17607	RBBP1 tudor domain	575	488	116	0	X
11500	PARP11 WWE domain	575	428	100	0	X
19340	C-Terminal Domain of AciniformSpidroin	575	330	121	0	X
25663	Link HUMAN TSG-6	575	358	93	0	X
15086	hypothetical protein Cgl2762	575	411	108	0	X
6612	Ubiquitin-protein ligase E3 Mdm2 (E.C.6.3.2.-)	575	320	103	0	X
11202	Neurabin-I	575	433	113	0	X
18496	YdbC:dT19G1 complex	575	330	70	0	X	X
6031	hNotch-1 cbEGF11-13	575	382	118	0	X
4162	Neural cell adhesion molecule module 1	575	377	112	0	X
7113	The First Immunoglobulin Domain of Myotilin (Residues 249-344)	574	397	92	0	X
5049	Extracellular domain of subunit 2 of the human receptor for type I interferons	574	573	183	0	X
16285	PDZ protein	574	432	120	0	X
5976	hypothetical protein TM0487	574	463	106	0	X
19824	Solution structure of a TrkAIg2 domain construct for use in drug discovery	574	441	113	0	X
18864	CsPinA	574	332	90	0	X
11136	Vigilin	574	435	95	0	X
18269	N-terminal domain of human CDNF	574	360	98	0	X
6913	thioredoxin 2	574	435	103	0	X
15663	CaBP3 monomer	574	561	135	0	X
10127	hypothetical PNPase	574	427	88	0	X
15850	BcR103A	574	436	95	0	X
6932	cent-I	574	491	123	0	X
30373	Bromodomain-containing protein 4, Bifunctional arginine demethylase and lysyl-hydroxylase JMJD6 (E.C.1.14.11.-)	574	343	81	0	X
30368	Bromodomain-containing protein 3, Brd3_ET	573	352	79	0	X
19638	cytochrome c Y67H	573	0	0	0	X
11186	InaD-like protein	573	445	99	0	X
10323	Filamin-B	573	446	96	0	X
4098	Liver Fatty Acid-Binding Protein	572	485	109	0	X
4843	Interleukin-13	572	452	111	0	X
6868	Protein ydhR precursor	572	427	108	0	X
10085	Heterogeneous nuclear ribonucleoprotein H	572	427	96	0	X
30101	Melanoregulin	572	533	151	0	X
5803	hen egg white lysozyme	572	0	0	0	X
17526	NusB/BoxA RNA	572	427	135	0	X		X
27503	Ef-P	572	556	152	0	X
6912	yeast thioredoxin 1	572	427	105	0	X
4269	gamma delta resolvase catalytic core	572	411	109	0	X
6526	pXqua	572	375	136	0	X
17039	MvR254A	572	458	119	0	X
19366	region 2 of E. coli sigmaE	572	334	108	0	X
19749	N-terminal domain (SH2 domain) of human Inositol polyphosphate phosphatase-like protein 1 (INPPL1)	572	427	112	0	X
11140	final001	571	425	98	0	X
11227	Ephrin type-B receptor 4	571	428	94	0	X
17637	short Grx domain	571	312	112	0	X
5807	gpD	571	0	110	0	X
19006	VanU	571	461	111	0	X
19579	C-terminal domain from A. ventricosus minor ampullate spidroin (MiSp)	571	463	130	0	X
25546	MDMX-295	571	398	94	0	X
19463	p87m-HlyIIc	571	377	112	0	X
6717	Hypothetical UPF0213 protein BH0048	571	443	100	0	X
27506	VPg	571	481	123	0	X
15652	RrR43	571	435	90	0	X
10037	KIAA1798 protein	570	439	94	0	X
16368	Mb0332	570	431	116	0	X
10103	KIAA0147 protein	570	425	108	0	X
5885	DIMER OF FUSED DOCKING DOMAINS OF DEBS2 AND DEBS3	570	391	116	0	X
16211	PpiD	570	0	108	0	X
6308	ERp57, domain a	570	339	111	0	X
5485	ribosomal protein L30e	570	300	96	0	X
18845	SUP-12	570	431	99	0	X
18846	SUP-12	570	430	99	0	X		X
25717	PltL-pyrrolyl	570	313	90	0	X
10266	Receptor-type tyrosine-protein phosphatase F	570	422	103	0	X
30134	Flagellar protein FliT,Flagellar hook-associated protein 2	570	528	139	0	X
26921	Cx37CT Domain	570	397	88	0	X
15942	RRM2 monomer	570	325	100	0	X
17171	SWIRM	570	370	89	0	X
19508	human wild type FAPP1-PH domain	570	400	113	0	X
10299	Tripartite motif protein 9, isoform 2	570	414	101	0	X
16043	SR211	570	477	119	0	X
26530	SPM	570	460	154	0	X
16920	Tra2beta1 RRM in complex with AAGAAC RNA	569	280	92	0	X		X
15688	TA0956	569	303	110	0	X
16045	hH1	569	381	96	0	X
34287	functional pRN1 primase	569	370	102	0	X
25496	RRM3 domain of Gbp2	569	369	112	0	X
15736	Full-length Human frataxin monomer	569	584	147	0	X
26724	Tcb2-C	569	457	106	0	X
6007	tn3 calcium free form	569	454	115	0	X
26738	human Ca2+-bound mS100A9 (C3S) homodimer	568	435	98	0	X
11206	Glutamate receptor interacting protein 2	568	440	104	0	X
15327	YqcC	568	420	99	0	X
6820	Caltractin	568	382	93	0	X
17635	FUS/TLS RRM domain	568	446	117	0	X
30017	Protein S100-A9	568	435	98	0	X
27523	free helix bundle domain	568	370	102	0	X
26723	Tcb2-C	567	450	101	0	X
11261	Ubiquilin 3	567	434	97	0	X
15039	Chain_1	567	303	110	0	X
25716	pyoluteorin type II pep-tidyl carrier protein PltL, holo form	567	402	92	0	X
4716	auxilin	567	361	154	0	X
27271	BCoR-AF9	567	448	104	0	X
16463	kIV light-chain variable domain of immunoglobulin	567	429	110	0	X
10161	Filamin-B	567	429	99	0	X
5785	Matrix MetalloProteinase-3 in complex with N-TIMP-1	567	495	138	0	X
16238	VC_A0919	566	437	102	0	X
6553	Redesigned apo-cytochrome b562	566	315	113	0	X
2031	interleukin 4	566	0	138	0	X
11080	CsPin	566	327	90	0	X
15072	oscp-nt alpha-nt	566	222	100	0	X
5959	Antigen Ki-67 FHA domain	566	434	103	0	X
11291	myosin binding protein C, fast-type	566	424	97	0	X
17166	dN6	566	423	97	0	X
10081	rhophilin, Rho GTPase binding protein 2	566	427	100	0	X
11249	holo GrxS14	566	409	97	0	X
6484	S100A13	565	424	100	0	X
34052	Curli production assembly/transport component CsgF	565	428	122	0	X
26041	BRD4 ET with NSD3_1	565	329	82	0	X
5047	LCCL module of human coch-5b2 protein	565	0	108	0	X
1093	lysozyme	565	0	0	0	X
19126	GlyR	565	283	155	0	X
15304	ExbD periplasmic domain	565	411	94	0	X
18546	tandem zinc finger domain of Stc1	565	385	105	0	X
11207	LAP4 protein	564	431	105	0	X
4575	N-terminal 24 kDa fragment of gyrase B	564	583	202	0	X
16121	L14e_ribosomal_protein	564	420	91	0	X
15577	Crepressor	564	422	106	0	X
6082	methionine-rich 2S albumin from Sunflower seed	564	0	0	0	X
17476	zinc-finger	564	313	89	0	X
16114	Ubiquitin/UIM fusion protein	564	324	105	0	X
15232	v8pf	564	371	127	0	X
6640	JHP1348	564	438	106	0	X
18849	BfmrC	564	420	96	0	X
15816	DsrR	564	431	101	0	X
17906	CurA	563	418	108	0	X
4395	RIBOSOMAL PROTEIN L25	563	410	93	0	X
7032	KIV8	563	389	102	0	X
11103	Netrin receptor DCC	563	434	98	0	X
27097	mvo10b homodimer	563	426	100	0	X
15762	SfR90	563	417	105	0	X
25825	UBL protein	563	404	98	0	X
19943	inner membrane protein YgaP	563	306	112	0	X
19423	Vav1 SH2 domain complex	563	315	92	0	X
26947	AIPL1 FKBP/FC complex	563	505	113	0	X
6118	glutaredoxin	563	214	108	0	X
15562	Ymr074cp (1-116) monomer	563	466	118	0	X
11409	cDNA FLJ40872 fis, clone TUTER2000283, highly similar to Homo sapiens transformer-2-beta (SFRS10) gene	562	409	96	0	X		X
15789	Ca-bound MCFD2	562	421	108	0	X
17314	Nonphosphorylated Peptide Recognizing Domain	562	388	97	0	X
15263	NAB2 NTD	562	339	111	0	X
4019	plastocyanin	562	402	101	0	X
10330	Filamin-C	562	437	99	0	X
6624	RA1	562	362	92	0	X
5763	SAV1595	562	313	102	0	X
5544	Ca2+-loaded S100B(beta beta)-TRTK-12 peptide complex	562	362	92	0	X
11525	PriC N-temrinal domain	562	423	112	0	X
4940	Antennal Specific Protein 1	562	386	101	0	X
16508	synaptobrevin	561	360	106	0	X
10029	membrane associated guanylate kinase inverted-2	561	417	102	0	X
16839	chemokine CCL27	561	409	95	0	X
11211	Myosin-binding protein C, slow-type	561	423	99	0	X
16111	Art v 1- the major allergen of Artemisia vulgaris	561	293	106	0	X
17445	Akap79M	561	491	157	0	X
18734	ZP_02034617.1	561	315	100	0	X
26053	MapZ_SY	561	426	113	0	X
26043	BRD4 ET domain with NSD3_3 peptide	561	321	81	0	X
15834	FeoA_protein	560	416	104	0	X
25027	NMR structure of the hypothetical protein BVU_0925 from Bacteroides vulgatus ATCC 8482	560	324	107	0	X
25007	C3 DOMAIN OF CARDIAC MYOSIN BINDING PROTEIN-C, WT	560	423	99	0	X
5778	Pleckstrin Homology domain of the human Protein Kinase B beta	560	303	86	0	X
10086	Rap guanine nucleotide exchange factor 5	560	420	86	0	X
30297	Cytoplasmic Tail of HIV-1 gp41 protein	560	462	107	0	X
7109	TrxA monomer	560	420	105	0	X
18696	rmodN	560	574	143	0	X
34080	hnRNP A1 RRM2 in complex with 5'-UCAGUU-3' RNA	560	293	92	0	X		X
17378	PROTEIN	560	345	92	0	X
36185	RNA binding protein La-like protein	560	195	91	0	X
11413	cDNA FLJ40872 fis, clone TUTER2000283, highly similar to Homo sapiens transformer-2-beta (SFRS10) gene	560	333	96	0	X
19367	complex formed by the region 2 of E. coli sigmaE and its cognate -10 non template element TGTCAAA	560	317	103	0	X	X
15190	HP0495	559	413	91	0	X
6147	LuxU	559	455	114	0	X
17150	phosphotransferase_IIB	559	419	109	0	X
18577	Connexin45 Carboxyl Terminal Domain	559	406	92	0	X
18623	mutant (T170E) second CARD of human RIG-I	559	431	96	0	X
6957	SCAN	559	398	93	0	X
7085	hypothetical protein yst6499	559	405	91	0	X
26725	MtRpsA_S4	559	355	87	0	X
25160	RRM1 of human LARP6	559	461	104	0	X
7108	TrxA monomer	559	439	105	0	X
260	plastocyanin	559	0	0	0	X
6918	Ca2+/CRC-N	559	384	93	0	X
15801	ArsR	559	321	100	0	X
25499	RRM3 domain of Hrb1	559	288	113	0	X
4786	Bleomycin resistance protein of S. hindustanus	559	467	117	0	X
17352	Taf14 YEATS domain	559	392	107	0	X
5399	Erg Pointed Domain	559	432	112	0	X
18113	allergenic beta parvalbumin	559	418	105	0	X
6011	At5g22580	558	437	111	0	X
19248	SRSF1 RRM2 in complex with the RNA 5'-UGAAGGAC-3'	558	271	89	0	X		X
34009	Inner membrane protein YgaP	558	303	110	0	X
4452	sea raven Type II antifreeze protein	558	0	120	0	X
18725	Faap24	558	341	79	0	X
16339	LKAMG	558	301	121	0	X
17577	Siderocalin Q83	558	613	151	0	X
25565	BCOR PUFD	558	446	102	0	X
15002	CtBP THAP domain	557	412	95	0	X
5226	Ssh10b dimer	557	420	101	0	X
16204	holo HisJ	557	702	227	0	X
25564	Third Type III Domain from Human Fibronectin	557	439	99	0	X
16948	GTPase Effector Domain ( GED)	557	366	124	0	X
17173	Nrd1 CID	557	348	116	0	X
15320	UPF0350 protein VC_2471	557	324	98	0	X
6249	BD37	557	829	278	0	X
6111	Choristoneura fumiferana antifreeze protein isoform 501	557	429	124	0	X
15092	single polypeptide	557	423	124	0	X
17136	GlpE	557	302	120	0	X
4437	MEROZOITE SURFACE PROTEIN 1	557	339	105	0	X
7297	conserved hypotetical protein RPA1320	556	417	95	0	X
25069	human Ca2+-loaded S100A4 cys-free mutant	556	400	103	0	X
18697	rmodN-ACSL complex	556	522	145	0	X
5128	GABARAP monomer	556	199	97	0	X
25773	Trappin-2	556	401	95	0	X
10142	Filamin-B	556	427	96	0	X
443	ribonuclease A	556	0	0	0	X
7165	Urm1 monomer	556	390	102	0	X
6456	SH3 domain of Lyn Tyrosine Kinase with a herpesviral ligand	556	321	84	0	X
19233	msp1	556	382	108	0	X
15673	PisI	556	342	106	0	X
25010	Hypertrophic Cardiomyopathy-Related R502W Mutant	556	326	100	0	X
17705	SRSF2_RRM	556	264	96	0	X
17600	Par-6	556	427	103	0	X
6803	FecA N-terminal periplasmic signaling domain	556	381	107	0	X
36070	Cytochrome b5	556	195	83	0	X
27780	eCUE	556	402	99	0	X
7371	SiR5	556	420	93	0	X
11110	Tenascin-X	556	431	95	0	X
6221	RpfBc	555	300	124	0	X
17365	ASHH2 a CW domain	555	395	109	0	X
4010	OB-fold sub-domain of staphylococcal nuclease	555	0	104	0	X
18622	second CARD of human RIG-I	555	448	96	0	X
4748	ORYZACYSTATIN-I	555	0	100	0	X
16084	SRU_0103	555	310	99	0	X
19461	HlyIIC-Cis	555	371	113	0	X
144	parvalbumin	555	0	0	0	X
30061	Fibronectin, Anastellin	555	418	91	0	X
10077	Eukaryotic translation initiation factor 4B	555	415	93	0	X
16450	YSK2	555	398	109	0	X
15509	CPH domain monomer	555	372	105	0	X
25038	hnRNP L	555	318	103	0	X
18156	HR6741A	555	420	101	0	X
25515	non-phosphorylated J-domain of Human Cysteine String Protein (CSP)	555	410	104	0	X
4374	Sml1 protein	555	389	96	0	X
18694	KIX domain complex	555	437	108	0	X
5085	PABC-Paip2 complex	555	182	107	0	X
25244	HuR_RRM1 monomer	554	412	106	0	X
30155	ELAV-like protein 1	554	412	106	0	X
18765	RRM1 monomer	554	415	99	0	X
18801	NmPin	554	384	94	0	X
18850	Haloferax volcanii HVO_2177 protein	554	441	98	0	X
18263	RPA2022	554	436	102	0	X
11042	RelE	554	417	86	0	X
19946	cytoplasmic rhodanese domain of the full-length inner membrane protein YgaP	554	303	112	0	X
25139	MANEC-type domain from Hepatocyte Growth Factor Inhibitor 1	554	381	105	0	X
18540	midkine-a	554	367	122	0	X
6601	PrsA PPIase	554	417	92	0	X
17586	Rv0020c_FHA	553	287	114	0	X
7053	cysteine catalytic half-domain of mouse E1 protein	553	437	108	0	X
25627	meiosis-expressed gene 1 (Meig1)	553	410	99	0	X
17687	PARP-1 BRCT domain	553	328	98	0	X
30395	phosphate-loop protein	553	460	113	0	X
30034	Uncharacterized protein	553	439	115	0	X
25514	phosphorylated J-domain of Human Cysteine String Protein (CSP)	553	400	106	0	X
17857	S100A1E32Q	553	415	101	0	X
10288	Hepatocyte nuclear factor 1-beta	553	401	99	0	X
16686	lmo0835	553	428	101	0	X
6207	EC0510	553	421	105	0	X
7301	SF2/ASF RRM2	553	454	109	0	X
30161	Two-component system response regulator	552	468	111	0	X
19544	RsmZ(SL1)/RsmE(dimer) 2:1 complex	552	360	78	0	X		X
7074	Zn-saturated Pf0610	552	391	90	0	X
5950	Cell division Activator CedA	552	381	96	0	X
1673	flavodoxin	552	0	174	0	X
25382	UBX-L domain of VCIP135	552	316	79	0	X
4827	cystatin A	552	274	102	0	X
17146	ApcA	552	431	107	0	X
6829	Chitin binding domain	552	429	110	0	X
10033	1700030A21Rik protein	552	401	92	0	X
5498	p67SH3(C) and p47 tail peptide	551	395	86	0	X
4902	SH2 domain of Human Protein Tyrosine Kinase 6	551	403	96	0	X
5505	Cu (II) Plastocyanin from Anabaena Variabilis	551	427	103	0	X
4430	CALCYCLIN (RABBIT)	551	296	94	0	X
6128	At3g01050.1	551	502	116	0	X
6287	GABPalpha pointed domain	551	414	86	0	X
15113	NC:muPsi complex	551	88	0	0	X		X
6585	At1g24000.1	551	441	116	0	X
18693	Exocrine gland-secreting peptide 4	551	410	100	0	X
34079	Heterogeneous nuclear ribonucleoprotein A1/RNA Complex	551	293	93	0	X		X
4350	Adenylate kinase from E. coli	551	0	189	0	X
30394	phosphate-loop protein	551	461	113	0	X
27098	mth10btqqa homodimer	551	407	106	0	X
11591	chitosan-binding module 1	551	457	140	0	X
5141	SasA N-terminus	551	343	104	0	X
10056	regulator of G-protein signaling 14; rap1/rap2 interacting protein	551	410	88	0	X
4870	region 4 of sigma70 of E. coli RNA polymerase holoenzyme	550	417	105	0	X
16913	squash aspartic acid proteinase inhibitor	550	421	0	0	X
5845	MW2441 protein	550	417	110	0	X
7095	Ubiquitin-like protein 3	550	406	91	0	X
1766	neocarzinostatin	550	0	0	0	X
15790	ANDES HANTAVIRUS NUCLEOCAPSID PROTEIN	550	416	96	0	X
16744	APLF	550	302	95	0	X
5040	I1(I29T) monomer	550	492	148	0	X
5055	HYPOTHETICAL PROTEIN HI0257	550	397	112	0	X
11038	The DNA binding domain of RTBP1	550	409	113	0	X
11245	ubiquitin-like 5	550	415	99	0	X
36018	Splicing factor 3B subunit 4	549	411	94	0	X
6577	Bacillus stearothermophilus IF2-C1	549	425	106	0	X
3441	lysozyme	549	0	0	0	X
16897	MTH1821	549	375	92	0	X
15975	4 sigma70	549	431	104	0	X
15046	Subunit F of the A1AO ATP synthase from Methanosarcina mazei Go1	549	395	103	0	X
10322	Filamin-B	549	416	96	0	X
17650	AbrB	549	399	91	0	X
18471	PWWP_domain	549	298	101	0	X
15125	monomer	549	387	87	0	X
19906	EDB and specific binding aptide	549	328	104	0	X
11267	Ubiquitin-like protein SMT3B	549	399	94	0	X
4793	HYPOTHETICAL PROTEIN MTH538	549	422	108	0	X
27781	Grb2-SH2	549	414	81	0	X
34346	Big defensin 1	548	172	90	0	X
4459	T4 Glutaredoxin	548	0	0	0	X
5891	Sso10a	548	443	93	0	X
15344	RhR5	548	415	97	0	X
16851	KIX_ETAD1	548	438	112	0	X
5070	C-terminal domain of tyrosyl-tRNA synthetase	548	368	101	0	X
10137	Lipocalin-type Prostaglandin D synthase	548	351	107	0	X
16360	S100A1 (aa) dimer	548	417	100	0	X
10275	PAAD_DAPIN, UNP residues 8-88	547	381	90	0	X
16805	RpR324	547	428	99	0	X
19320	Taf15	547	412	100	0	X
11216	PDZ domain containing protein 1	547	410	99	0	X
10043	Signal Recoginition Particle 54	547	407	103	0	X
5169	beta2-microglobulin	547	0	0	0	X
16774	Rv0543c	547	418	94	0	X
11199	Enigma homologue protein	547	407	106	0	X
18046	D6	547	423	108	0	X
11488	protein	547	415	86	0	X
17144	ApcA	547	419	108	0	X
18916	BRCT domain of yeast REV1	546	398	86	0	X
16352	AF2094	546	391	91	0	X
16057	gp15	546	382	93	0	X
18087	S100A1C85M	546	396	95	0	X
18954	GUCT	546	307	101	0	X
16778	CBX7/H3K27me2 complex	546	307	68	0	X
4414	plastocyanin	546	0	0	0	X
4828	cystatin A P25S	546	275	103	0	X
16050	Ca-S100A1 and TRTK12	546	369	93	0	X
11562	a' domain of Protein Disulfide Isomerase (reduced form)	545	448	115	0	X
11501	PARP14 WWE	545	405	99	0	X
17345	PROTEIN	545	414	87	0	X
6375	TonB C-terminal Domain monomer	545	359	93	0	X
4343	PTB-C197-system	545	520	172	0	X
26571	EhCaBP6	545	306	144	0	X
25994	designed protein E_1r26	545	311	106	0	X
18484	G5	545	309	101	0	X
4458	T4 Glutaredoxin	545	0	0	0	X
15676	prion protein	545	301	117	0	X
18580	H6-vMycCterm	545	418	120	0	X
25159	LARP6-LaM	545	416	98	0	X
5014	MyBP-C cC5	545	448	126	0	X
5969	holo-neocarzinostatin	544	179	115	0	X
5798	Protein yrbA	544	384	99	0	X
30334	Thioredoxin	544	443	111	0	X
34463	Integration host factor MIHF	544	324	111	0	X
6876	Chagasin	544	335	113	0	X
4280	Methyl binding domain of MeCP2	544	291	91	0	X
5129	MTH1880 without calcium	544	286	95	0	X
5982	apolipoprotein	544	382	95	0	X
385	ribonuclease A	544	0	0	0	X
16230	U6 snRNP (small fragment)	544	367	91	0	X		X
7024	rabbitpox vCCI:human MIP-1b complex	544	782	270	0	X
7137	C-TERMINAL DOMAIN OF INSULIN-LIKE GROWTH FACTOR BINDING PROTEIN 2	544	427	94	0	X
6843	Caspase recruitment domain protein 4	544	419	97	0	X
11399	PTB-like protein L	543	413	87	0	X
4079	A-domain HMG1	543	305	79	0	X
7083	SBD	543	309	120	0	X
27167	gb1ent-atmfatc	543	332	109	0	X
10332	Filamin-C	543	425	95	0	X
6079	thioredoxin h1 from poplar	543	451	104	0	X
19548	RsmZ(SL4)/RsmE(dimer) 2:1 complex	543	355	81	0	X		X
18089	Post-translational S-nitrosylation	543	320	100	0	X
4060	thioesterase/protease_I	543	506	161	0	X
6080	PRL-1	543	314	129	0	X
10163	Filamin-B	543	416	97	0	X
11210	amyloid beta (A4) precursor protein-binding, family A, member 1 (X11)	543	406	97	0	X
4460	Replication Protein A 32kDa subunit	543	277	104	0	X
6538	2B4 monomer	543	437	98	0	X
34142	Breast cancer anti-estrogen resistance 1,Tyrosine-protein phosphatase non-receptor type 12 (E.C.3.1.3.48)	543	385	86	0	X
27595	BAF200 ARID monomer	542	417	102	0	X
4898	complex of the FYVE domain of EEA1 with PtdIns3P	542	383	109	2	X
15541	IscU*HscB complex	542	469	154	0	X
16674	cytochrome c3	542	0	0	0	X
18088	Post-translational S-nitrosylation	542	321	100	0	X
26919	PulG	542	421	103	0	X
5308	Human-E.coli chimeric thioredoxin	542	455	108	0	X
10100	Membrane Associated Guanylate Kinase Inverted-2 (MAGI-2)	542	401	91	0	X
17388	USP13	542	408	97	0	X
16344	S6wt	541	0	106	0	X
10112	DNA segment, Chr 7, Wayne State University 128, expressed	541	408	93	0	X
5107	Sensor and Substrate Binding Domain from Lon (La) Protease (E. coli)	541	421	98	0	X
5517	B-MybR2R3	541	289	101	0	X	X
25810	N-domain of troponin C bound to the switch region of troponin I and the covalent levosimendan analog i9	541	352	116	0	X
18200	RstA_C	541	389	103	0	X
6812	ta0938	541	389	107	0	X
30006	Type I modular polyketide synthase	541	315	92	0	X
11590	PhoP DNA-Binding Domain	541	453	98	0	X
5603	proguanylin	541	268	95	0	X
15483	SQAPI	541	405	90	0	X
4080	Troponin C	541	272	8	0	X
11324	THAP domain-containing protein 2	541	415	81	0	X
4957	N-terminal domain of MotA, MotNF	541	413	91	0	X
5545	insulin-like growth factor binding protein-6	541	366	98	0	X
10050	NEDD8 ultimate buster-1	541	403	86	0	X
5512	chicken liver basic fatty acid binding protein	541	0	0	0	X
27596	R1TraIC126 disordered region of R1 Relaxosome complex	541	487	119	0	X
4670	PIN1At	540	393	103	0	X
6476	GII loop mutant, GII-L	540	403	88	0	X
18042	EDC3_DCP2	540	436	101	0	X
15956	BMPR-IA	540	379	101	0	X
5871	Ara h 6	540	407	112	0	X
34143	Breast cancer anti-estrogen resistance 1,Vinculin	540	395	86	0	X
4829	Interleukin enhancer binding factor	540	298	105	0	X
16850	Thioredoxin	540	386	198	0	X
25762	Pleiotrophin	540	533	127	0	X
5075	Apolipoprotein(a) kringle IV type 6	540	388	110	0	X
4293	DNase domain of colicin E9	540	460	161	0	X
16967	MAST2-PDZ/PTEN-C_Terminus	540	406	96	0	X
4911	DYNEIN light chain 8 (dlc8) and nNOS (fragment peptide) complex	540	259	97	0	X
11189	InaD-like protein	539	416	106	0	X
7324	SelW	539	360	95	0	X
5000	C-Terminal Domain of PAC-1	539	300	112	0	X
11180	RIM binding protein 2	539	404	100	0	X
15545	FLN29+4Zn	539	544	136	0	X
5780	apoptosis-associated SPECK-like peotein containing a CARD	539	0	0	0	X
11592	chitosan-binding module 2	539	469	137	0	X
25944	AVR3a_60-147 from Phytophthora infestans	539	374	102	0	X
19187	Methanothermobacter thermautotrophicus MCM C-terminus	539	405	83	0	X
27268	WIP-WASp complex	539	526	167	0	X
4011	Starch binding domain	539	0	101	0	X
11256	Ubiquitin carboxyl-terminal hydrolase 14	538	408	96	0	X
18555	PA1075	538	429	105	0	X
16560	protein from gene locus NE0665	538	405	98	0	X
19234	MSP1-E28K	538	287	104	0	X
11223	Leucine-rich repeat-containing protein 4	538	414	96	0	X
11541	Protein-RNA Complex	538	317	97	0	X		X
7187	Ct ole e 9 monomer	538	376	102	0	X
16570	YbbR family protein Dhaf_0833	538	409	94	0	X
10069	actin-binding LIM protein homologue	538	402	98	0	X
19870	6aJL2 Amyloidogenic Light Chain Protein	538	384	98	0	X
10019	GSPT1/eRF3a(PAM2-1) - PABC complex	538	257	77	0	X
11138	Vigilin	538	398	95	0	X
4981	fifth domain of beta2-glycoprotein I	538	389	88	0	X
4047	HU protein	537	418	112	0	X
10335	Filamin-B	537	427	95	0	X
5992	C-terminal domain of human centrin 2-Ca2+ - P1-XPC Peptide Complex	537	247	81	0	X
18678	RRM1-RBM10	537	368	100	0	X
15491	VfR117	537	399	94	0	X
4727	S16	537	269	83	0	X
6751	Asl1650	537	360	93	0	X
11125	Fibronectin type-III domain containing protein 3a	537	404	96	0	X
27462	Biliverdin reductase B	537	558	184	0	X
16561	BcR147A	537	422	94	0	X
16345	permutant P54-55	537	393	104	0	X
5115	gamma subunit of dissimilatory siroheme-sulfite reductase	537	444	103	0	X
34234	RNA polymerase sigma factor RpoS	537	390	96	0	X
25975	Geobacillus stearothermophilus IF2 G3-subdomain	537	402	110	0	X
11456	Solution structure of the N-terminal dsRBD from RNA helicase A	536	384	104	0	X
5391	Receptor-Interacting Serine/Threonine Protein Kinase 2	536	374	104	0	X
7097	brinker CG9653-PA/DNA Complex	536	255	75	0	X	X
25451	dithiolic glutaredoxin 2-C-Grx1 from the pathogen Trypanosoma brucei brucei	536	404	92	0	X
10066	KIAA1526 protein	536	406	88	0	X
15212	RRM1 domain	536	385	101	0	X
17482	Hsp12	536	391	102	0	X
2059	amicyanin	536	0	0	0	X
6531	S100 calcium-binding protein A13	536	406	95	0	X
17762	BS-RNase	536	350	132	0	X
4486	METHANE MONOOXYGENASE REGULATORY PROTEIN B	536	335	121	0	X
17020	CV_0373(175-257) protein	536	382	100	0	X
4954	Riboflavin Synthase N-domain	535	397	105	0	X
11231	KIAA1837 protein	535	401	98	0	X
17103	calcium-sensitizer, dfbp-o, in complex with troponin C and the switch region of troponin I	535	266	85	0	X
11549	DnaT	535	397	93	0	X
19694	FHL2 LIM adaptor and its Interaction with Ski	535	303	101	0	X
5401	GABPalpha Pointed Domain	535	412	99	0	X
26961	SUMO-specific protease 4 (SUSP4 201-300)	535	410	95	0	X
5762	PDZ2-AS	535	297	108	0	X
10146	Filamin-B	535	397	92	0	X
25168	flpp3Sol 2	534	421	112	0	X
7195	DHFR ternary complex	534	0	170	0	X
16895	UBB+1 (ubiquitin B mutant)	534	380	93	0	X
5552	DUAL SPECIFICITY PROTEIN PHOSPHATASE 2 (E.C.3.1.3.48)(E.C.3.1.3.16)	534	334	124	0	X
15209	hDlg PDZ2/E6 complex	534	332	93	0	X
30246	Egg-lysin	534	454	119	0	X
5872	regulator of G protein signaling Z1	534	562	146	0	X
6122	S1 monomer	534	389	100	0	X
19379	alpha7 nAChR transmembrane domain	534	473	128	0	X
15325	CTD	534	413	84	0	X
17030	HR4694F	534	394	89	0	X
15645	Im7 mutant	533	403	95	0	X
17739	HopAB1Pph1448_220_320	533	388	90	0	X
4105	S100B	533	314	88	0	X
4958	His6PSCD4	533	391	86	0	X
6453	yggx	533	330	107	0	X
11033	the presumed chromodomain	533	396	96	0	X
19550	S1F1	533	389	95	0	X
5402	sh2 domain	533	313	101	0	X
4036	Apokedarcidin	533	320	116	0	X
11230	Obscurin	533	407	94	0	X
27179	Hepatitis B virus X protein (HBx) monomer	533	450	115	0	X
6201	Ca.CD2	533	0	101	0	X
5567	Histone H3 Lysine Methyltransferase from Paramecium Bursaria Chlorella Virus 1	533	351	110	0	X
15142	DL2A homodimer	533	305	90	0	X
19547	RsmZ(SL3)/RsmE(dimer) 2:1 complex	533	346	76	0	X		X
17645	myosin VI lever arm extension	533	305	83	0	X
10273	Developmentally-regulated GTP-binding protein 1	532	406	81	0	X
1720	cytochrome c	532	0	0	0	X
15847	XF2673	532	393	91	0	X
15988	TonB2-CTD	532	279	100	0	X
11307	KIAA0161 protein	532	391	91	0	X
6314	RbfA	532	380	110	0	X
30135	Eukaryotic elongation factor 2 kinase (E.C.2.7.11.20)	532	416	109	0	X
4305	protein inhibitor of neuronal nitric oxide synthase	532	248	96	0	X
16905	Sma0114, response regulator	532	478	119	0	X
11532	oxidized human HMGB1 A box	532	398	87	0	X
6899	PAH2 domain	532	338	107	0	X
11458	N-terminal RNA recognition motif of NonO	531	391	75	0	X
17978	MPG1	531	382	103	0	X
7087	D4ED3	531	379	86	0	X
34169	Voltage-gated hydrogen channel 1	531	360	109	0	X
4259	RNAse-SA	531	183	96	0	X
19230	Hdm2	531	147	121	0	X
18986	C-terminus of the minichromosome maintenance protein MCM	531	391	82	0	X
5311	AvrPto	531	389	101	0	X
17833	Skint1 IgV	531	424	99	0	X
18591	ilvN	531	387	98	0	X
15805	PA0246	531	447	102	0	X
19643	5-Hydroxytryptamine Receptor 2a and 2c Variants with PSD-95 and SAP997	531	296	90	0	X
11139	Vigilin	531	390	89	0	X
7259	DNA polymerase mu (E.C.2.7.7.7)	531	413	100	0	X
6354	N-terminal domain of NECAP1 protein	531	498	124	0	X
16687	ilvN	531	387	98	0	X
15257	RsmE dimer with two RNA stem loops	531	340	77	0	X		X
17466	Solution structure of the RING finger-like domain of Retinoblastoma Binding Protein-6 (RBBP6)	531	300	96	0	X
16384	SR232	531	382	72	0	X
17772	Solution structure of the RING finger-like domain of Retinoblastoma Binding Protein-6 (RBBP6)	531	300	96	0	X
10119	KIAA0730 protein	531	371	90	0	X
16599	clytin monomer	531	542	194	0	X
7285	double dockerin	531	375	118	0	X
16936	MBD2 bound to a methylated DNA	530	307	70	0	X	X
27439	Sph15	530	393	105	0	X
16091	rps8	530	303	97	0	X
11523	the second RRM domain of Nrd1	530	410	93	0	X
7419	entity_1	530	386	90	0	X
5782	DN3beta2-microglobulin	530	0	0	0	X
34043	Protein TonB	530	384	92	0	X
19682	Zinc finger-PHD-type 1 domain_number-1	530	392	95	0	X
34196	Nonribosomal peptide synthetase StoC	530	312	90	0	X
11130	Zinc finger protein 512	530	386	89	0	X
25703	oxidized form of thioredoxin 1 from Sacharomyces cerevisiae	530	421	101	0	X
27524	C terminal domain of Human Gamma S Crystallin	529	323	89	0	X
6178	Polypyrimidine tract-binding protein 1 domain 1	529	411	95	0	X
17306	NR1C	529	410	103	0	X
18338	PPc	529	368	102	0	X
10262	Collagen alpha-1(XX) chain	529	404	86	0	X
19288	HR7784A	529	369	90	0	X
17579	H/ACA RNP protein Nhp2p	529	430	114	0	X
4649	HTLV-I CAPSID PROTEIN	529	477	121	0	X
19953	V domain of RAGE in complex with IOR	529	345	92	0	X
11497	the chromodomain of Swi6	529	386	90	0	X
18107	a major allergen from dust mite	529	291	94	0	X
11487	protein	529	399	83	0	X
4675	DNA binding domain of AFX transcription factor	529	494	139	0	X
5799	PSP monomer	529	599	206	0	X
5357	tm1112	528	388	89	0	X
5615	C-RcsB	528	375	92	0	X
26061	MAL/TIRAP TIR domain	528	419	104	0	X
26690	protein + bound peptide	528	408	88	0	X
10260	Receptor-type tyrosine-protein phosphatase F	528	411	92	0	X
6162	Yeast linker histone globular domain II	528	299	89	0	X
17665	synuclein tetramer	528	260	134	0	X
15225	Domain 2 of Non-structural Protein 5A (NS5AD2)	528	385	93	0	X
5263	CBM28 of CelI	528	318	175	0	X
18416	ubiquitin homology of mouse BAG-1	528	383	96	0	X
19755	MecA	528	409	90	0	X
6096	Dynein light chain 1, cytoplasmic	528	316	88	0	X
16911	VARC244	528	364	95	0	X
19546	RsmZ(SL2)/RsmE(dimer) 2:1 complex	528	346	78	0	X		X
16564	Atu1219	528	421	107	0	X
27481	DFsc	528	414	124	0	X
25607	AR-25Q	528	431	154	0	X
10259	human unnamed protein product	528	409	98	0	X
1394	acylphosphatase	527	0	0	0	X
19147	APC/C_CDH1-EMI1: multimodal mechanism of E3 ligase shutdown	527	355	86	0	X
27732	FKBP12	527	439	103	0	X
25494	First and Second KH domains of hnRNP E1	527	421	148	0	X
36034	Eukaryotic translation initiation factor 3 subunit C	527	429	103	0	X
6973	human p23(1-119)	527	373	120	0	X
5846	MR19 monomer	527	377	82	0	X
16483	CR17 from LRP-1 and ApoE	527	398	85	0	X
4394	TRANSLATION INITIATION FACTOR IF3	527	256	92	0	X
25544	human Myosin VI isoform3 (1050-1131)	527	366	89	0	X
36037	Putative uncharacterized protein	527	315	133	0	X
10110	Growth-arrest-specific protein 2	527	378	79	0	X
18961	HP0242	527	419	91	0	X
25498	RRM2 domain of Hrb1	527	409	102	0	X
18711	CH3CS	527	311	95	0	X
11132	novel protein	526	383	80	0	X
36059	RNA-binding protein Musashi homolog 1/RNA Complex	526	416	98	0	X		X
26867	HADDOCK model of the complex between the KIX domain of CBP and the transactivation domain of p65	526	476	118	0	X
17971	TGIF1	526	380	98	0	X
4941	Ku70 DNA binding domain at the C-terminus	526	288	86	0	X
17508	HR6430A	526	391	90	0	X
26789	CheY3_ph7.3_nomg	526	421	106	0	X
16475	LpxC-L-161,240 complex	526	824	275	0	X
4633	MONELLIN	526	0	0	0	X
30099	Islet amyloid polypeptide, HI18	526	320	98	0	X
695	neocarzinostatin	526	0	0	0	X
4143	Neural cell adhesion molecule module 2	526	0	97	0	X
7194	TFIIIA zf46 & 5S rRNA complex	525	297	97	0	X		X
25611	OR303	525	366	96	0	X
6138	At2g24940	525	390	110	0	X
18201	HasR N-terminal periplasmic signaling domain	525	403	107	0	X
34232	C-C chemokine receptor type 5, C-C motif chemokine 5	525	309	69	0	X
25933	NSD1-PHD_5-C5HCH tandem domain	525	366	93	0	X
15664	YqiJ	525	436	91	0	X
11450	RNA-binding protein Musashi homolog 1	525	386	90	0	X		X
30153	Bifunctional coenzyme PQQ synthesis protein C/D (E.C.1.3.3.11)	525	405	87	0	X
34419	Gag protein	525	291	0	0	X
30042	C-X-C motif chemokine 13	525	309	91	0	X
18732	NP_390345.1	525	323	90	0	X
26634	protein alone	525	405	87	0	X
11345	Transcriptional adapter 2	525	382	87	0	X
6779	Outer membrane usher protein fimD	525	310	107	0	X
2384	spasmolytic polypeptide	525	0	0	0	X
15722	Ca2+ bound Collagen binding domain derived from Clostridium Histolyticum	525	420	105	0	X
34333	Ly6/PLAUR domain-containing protein 6	525	354	97	0	X
11283	FAS-associated factor 1	525	400	91	0	X
4946	C-1027 apoprotein	524	0	0	0	X
4228	DNAJ	524	376	92	0	X
36162	Heat shock protein SSA1	524	405	107	0	X
4927	Circular Permuted Variant of CV-N	524	423	116	0	X
11254	cytoskeleton-associated protein 1	524	402	96	0	X
4912	DYNEIN	524	248	96	0	X
27610	FN III 14 module	524	389	80	0	X
25527	alpha-crystallin domain from human, HSPB5	524	359	95	0	X
18455	REV1-CT	524	380	98	0	X
19238	Calmodulin_prototypical_calcium_sensor	523	440	143	0	X
6988	HGB1-UBA monomer	523	397	103	0	X
19872	apo form of human glutaredoxin 5	523	484	118	0	X
19642	RBM39_RRM1	523	385	95	0	X
6173	PfR48	523	378	92	0	X
30062	Calmodulin, Disks large homolog 4	523	440	143	0	X
17282	IscU	523	394	98	0	X
6309	OHFD3	523	361	94	0	X
30290	Thioredoxin	523	448	105	0	X
4283	EDB	523	0	97	0	X
15972	Mast205 monomer	523	402	93	0	X
18592	MRH domain	523	361	96	0	X
7127	2F3	523	318	97	0	X
16264	Glutaredoxin	523	276	89	0	X
5332	recoverin mutant, E85Q	522	523	170	0	X
18898	LMO4-DEAF-1 tethered complex	522	354	103	0	X
6167	Nucleobindin	522	433	99	0	X
10065	putative nuclear protein homolog 5830484A20Rik	522	390	98	0	X
16999	CV0426	522	381	94	0	X
18112	HR4660B	522	530	146	0	X
17903	Iso-1-cytochrome	522	0	0	0	X
16398	Psb27	522	379	121	0	X
6015	cC1 domain	522	416	109	0	X
4117	human Elongation Factor-1beta	522	370	95	0	X
19516	Dot1L-AF9 complex	522	414	89	0	X
975	barnase	522	0	0	0	X
27062	Arig2	522	349	113	0	X
19415	LMO4-LIM2 in complex with DEAF-1 (404-418)	522	354	103	0	X
4860	Lck unique SH3	522	436	118	0	X
19489	MSP-P56S DOMAIN/VAPB	522	230	118	0	X
4638	MNEI, A SINGLE CHAIN SWEET PROTEIN	522	0	102	0	X
6727	telomeric repeat-binding domain of Arabidopsis thaliana	521	399	96	0	X
11253	1700011N24Rik protein	521	385	95	0	X
5225	Parvulin 10	521	408	89	0	X
10159	Filamin-B	521	406	86	0	X
16515	mPar3 PDZ2	521	407	108	0	X
11496	the chromodomain of Chp1 in complex with H3K9me3 peptide	521	352	82	0	X
30469	qRRM2 domain of Heterogeneous nuclear ribonucleoprotein H2	521	380	97	0	X
15622	antilipopolysaccharide factor	521	0	90	0	X
15573	Protein LX	521	291	79	0	X
11275	poly (ADP-ribose) polymerase family, member 10 variant	521	411	92	0	X
15332	MEKK3 PB1-cis	521	348	93	0	X
11574	PDZ domain	521	385	94	0	X
34106	NAD(P)(+)--arginine ADP-ribosyltransferase (E.C.2.4.2.31)	521	391	89	0	X
19881	transport protein m	520	370	90	0	X
17904	Iso-1-cytochrome	520	0	0	0	X
7323	Colicin immunity protein IM2	520	301	85	0	X
16921	MinE dimer	520	377	95	0	X
25217	AUX IAA17	520	428	108	0	X
6233	(poly)ubiquitin-binding region of the proteasome subunit S5a	520	417	117	0	X
19714	Transport protein A	520	378	90	0	X
4217	streptomyces metalloproteinase inhibitor	519	191	97	0	X
6700	TBP associated factor 1 (TAF1)	519	600	250	0	X
30066	Putative peptidyl carrier protein	519	382	95	0	X
7093	mMjCM in complex with a TSA	519	279	101	0	X
26807	The Egr-1 zinc-finger protein	519	368	110	0	X
15355	Mitogen-activated protein kinase kinase kinase 3	519	345	92	0	X
10252	thymus high mobility group box protein TOX	519	394	90	0	X
15777	FLNA23	519	374	92	0	X
11414	zinc finger-containing protein 1	519	376	83	0	X
4444	Ferredoxin	519	349	111	0	X
11526	Ump1	519	436	140	0	X
6195	Arath;CDC25	519	392	127	0	X
6464	At1g16640	518	370	99	0	X
15617	alg13	518	668	189	0	X
922	cytochrome c	518	0	0	0	X
11017	TnpE protein	518	386	94	0	X
16766	BLM HRDC domain	518	373	88	0	X
25943	NLRP3 PYD	518	289	84	0	X
10274	Collagen alpha-1(XX) chain	518	401	93	0	X
5386	cNTnC-cTnI(147-162)-Bepridil Ternary Complex	518	281	90	0	X
6189	NSFL1 cofactor p47	517	311	106	0	X
17233	PlyG	517	363	88	0	X
6396	BC029172	517	399	108	0	X
4455	CD58 adhesion domain, 1dCD58	517	375	97	0	X
11236	Myosin light chain kinase, smooth muscle	517	400	96	0	X
18230	S100A1 dimer	517	349	95	0	X
25156	Decorin Binding Protein A	517	427	156	0	X
19044	PMM/PGM_D4	517	409	90	0	X
5786	Neural cadherin	517	416	118	0	X
18179	E60A mutant AGR2	517	424	110	0	X
34246	Penicillin-binding protein 1B (E.C.2.4.1.129,3.4.16.4)	517	408	85	0	X
25560	MRH-GIIb	517	356	96	0	X
16029	At2g32350	517	381	91	0	X
50088	Phenomycin	517	389	99	0	X
11077	HPF	517	312	94	0	X
11137	Vigilin	517	391	86	0	X
5565	porcine MSP	517	394	97	0	X
19167	CsPABP1	516	447	108	0	X
34010	Inner membrane protein YgaP	516	310	0	0	X
18545	C85M_S100A1 dimer	516	385	94	0	X
274	cytochrome c	516	0	0	0	X
4931	DYNEIN	516	259	89	0	X
16682	Q83/[GaIII(Ent)]3-	515	554	137	0	X
17640	EL222 monomer	515	437	167	0	X
5027	human fibronectin EDA	515	392	94	0	X
27497	ZIg10-titin	515	299	94	0	X
5042	Human lymphotactin monomer	515	295	90	0	X
25588	High-affinity calmodulin complexes with vanilloid ligands of TRPV1	515	464	145	0	X
5102	SK2 calmodulin binding domain	515	174	95	0	X
27243	Rpt1/ini1	515	387	86	0	X
4356	HIV-1 protease tethered dimer	515	482	173	0	X
18438	HR7057A	515	372	88	0	X
30471	Titin (E.C.2.7.11.1)	515	299	94	0	X
17518	Starch Binding Domain 1 of beta/alpha-amylase	515	420	112	0	X
15750	Lin0334	515	384	88	0	X
6049	Parvalbumin alpha	515	290	110	0	X
6181	endosomal adaptor protein P14	515	347	116	0	X
19502	dsRBD3	514	284	93	0	X
27593	AmiC N-terminal domain	514	458	104	0	X
36001	Switch-activating protein 1/DNA Complex	514	438	98	0	X	X
6749	mSin3B PAH1 and NRSF/REST	514	364	78	0	X
18811	Spidroin	514	313	112	0	X
5937	PDZ2b domain of PTP-Bas (hPTP1E)	514	318	104	0	X
15204	huamn IgG1 CH3 domain	514	394	110	0	X
15088	ER411	514	287	98	0	X
10325	Filamin-B	513	414	95	0	X
4813	LAC REPRESSOR HP62/DNA COMPLEX	513	169	66	0	X	X
15036	beta-microseminoprotein	513	354	98	0	X
11160	Myeloid/lymphoid or mixed-lineage leukemia protein 3 homolog	513	380	89	0	X
18833	PDZ	513	394	90	0	X
17776	chimeric Af1503 HAMP- EnvZ DHp homodimer; A219F variant	513	387	101	0	X
15814	Domain 5 of Dictyostelium ABP-120	513	407	99	0	X
4086	p16(INK4)/delta_1-8	512	330	123	0	X
5547	streptococcal pyrogenic exotoxin B	512	462	235	0	X
19086	Solution structure of human ribosomal protein P1.P2 heterodimer	512	205	0	0	X
26808	Egr-1 DNA complex	512	366	109	0	X	X
10136	Intersectin 2	512	392	92	0	X
16860	holo acyl carrier protein	512	383	90	0	X
4953	trigger factor PPIase domain	512	416	105	0	X
6709	Dsbe	512	469	127	0	X
18231	S100A1 homodimer	512	380	91	0	X
34263	Calmodulin-1	512	400	95	0	X
18017	RRM	512	366	94	0	X
30298	DNA repair protein REV1 (E.C.2.7.7.-)	512	361	93	0	X
16155	HS00059	512	374	97	0	X
19452	putative thioredoxin (ECH_0218) in the reduced state from Ehrlichia chaffeensis	512	410	109	0	X
4276	Plasminogen	512	81	89	0	X
17828	HOIL-1_Unl	511	391	90	0	X
10324	Filamin-B	511	395	89	0	X
345	cytochrome c	511	0	0	0	X
4932	nonspecific lipid transfer protein	511	0	0	0	X
25165	OR109	511	377	92	0	X
4661	Apoptotic protease activating factor 1	511	141	90	0	X
25654	II-III-VI three-way junction from the VS ribozyme	511	394	51	0			X
10329	Filamin-C	511	381	83	0	X
34299	Type I modular polyketide synthase	511	424	101	0	X
16557	ErR9A	511	285	89	0	X
15939	FOXO3a	511	374	93	0	X
18870	dimerization domain of Aux/IAA transcription factor Ps-IAA4 from pea (Pisum sativum)	511	399	104	0	X
16135	CcdB homodimer	511	450	98	0	X
19203	RRM2 of Homo sapiens splicing factor, arginine/serine-rich 1	511	281	87	0	X
25655	II-III-VI three-way junction from the VS ribozyme in complex with MAGNESIUM	511	394	51	0			X
16658	B1B2	511	351	78	0	X
34190	Protein scribble homolog	510	69	107	0	X
19204	BAF155 SWIRM domain	510	280	86	0	X
17505	human muscle acylphosphatase polypeptide	510	386	103	0	X
30307	Disks large homolog 4	510	313	92	0	X
27396	sMA	510	390	89	0	X
19510	Z-subunit	510	381	103	0	X
18349	RF2209A	510	294	88	0	X
36058	RNA-binding protein Musashi homolog 1	510	403	93	0	X
10271	Collagen alpha-1(XX) chain	510	403	89	0	X
5973	Dengue type 2 virus capsid protein	510	394	104	0	X
19155	CbpAN from Streptococcus pneumoniae	510	356	87	0	X
17685	Zuo1	510	373	93	0	X
6086	recombinant MAGI-1 tandem WW domain region	510	395	98	0	X
6532	apo-S100A13	509	275	90	0	X
26022	translation initiation factor IF1	509	376	83	0	X
30527	De novo Designed Protein Foldit3	509	285	92	0	X
10023	se-heIF2alpha	509	910	282	0	X
4383	wheat ns-LTP	509	0	0	0	X
15689	UBB	509	294	92	0	X
4285	S100A dimer	509	291	99	0	X
25830	Lipid Transfer Protein From Pea Pisum Sativum	509	379	96	0	X
30154	Uncharacterized protein aq_1974	509	385	77	0	X
25530	AQ1974	509	385	77	0	X
4451	N-terminal domain of caspase-activated DNase	509	379	93	0	X
18434	C-terminal domain of human REV1 in complex with DNA-polymerase H (eta)	509	382	97	0	X
34144	Nucleolysin TIA-1 isoform p40	509	383	88	0	X
25664	NESG Target OR34	509	301	85	0	X
15608	VPA0419	509	381	86	0	X
25666	or34	509	301	85	0	X
6844	U1 small nuclear ribonucleoprotein A	509	339	90	0	X
10070	Heterogeneous nuclear ribonucleoprotein H'	509	394	92	0	X
18003	apo-NmtR	509	412	108	0	X
5663	CPI-17(22-120) mutant T38D	508	282	100	0	X
6060	PDZ2 from PTP-BL	508	286	92	0	X
15451	OST domain in GABP alpha	508	397	98	0	X
16490	sf3929	508	369	88	0	X
18563	HR8578K	508	393	92	0	X
15289	THAP domain	508	0	75	0	X
26031	BOLA3 from Homo sapiens	508	351	87	0	X
16596	APLF	508	288	87	0	X
6447	Major vault protein	508	204	110	0	X
17431	outer membrane protein RcsF	508	403	86	0	X
10105	hypothetical protein RAFL11-05-P19	508	377	79	0	X
6933	Neurabin PDZ	507	369	99	0	X
4142	ns-LTP1	507	7	0	0	X
4721	general transcription factor TFIIE-BETA	507	256	87	0	X
11272	KIAA0977 protein	507	384	83	0	X
5844	ZR18	507	389	89	0	X
15836	tt824a	507	374	94	0	X
6884	YflL monomer	507	362	93	0	X
19068	HR2876C	507	373	91	0	X
5738	Tropinin C and I complex	507	263	87	0	X
4154	oxidized putidaredoxin	507	376	96	0	X
34085	Phosphopantetheine-binding protein	507	396	96	0	X
34352	Polyubiquitin-B	506	599	133	0	X
19252	RRM domain of HUMAN RBM7	506	298	80	0	X
26905	P-S23C_tetramer	506	451	149	0	X
18647	mStARD4L124D	506	619	200	0	X
1171	cytochrome c	506	0	0	0	X
16486	GTP pyrophosphokinase	506	368	94	0	X
11280	Synaptic glycoprotein SC2	506	393	82	0	X
30399	ABC transporter ATP-binding/permease protein Rv1747 (E.C.3.6.3.-)	506	417	110	0	X
25955	Solution structure of reduced and zinc-bound RsrA	506	289	93	0	X
30156	Calmodulin, Estrogen receptor peptide	506	437	145	0	X
4796	HYPOTHETICAL PROTEIN MTH1175	506	435	122	0	X
4405	hnRNP K	506	363	92	0	X
26870	nSH3 of CrkII	506	391	91	0	X
34220	MINA-1	506	286	98	0	X
5515	Dishevelled-2 DIX dimer	506	311	85	0	X
4947	C-1027 Apoprotein	505	0	0	0	X
5343	Neocarzinostatin apo-protein	505	386	118	0	X
10040	Growth factor receptor-bound protein 7	505	392	95	0	X
5175	CPI-17 (35-120) deletion mutant	505	168	84	0	X
15632	TCS C-domain	505	407	97	0	X
16118	PFE0790c	505	391	95	0	X
5971	Domain III of the E protein of Langat flavivirus	505	417	114	0	X
25434	OCRE	505	294	93	0	X
5774	Cleavage stimulation Factor 64, RRM domain	505	385	112	0	X
6989	Ribosomal Protein S24E	505	404	92	0	X
3442	hemoglobin A alpha chain	505	0	0	0	X
2065	phospholipid transfer protein	505	0	0	0	X
36085	Anti-CRISPR AcrIIA4	505	360	97	0	X
17519	Starch Binding Domain 2 of beta/alpha-amylase	505	398	112	0	X
10054	UNR protein	505	377	96	0	X
6956	PROTEIN/RNA Complex	505	352	83	0	X		X
7182	Hypothetical protein ycgL	504	422	99	0	X
34036	Non-specific lipid-transfer protein 2	504	362	97	0	X
4992	toluene 4-monooxygenase	504	373	102	0	X
15679	MyBP-C	504	281	85	0	X
16096	DvR115G	504	392	87	0	X
923	cytochrome c	504	0	0	0	X
19633	EF-hand domain from sea urchin polycystin-2	504	386	104	0	X
18522	PICK1 PDZ domain fused to the C10 DAT ligand	504	382	106	0	X
34187	CID, NCBD	504	233	93	0	X
26970	lc-ltp2/DMPG	504	362	97	0	X
15795	MBF1	504	424	107	0	X
26971	lc-ltp2/DHPC	503	362	97	0	X
26618	ORP	503	476	114	0	X
6894	Ral guanine nucleotide dissociation stimulator	503	349	93	0	X
6242	DIPETALIN-I+II	503	362	97	0	X
5529	Monellin chain B and Monellin chain A	503	0	104	0	X
17725	KSR1 CA1-CA1a domain	503	649	156	0	X
349	tissue plasminogen activator	503	0	0	0	X
30404	Gag-Pol polyprotein (E.C.2.7.7.-,3.1.-.-)	503	379	87	0	X
6761	UBL1 domain of TUG	503	378	83	0	X
5783	Arg3Ala beta2-microglobulin	503	0	0	0	X
1170	cytochrome c	503	0	0	0	X
18029	sf-ALR	503	411	107	0	X
15919	RAP74/FCP1 complex	503	345	85	0	X
34049	Gag protein	503	278	93	0	X
19365	Lipid Transfer Protein from Lentil Lens Culinaris	503	271	97	0	X
11135	Vigilin	502	374	83	0	X
25639	LEDGF/p75 IBD in complex with POGZ peptide (1389-1404)	502	345	81	0	X
5536	G88W110 fragment of Staphylococcal Nuclease	502	463	109	0	X
25265	Uncharacterized protein	502	365	86	0	X
18834	PDZ	502	391	87	0	X
4918	Pseudomonas Type IV pilin	502	0	124	0	X
6152	TUMOR INHIBITORY PROTEIN	502	392	101	0	X
16670	NALP1_PYD	502	285	102	0	X
19050	Calmodulin IQ motif complex	502	314	78	0	X
1037	antennepedia	501	0	0	0	X
10213	ATP-dependent RNA helicase DDX50 (E.C.3.6.1.-)	501	387	88	0	X
11302	Zinc finger protein 64, isoforms 1 and 2	501	373	75	0	X
15458	F0	501	365	84	0	X
7223	Interferon, alpha-inducible protein	501	375	86	0	X
30367	CHD4, Bromodomain-containing protein 3	501	354	82	0	X
18735	HR3520O	501	358	86	0	X
6292	Alkaline protease inhibitor	501	410	100	0	X
4579	FYVE domain of EEA1	501	366	98	0	X
4225	Glutaredoxin 3 system	501	0	87	0	X
19646	major factor VIII binding region on von Willebrand factor	501	287	85	0	X
16480	LDLR	501	352	92	0	X
15812	FeoA-like protein	501	368	78	0	X
10282	FLJ21616 protein	501	380	89	0	X
18541	midkine-b	501	331	115	0	X
17578	H/ACA RNP protein Nhp2p-S82W mutant	501	351	114	0	X
11184	RIM binding protein 2	501	378	86	0	X
4085	Sex-lethal protein RNA binding domain 2	500	288	99	0	X
16879	PDZ3_PTP-BL	500	384	100	0	X
16981	SARS Coronavirus Nonstructural Protein Nsp7	500	293	93	0	X
11144	Williams-Beuren syndrome chromosome region 18 protein	500	390	91	0	X
16928	hERG N-terminal domain	500	516	139	0	X
11340	TNF receptor-associated factor 6	500	373	80	0	X
25803	UBL domain of the yeast DNA damage-inducible protein homolog 1	500	360	89	0	X
18504	pfsub2	500	471	118	0	X
15055	N-term of dnaA	500	403	99	0	X
10061	Cypher protein	499	371	94	0	X
11009	Dm LSm16 monomer	499	385	91	0	X
19635	Pseudomonas aeruginosa Tps4 two-partner secretion system	499	388	83	0	X
10072	Heterogeneous nuclear ribonucleoproteins C1/C2	499	376	89	0	X
16191	Monomer	499	348	100	0	X
19707	extracellular sensor domain of DraK histidine kinase	499	361	93	0	X
19000	VV2_0175	499	356	71	0	X
15765	Tetraheme Cytochrome from Shewanella Frigidimarina	499	0	0	0	X
6801	Human SUMO-2 monomer	499	366	92	0	X
11431	HMGB2 B-domain (H22Y)	499	312	71	0	X
4328	N-terminal domain of HsRad51	499	330	106	0	X
6092	PDZ2 from PTP-BL	498	278	105	0	X
10124	MEMBRANE ASSOCIATED GUANYLATE KINASE INVERTED-2 (MAGI-2)	498	366	95	0	X
11262	RIKEN cDNA 4931431F19	498	373	85	0	X
4326	N-Terminal Domain of DNA Polymerase B	498	312	83	0	X
25630	nonspecific lipid transport protein from the dill Anethum graveolens L.	498	361	102	0	X
1672	cytochrome b562	498	0	108	0	X
5707	Bet v 4	498	344	92	0	X
30079	Uncharacterized protein	498	413	91	0	X
26887	HBHA110-199	498	373	84	0	X
16206	RRM DOMAIN OF GW182	498	336	94	0	X
17038	SlR115	498	390	96	0	X
5465	SAPOSIN C	498	380	82	0	X
16403	GLUTAREDOXIN	498	281	90	0	X
26888	HBHA and Heparin	498	373	84	0	X
5836	Yersinia pseudotuberculosis-derived mitogen	497	154	91	0	X
15868	GED monomer	497	380	131	0	X
34488	Moevan	497	428	89	0	X
16214	Zn finger protein YBIL	497	349	91	0	X
7072	GOPC PDZ monomer	497	363	87	0	X
7066	CmtR, Cadmium-responsive transcriptional regulator (E.C.2.7.7.7)	497	309	102	0	X
7243	pMSP	497	322	98	0	X
36064	Metabotropic GABA-B receptor subtype 1, Metabotropic GABA-B receptor subtype 2	497	346	94	0	X
4183	DtxR subunit 3, C-terminal domain	497	392	106	0	X
30050	Serine/threonine-protein kinase B-raf (E.C.2.7.11.1)	497	378	76	0	X
5791	Lactose operon repressor	497	117	69	0	X	X
30048	Serine/threonine-protein kinase B-raf (E.C.2.7.11.1)	497	378	76	0	X
17131	N-terminal domain of fibroin 1	496	458	131	0	X
6516	holo-acyl carrier protein	496	342	93	0	X
16856	acyl_carrier_protein	496	335	90	0	X
15246	PA4090	496	363	88	0	X
6405	CNR-EC1	496	338	86	0	X
16520	hPar3 PDZ2	496	393	99	0	X
4132	human ubiquitin-conjugating enzyme	496	308	142	0	X
6581	Hematopoetic cell kinase SH3 domain - peptide complex	496	358	91	0	X
346	cytochrome c	496	0	0	0	X
19008	SinR_FL	496	489	115	0	X
15275	srp54 of archaeoglobus fulgius	496	397	90	0	X
4886	Azotobacter vinelandii C69A apoflavodoxin II	496	0	146	0	X
6885	Ig1 module	495	0	105	0	X
16387	OR15	495	349	84	0	X
4833	Antifungal protein from Streptomyces tendae Tu901	495	376	97	0	X
18196	proteinase inhibitor	495	451	124	0	X
6922	Vts1:RNA dimer	495	399	89	0	X		X
4084	hnRNP(A1)	495	274	92	0	X
16521	CV_2116	495	371	87	0	X
10195	Vinexin	495	356	82	0	X
30418	Amoebiasin-1	495	294	109	0	X
16624	acyl carrier protein from a fungal type I polyketide synthase	495	365	93	0	X
25740	C-terminal domain of Cdc37 cochaperone	495	351	86	0	X
25098	copper binding protein in the apo form	495	269	84	0	X
18474	pwwp domain of TFIIS2-1	495	295	107	0	X
4863	NUCLEOLIN RBD2	495	252	95	0	X
7159	2SS[6-127, 30-115]	494	0	0	0	X
6240	At5g66040	494	413	106	0	X
11430	HMGB2 B-domain	494	276	75	0	X
18557	Ca2+-bound CaBP7 N-terminal doman	494	377	88	0	X
18673	potential acylphosphatase from Giardia lamblia	494	409	99	0	X
16024	Ga-substituted Ferredoxin	494	0	96	0	X
6212	F6 monomer	494	274	78	0	X
4177	Monocyte chemoattractant protein-3	494	247	81	0	X
7296	H47A cyt c-551	494	0	0	0	X
4463	Ras-binding domain of Byr2	494	217	110	0	X
19217	SmTSP2EC2	494	274	82	0	X
4771	tola3	493	390	91	0	X
34229	Glycosyl hydrolase family 5 cellulase CBM64	493	368	93	0	X
25308	obscurin Ig58	493	376	91	0	X
10088	KIAA0147 protein	493	392	100	0	X
10138	Probable 16S rRNA-processing protein rimM	493	388	82	0	X
19523	N-terminal domain of Bilbo1 from Trypanosoma brucei	493	409	107	0	X
17002	YP_510488.1	493	352	90	0	X
11218	CIDE-N domain of human cell death activator CIDE-A	493	383	89	0	X
34227	Glycosyl hydrolase family 5 cellulase CBM64	493	368	93	0	X
17169	HR4527E	493	283	82	0	X
5892	Sso10b2	493	400	87	0	X
5127	murine mts1	493	412	101	0	X
16994	C-Terminus Calmodulin F92E	492	268	92	0	X
16884	RRM3 monomer	492	395	107	0	X
17034	shPrP(90-232)	492	0	136	0	X
25700	R. palustris CsgH	492	399	99	0	X
11426	Probable SecDF protein-export membrane protein	492	380	96	0	X
6583	S100A1 dimer	492	285	91	0	X
11424	tight junction protein ZO-1	492	368	86	0	X
6962	10:0 ACP from spinach	492	343	86	0	X
11321	RING finger protein 31	492	355	80	0	X
4804	bovine ferrous cytochrome b5-N17D	492	373	88	0	X
5131	Second PDZ domain of PTP-BL	492	355	102	0	X
17138	MBD2/p66-alpha complex	492	357	74	0	X
16998	HR4653B	492	286	82	0	X
16871	ZO-1 PDZ2	492	351	88	0	X
25407	DNA complex of the C-Terminal domain of MvaT	492	163	51	0	X	X
11428	a disulfide-deficient mutant of the starch-binding domain of glucoamylase	492	0	109	0	X
390	calbindin	492	0	0	0	X
4803	bovine ferrous cytochrome b5	492	373	88	0	X
18145	OR135	492	351	85	0	X
4035	Regulatory protein E2	491	296	84	0	X
34330	Transcription intermediary factor 1-beta (E.C.2.3.2.27)	491	369	90	0	X
25428	acidic domain of SYNCRIP (hnRNPQ)	491	339	92	0	X
7382	Nucleolar_protein_3	491	317	88	0	X
15841	Protein FeoA	491	363	82	0	X
19792	RBMX	491	366	92	0	X
15110	Lymphotactin	491	377	88	0	X
18977	Phosphate-bound TpbA	491	298	166	0	X
16593	F98N-fdx	491	33	79	0	X
4961	YopH complex	491	479	123	0	X
16201	octanoyl ACP	491	362	92	0	X
5561	Activation domain of human procarboxipeptidase A2	491	0	87	0	X
17104	YP_001336205	491	299	87	0	X
19685	RRM3 intermediate state	490	396	107	0	X
17271	complex of GPS2 53-90 and SMRT 167-207	490	232	90	0	X
7291	Coxsackievirus and Adenovirus receptor	490	338	83	0	X
18041	EDC3-LSm domain	490	386	93	0	X
15770	CarS1	490	371	78	0	X
16652	asl3597	490	370	79	0	X
34005	C-X-C motif chemokine 13	490	313	81	0	X
6193	PSD-95 PDZ3	490	328	118	0	X
34350	Gallinacin-11	490	0	74	0	X
18755	Mdm2 (6-125) with Pip-1	489	405	113	0	X
10211	Tyrosine-protein kinase ITK/TSK (E.C.2.7.10.2)	489	365	86	0	X
15511	C-terminal dimerization domain of SARS coronavirus nucleocapsid protein	489	347	123	0	X
15549	c6orf115	489	363	90	0	X
19427	BldD-CTD monomer	489	368	88	0	X
15152	HypC	489	362	100	0	X
18707	TamA POTRA domain I	489	283	77	0	X
5069	hen egg white lysozyme	489	0	0	0	X
15371	antimicrobial resistance protein	489	368	95	0	X
4232	Calcium binding subunit of troponin, TnC monomer	489	172	96	0	X
30129	De novo Beta Sheet Design Protein OR485	489	337	80	0	X
17862	Staphylococcus aureus IsdH linker domain	488	357	82	0	X
27019	RXFP2-LDLa-linker-GB1	488	424	119	0	X
28012	HFAT-892	488	451	138	0	X
15163	LARG PDZ domain complex	488	251	83	0	X
19989	N-terminal Region of CCR3 Bound to CCL11/Eotaxin-1	488	225	74	0	X
6385	human pleckstrin Dep domain	488	328	112	0	X
6100	rmMBP	488	436	154	0	X
5805	Rpp29	488	357	84	0	X
11417	DnaJ homolog subfamily B member 8	488	373	87	0	X
11285	peroxisomal biogenesis factor 13	488	343	86	0	X
247	calbindin	488	0	0	0	X
17594	hs00411	488	356	96	0	X
18018	YP_916642.1	487	360	98	0	X
19860	a ribosomal protein	487	360	83	0	X
4368	A35T vnd/NK2 mutant homeodomain	487	265	76	0	X	X
4774	PHOSPHOCARRIER PROTEIN HPR	487	0	0	0	X
16340	calcium-loaded Calbindin D9K P43G	487	386	92	0	X
5704	mth677	487	414	93	0	X
16927	protein_sur18c	487	386	96	0	X
27197	Dm. Par3 PDZ1 domain	487	374	85	0	X
15449	ACP domain from rat	487	283	88	0	X
6436	XC 4149	487	335	102	0	X
7266	NE1680	487	362	87	0	X
6895	PROTEIN/RNA Complex	486	234	84	0	X		X
34188	CID, NCBD	486	221	87	0	X
327	calbindin	486	0	0	0	X
25497	RRM1 domain of Hrb1	486	371	89	0	X
6730	Human Filamin A domain 17	486	371	94	0	X
4972	Crh	486	354	91	0	X
5388	Gads C-terminal SH3 domain	486	355	87	0	X
11473	CERT PH domain	486	363	98	0	X
5920	PrrA C-terminal domain	486	344	89	0	X
27626	M7A SAH	486	391	83	0	X
4850	GLUTAREDOXIN 3	486	0	81	0	X
326	calbindin	486	0	0	0	X
11400	Arginine/serine-rich splicing factor 10	486	365	84	0	X
19362	STIM1 CC1-CC2 homodimer	485	357	78	0	X
17766	E133-222	485	266	89	0	X
15601	Atra-PBP1	485	409	135	0	X
16203	3,5-dioxohexyl ACP	485	362	92	0	X
6605	NMR ensemble Ada Protein	485	438	142	0	X	X
15769	Ubiquitin like domain of Dsk2p	485	357	82	0	X
11266	Np95-like ring finger protein, isoform a	485	368	86	0	X
18297	Uba3	485	367	82	0	X
6888	Neocarzinostatin apo-protein with Flavone	485	0	117	0	X
25702	reduced form of thioredoxin 1 from Sacharomyces cerevisiae	485	380	102	0	X
6968	intrinsically disordered alpha-synuclein	485	401	139	0	X
4978	B0 isoform of the 3rd(C-terminal) globular domain of agrin	484	548	193	0	X
4403	Polyomavirus J domain	484	366	81	0	X
16527	Modified Fatty Acid Synthase Acyl Carrier Protein	484	260	81	0	X
11252	HRDC domain from Bloom syndrome protein	484	295	88	0	X
6754	PDZ domain of alpha-syntrophin	484	266	84	0	X
15567	PDZ domain	484	340	90	0	X
16909	IRTKS-SH3 and EspFu-R47 complex	484	285	71	0	X
25287	5-phenyl-3-oxo-pentyl Actinorhodin Acyl Carrier Protein from Streptomyces coelicolor	484	355	90	0	X
25786	holo ArCP from yersiniabactin synthetase	484	371	81	0	X
2151	glutaredoxin	484	0	0	0	X
7104	F3 module 2 of NCAM	484	0	95	0	X
16199	butyryl-ACP	483	361	92	0	X
17680	CBLB-pY-H-RING	483	351	84	0	X
7218	monomer	483	356	127	0	X
15337	SO0334	483	360	76	0	X
34301	Type I modular polyketide synthase	483	396	94	0	X
17641	Yeast_frataxin_(Yfh1)	483	236	104	0	X
5952	E2C dimer	483	374	81	0	X
5970	50S Ribosomal Protein L18	483	245	114	0	X
2868	hemoglobin A alpha chain	483	0	0	0	X
6999	KorA dimer	483	419	107	0	X
16202	3-oxo-butyl-ACP	483	355	92	0	X
2278	putidaredoxin	483	0	0	0	X
6254	HPr monomer	482	269	93	0	X
17629	Nbp2_SH3 and Ste20_peptide	482	280	71	0	X
6359	YGGX	482	352	99	0	X
19479	Active Site Mutant Pepitdyl Carrier Protein	482	292	79	0	X
979	carboxypeptidase B	482	0	0	0	X
4181	ferredoxin	482	0	0	0	X
16802	CcmH	482	323	73	0	X
17777	Solution structure of the N-terminal domain of the Shigella type III secretion protein MxiG	482	148	98	0	X
18468	PaT415	482	370	76	0	X
30047	Serine/threonine-protein kinase B-raf (E.C.2.7.11.1)	482	365	76	0	X
16842	PpcA	482	0	73	0	X
17407	homeodomain	482	300	88	0	X
11226	MAGUK p55 subfamily member 2	481	365	87	0	X
25483	Metal Binding of Glutaredoxins	481	361	88	0	X
30231	Adrenodoxin	481	443	107	0	X
17175	SP_0782 homodimer	481	358	92	0	X
16525	Modified Fatty Acid Synthase Acyl Carrier Protein	481	269	82	0	X
25675	N-TERMINAL DOMAIN OF TDP-43	481	351	93	0	X
15971	DANIO RERIO RAP55	481	346	80	0	X
25372	CG KIX	481	338	82	0	X
16524	Modified Fatty Acid Synthase Acyl Carrier Protein	481	269	82	0	X
15587	ubiquitin-related modifier	481	397	98	0	X
17017	MmT2A	481	346	87	0	X
19910	P22S mutant of N-terminal CS domain of human Shq1	481	366	90	0	X
17235	ACP18	481	370	94	0	X
16200	hexanoyl ACP	481	355	91	0	X
25787	salicylate-loaded ArCP from yersiniabactin synthetase	481	345	81	0	X
18664	NSD3	481	331	91	0	X
5696	ZASP-PDZ Domain	481	335	92	0	X
2281	fibronectin	480	0	0	0	X
5988	alpha-bungarotoxin/ nicotinic acetylcholine receptor mimotope complex	480	0	0	0	X
16526	Modified Fatty Acid Synthase Acyl Carrier Protein	480	248	82	0	X
6259	GatB monomer	480	412	99	0	X
19007	MinC N-terminal monomer	480	396	105	0	X
4869	NON HISTONE PROTEIN 6 A	480	249	83	0	X
25065	PCP7T holo form	480	196	74	0	X
6929	NeT3 monomer	480	342	79	0	X
16109	Herpud2_9_85	480	349	73	0	X
27055	RBM10_RRM2	480	291	91	0	X
34048	Fibronectin	480	280	90	0	X
17068	Yeast frataxin	480	210	92	0	X
5467	ADAP	480	345	87	0	X
5233	ASC2	479	399	128	0	X
19622	PetF monomer	479	371	88	0	X
19525	Solution structure of the Nt. GR-RBP1 RRM domain	479	362	93	0	X
15796	E2-c-Cbl	479	348	82	0	X
15150	ZO2PDZ2 homodimer	479	343	86	0	X
25447	KstB-PCP(apo)	479	273	92	0	X
19985	PpcD	479	205	78	0	X
16196	acetyl Actinorhodin Acyl Carrier	479	355	92	0	X
7260	YjcQ protein	479	368	89	0	X
16623	E4B	479	210	76	0	X
18342	Get5_UBL domain	479	383	82	0	X
18486	Reduced Sulfiredoxin	479	356	108	0	X
26901	USP20	479	389	95	0	X
16528	Modified Fatty Acid Synthase Acyl Carrier Protein	479	261	82	0	X
5155	p47 protein	479	174	86	0	X
15296	S100A1-RyR	479	371	89	0	X
6433	Entamoeba histolytica calcium binding protein 2	479	373	123	0	X
6687	N-terminal domain of human centrin 2	478	0	80	0	X
7110	CBP BROMODOMAIN	478	400	103	0	X
4925	N-Ada10	478	85	90	0	X
7261	Hypothetical protein ykfF	478	349	95	0	X
11075	kp60	478	279	85	0	X
16338	CG11242	478	373	96	0	X
16197	malonyl ACP	478	362	92	0	X
15352	rpt8 dimer	478	357	87	0	X
5601	rubredoxin	478	550	159	0	X
34081	TAR DNA-binding protein 43	478	0	1	0	X
6324	hypothetical protein TM0979	478	281	87	0	X
15194	small ubiquitin-like modifier	478	375	99	0	X
4739	Calcium Vector Protein	478	0	80	0	X
4271	Calcium binding protein from Entamoeba Histolytica	478	380	131	0	X
25510	AIM2 PYD from Mus musculus	477	378	94	0	X
26012	N-terminal Domain of Human Cdc37	477	501	117	0	X
15060	monomeric DLC2 SAM domain	477	321	94	0	X
18589	Cbp2	477	395	89	0	X
25657	Proteasome protein fragment	477	304	63	0	X
34018	Lactococcin-A immunity protein	476	394	98	0	X
6035	DNA ligase III alpha 1-117	476	379	108	0	X
16608	Proinsulin	476	271	83	0	X
5387	ubiquitin	476	340	82	0	X
18906	CHD4	476	306	74	0	X
16402	human Ataxin-7-L3	476	328	91	0	X
4445	HRDC domain	476	289	83	0	X
6089	Lipid transfer protein 1	476	0	0	0	X
7202	dSUMO	476	356	90	0	X
6800	Domain III of the E protein of Langat flavivirus	476	383	107	0	X
6401	R55F	476	297	90	0	X
30515	Lanmodulin	476	300	100	0	X
17952	C5 protein monomer	476	312	116	0	X
18283	YmgD dimer	476	342	96	0	X
2030	phosphocarrier protein HPr	475	0	0	0	X
6469	FACT HMG	475	305	82	0	X
25874	L6F polypeptide	475	0	73	0	X
16591	LAIR-1	475	0	97	0	X
15658	actinorhodin polyketide acyl carrier protein	475	362	92	0	X
6196	Arath; CDC25; CYS131SER mutant	475	388	124	0	X
2224	gene V protein	475	0	0	0	X
5772	SlxA_CBM13	475	481	149	0	X
27168	gb1ent-dnapkfatc	475	288	105	0	X
25883	DD homodimer	475	284	96	0	X
6512	Vaccinia Virus envelope protein A27L	474	487	124	0	X
19939	MBD4 methyl-cytosine binding domain bound to methylated DNA	474	291	75	0	X	X
4603	APO-D-ALANYL CARRIER PROTEIN	474	349	88	0	X
16770	PrgI mutant	474	335	89	0	X
6982	TA0895	474	277	85	0	X
5622	Thioredoxin-like Protein from Methanobacterium Thermoautotrophicum	474	241	80	0	X
17858	NAB2_404-483	474	268	80	0	X
17016	CARMIL CAH3a/b domain bound to capping protein	474	1504	474	0	X
5204	Calreticulin P-domain fragment 189-261	474	258	70	0	X
19539	acp5b	473	357	93	0	X
18101	S100A1	473	371	90	0	X
4663	protein (1D8 UBIQUITIN) mutant (I3L,I13L,L15V,V17L,I23V,V26L,I61L,L67I)	473	273	84	0	X
7175	YorP	473	362	81	0	X
4354	E. coli maltose binding protein	472	1198	330	0	X
5808	PAH2-SID24 complex	472	269	90	0	X
16425	rna15, hrp1, anchor RNA 3' processing ternary complex	472	280	88	0	X		X
16571	ML4	472	414	93	0	X
17995	NE2163	472	354	86	0	X
5499	AMPA receptor interacting protein	472	369	84	0	X
16555	CA-CTD dimer	472	272	91	0	X
30210	Muscleblind-like protein 1/RNA Complex	472	300	85	0	X		X
17967	N-terminal domain of HPV16 E6 oncoprotein	472	264	83	0	X
6498	Siah-Interacting Protein (Residues 1-77)	471	335	77	0	X
18714	HR7907F	471	332	83	0	X
5906	dopamine and cAMP-regulated phosphoprotein, Mr. 32,000	471	451	98	0	X
4819	Yhh monomer	471	379	72	0	X
17948	Hsp12	471	223	102	0	X
18812	DUF3349	471	376	96	0	X
25455	cytochrome OmcF	471	235	86	0	X
25801	UBL domain of the human DNA damage-inducible protein homolog 2	471	332	83	0	X
10108	PDI-like Hypothetical Protein At1g60420	471	353	80	0	X
27433	Double knot toxin	471	347	75	0	X
4982	Apo-S100A1(aa) dimer	471	364	93	0	X
15465	Ph1500N	471	345	70	0	X
17553	acyl CoA binding protein	471	367	97	0	X
19960	Human Chemokine CCL19	471	267	77	0	X
6631	Splicing factor 3 subunit 1	471	365	91	0	X
4069	Long-[Arg-3]-Insulin-Like Growth Factor-I	471	0	76	0	X
5018	TUMOR NECROSIS FACTOR RECEPTOR-1	471	431	98	0	X
2198	plastocyanin	470	0	0	0	X
17769	Ubiquitin	470	348	83	0	X
6224	SufA	470	433	120	0	X
36011	PfSUMO	470	355	93	0	X
11317	Tripartite motif protein 32	470	352	81	0	X
30693	Ubiquitin	470	344	83	0	X
26775	PfSUMO	470	355	93	0	X
17616	plasmodium falciparum ribosomal lateral stalk	470	342	124	0	X
17691	Sox2	470	370	80	0	X
11195	Rho guanine nucleotide exchange factor 11	470	357	83	0	X
4566	bovine adrenodoxin	470	415	106	0	X
16083	MrR121A	470	370	100	0	X
18565	MLD PMT	470	366	81	0	X
17033	Nonsense mRNA reducing factor	470	288	75	0	X
5537	Human FF domain	470	295	77	0	X
15023	CarA(Nter)	469	0	77	0	X
15258	VP2129	469	348	86	0	X
34072	Putative metallothionein	469	240	99	0	X
7304	pMSP	469	0	0	0	X
5392	Upstream binding factor 1	469	363	89	0	X
5539	Xis C28S	469	309	72	0	X
17968	HPV16_E6	469	259	83	0	X
4153	Retinoid-X-Receptor -alpha DNA Binding domain	469	254	84	0	X
34004	SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1	468	273	77	0	X
18695	KIX domain complex (3)	468	323	92	0	X
10095	40S ribosomal protein S3	468	362	81	0	X
11505	Alternative structure of Ubiquitin	468	344	79	0	X
16640	HR3102A	468	259	84	0	X
17036	pja1 zinc finger domain	468	277	73	0	X
15821	MJ1198	468	346	75	0	X
16397	human ataxin-7	468	0	0	0	X
7034	hZHX1-ZNF	468	309	86	0	X
11279	Ubiquitin-like protein 4A	467	347	81	0	X
18322	reduced_Mrx1	467	370	90	0	X
6400	wt ma	467	388	96	0	X
294	cytochrome b5	467	0	0	0	X
15203	CPE0013 monomer	467	347	80	0	X
4948	A-BUNGAROTOXIN/ NICOTINIC ACETILCHOLINE RECEPTOR MIMOTOPE COMPLEX	467	0	0	0	X
17864	CTD monomer	467	356	92	0	X
19641	3rCWP7D	467	322	107	0	X
30171	Reverse transcriptase	467	276	86	0	X
17835	TDRD7	467	357	84	0	X
25587	Miz-1 zinc fingers 2 to 4	466	395	99	0	X
15746	BPP3783_115-120	466	359	94	0	X
6010	tm0979	466	365	85	0	X
11263	HLA-B associated transcript-3 isoform b	466	350	82	0	X
34286	Lipase chaperone	466	326	71	0	X
19146	RING domain of E3 ubiquitin ligase Doa10	466	349	83	0	X
11547	the pure alternative state of ubiquitin	466	337	79	0	X
5468	6-phosphogluconolactonase	466	748	240	0	X
4678	mtrpbH	466	269	70	0	X
27472	K-Ras4B	466	505	126	0	X
27767	Gp46 monomer	466	355	76	0	X
4493	Ubiquitin core mutant 1D7	466	273	84	0	X
491	glutaredoxin	466	0	0	0	X
34076	domain-swapped metallothionein from Littorina Littorea	466	238	99	0	X
4567	catalytic domain of yUBC1	466	463	130	0	X
15990	RNAP monomer	466	254	72	0	X
15743	Hahellin	466	341	92	0	X
4852	vMIP-II monomer	466	0	73	0	X
18967	E6	465	337	80	0	X
5187	TraR monomer	465	389	92	0	X
5975	N-terminal domain of trout cardiac troponin C	465	195	93	0	X
16313	AR3436A	465	366	86	0	X
18909	hs00507	465	332	74	0	X
25088	Ddi1UBL	465	331	84	0	X
4222	monellin	465	0	86	0	X
4227	DNAJ	465	341	81	0	X
4664	lipocalin Q83	465	419	138	0	X
6019	P62A dimer	465	317	92	0	X
36096	Small ubiquitin-related modifier	465	364	88	0	X
19703	Iron-sulfur cluster binding protein from Ehrlichia chaffeensis	465	393	98	0	X
25237	MBP	464	1137	340	0	X
7229	Small inducible cytokine B14	464	325	71	0	X
6268	CBP TAZ1	464	284	95	0	X
11158	Transcription factor SOX-17	464	331	77	0	X
25446	KstB-PCP (holo)	464	233	89	0	X
16692	BvR106A	464	247	77	0	X
5337	human adrenodoxin	464	374	92	0	X
4602	CYTOCHROME B5	464	0	70	0	X
17491	L4C	464	389	126	0	X
4593	Rous sarcoma virus capsid protein: C-terminal domain	464	252	80	0	X
18134	FIRST SAM DOMAIN OF ODIN	464	244	81	0	X
4396	Nematode Anticoagulant Protein c2	463	22	85	0	X
16908	Ubiquitin like domain of UBLCP1	463	258	77	0	X
17226	trHbN cyanomet	463	446	123	0	X
19947	Bitistatin_A	463	201	77	0	X
16198	Tim23	463	359	90	0	X
5710	Mth11 free in solution	463	288	86	0	X
19536	acp5a	463	364	88	0	X
18844	UBLCP1	463	258	77	0	X
2060	phosphocarrier protein HPr	463	0	82	0	X
19869	ZapA homodimer	463	266	74	0	X
19634	CR4/5 domain of medaka telomerase RNA	463	335	65	0			X
17805	single polypeptide chain	463	329	77	0	X
34176	Stromal cell-derived factor 1	463	373	103	0	X
6777	beta PIX-SH3 complexed with an atypical peptide from alpha-PAK	463	213	76	0	X
15566	BRCT domain	463	320	94	0	X
11161	Tripartite motif-containing protein 30	463	347	81	0	X
4316	subunit c of ATP synthase	463	269	85	0	X
18325	oxidized_Mrx1	462	368	88	0	X
6398	Sulfolobus solfataricus acylphosphatase	462	0	100	0	X
16899	UBL domain of UBLCP1, I5M	462	340	76	0	X
15531	rhGM-CSF	462	474	122	0	X
34046	Decoration protein	462	381	91	0	X
17855	NHP1	462	386	89	0	X
17827	k2-n	461	398	103	0	X
5827	Horse cytochrome c	461	421	98	0	X
5784	His31Tyrbeta2-microglobulin	461	0	0	0	X
15839	yiiF	461	261	84	0	X
17067	Complex hMia40-hCox17	461	526	148	0	X
5328	DNA Ligase BRCT domain	461	370	87	0	X
25925	rv3053c from Mycobacterium tuberculosis in the oxidized state	461	360	88	0	X
6355	SE0936	461	348	82	0	X
133	ribonuclease T1	461	0	0	0	X
25277	lantibiotic self-resistance lipoprotein MlbQ from Microbispora ATCC PTA-5024	461	347	82	0	X
16681	HR5531E	461	350	73	0	X
7364	AG_Endproducts	460	401	82	0	X
17704	RAGEC2-S100A13 tetrameric complex	460	349	74	0	X
5503	Human centrin2	460	0	0	0	X
6781	ada2 swirm domain polypeptide	460	282	83	0	X
25797	cardiac troponin C	460	281	91	0	X
6113	second PDZ domain of X11alpha	460	339	89	0	X
27240	ROR1 Kringle monomer	460	331	84	0	X
27412	dASCIZ LC8 binding domain	460	362	133	0	X
19482	Regulatory Domain of Tyrosine Hydroxylase	460	358	88	0	X
17456	THAP domain of human THAP11	460	342	76	0	X
6452	CLP-36 PDZ	459	317	93	0	X
36045	Acid stress chaperone HdeA	459	345	92	0	X
19963	Bitistatin_B	459	172	86	0	X
16103	FAIM-CTD monomer	459	364	96	0	X
6134	d27gg	459	427	103	0	X
6407	HPV16 E6 C-terminal domain	459	0	78	0	X
19322	LTBP1-cb14TB3	459	0	236	0	X
11429	HMGB2 A-domain	459	220	77	0	X
11082	DDEF1 SH3:APC SAMP1 complex	459	341	83	0	X
2049	acyl-coenzyme A binding protein	459	0	0	0	X
25976	fungal hydrophobin	458	379	91	0	X
16101	AR3445A	458	342	76	0	X
25008	Phosphotyrosine binding domain	458	63	89	0	X
16390	ubiquilin 1	458	328	79	0	X
4943	Chicken Egg White Lysozyme	458	0	0	0	X
18469	YdbC	458	338	77	0	X
5796	MPN156	458	307	96	0	X
5496	ubiquitin-like domain in murine PARKIN	458	333	78	0	X
15300	THAP domain	458	177	61	0	X
18818	human S100A14	458	417	102	0	X
68	ubiquitin	458	0	0	0	X
27467	FAT10 C-terminal domain	458	266	83	0	X
26647	p65 DBD	457	296	151	0	X
18015	PITX2	457	225	89	0	X	X
10337	Suppressor of T-cell receptor signaling 1	457	356	79	0	X
15659	actinorhodin apo acyl carrier protein	457	362	92	0	X
16914	UBX domain of human UBXD2	457	311	79	0	X
25606	AR-4Q	457	375	133	0	X
15377	DESR1	457	317	76	0	X
17936	dADAR-dsRBD1	457	263	75	0	X
11322	KIAA1915 protein	457	329	80	0	X
30293	Yeast dnaJ protein 1	457	340	70	0	X
11163	Tripartite motif-containing protein 5	457	337	73	0	X
10285	Alpha-fetoprotein enhancer binding protein	457	332	76	0	X
5664	oxytetracycline acyl carrier protein	457	0	95	0	X
17062	hPgn rK3	457	0	96	0	X
280	interleukin 8	456	0	0	0	X
10118	PH0471	456	270	74	0	X
25493	Human Med26 N-Terminal Domain (1-92)	456	402	95	0	X
17497	SNX17-PX	456	370	105	0	X
15776	Rpp21-Zn	456	370	75	0	X
25002	LysM region of the E. coli Intimin periplasmic domain	456	315	82	0	X
15090	str109 homodimer	456	326	86	0	X
10248	HMG-BOX transcription factor BBX	456	334	68	0	X
16549	Mus81_NTD	456	258	73	0	X
16996	human Rad51D N	455	333	80	0	X
18529	K-Ras-GDP	455	489	161	0	X
10047	Homeobox leucine zipper protein Homez	455	330	73	0	X
19002	Core Domain (11-85) of the Murine Norovirus VPg protein	455	330	75	0	X
25284	3,7-dioxo-octyl Actinorhodin Acyl Carrier Protein	455	339	86	0	X
4174	N-terminal domain of calmodulin	455	0	84	0	X
6976	Hypothetical UPF0346 protein yozE	455	355	80	0	X
15903	Rv0008c monomer	454	419	128	0	X
6270	chPrP (25-242)	454	160	82	0	X
11051	0SS-variant	454	0	125	0	X
15346	YejL homodimer	454	360	94	0	X
18620	RRM domain	454	430	102	0	X
15314	HNS79c_monomer	454	303	74	0	X
4450	Inhibitory Prodomain of Furin	454	274	85	0	X
17026	BtR375	454	334	91	0	X
5661	PKC iota (V1 domain)	454	320	102	0	X
19053	FimA wt	454	0	0	0	X
25271	PPIase	454	353	96	0	X
25573	Myristylated Feline Immunodeficiency Virus Matrix Protein	454	321	120	0	X
17620	D2 domain of human fibroblast growth factor receptor 4	454	343	87	0	X
19436	murine norovirus NS1/2 D94E mutant	453	307	75	0	X
15013	SPCp41 monomer	453	282	78	0	X
25732	PetP	453	347	83	0	X
15999	HTH_3	453	338	83	0	X
1719	cytochrome c	453	0	0	0	X
4278	Long-[L60]-IGF-I	453	0	82	0	X
5304	mono-heme c-type cytochrome ScyA	453	0	82	0	X
5077	M156R	453	374	83	0	X
18331	MS1	453	338	83	0	X
2039	gene V protein	453	0	0	0	X
4789	TAZ2 domain of CBP	452	354	103	0	X
5255	WmKT	452	0	0	0	X
5475	plastocyanin synechocistys PCC 6803	452	0	0	0	X
447	2Fe-2S ferredoxin	452	358	97	0	X
11342	RING-box protein 2	452	329	91	0	X
25677	CBX8 in complex with AF9	452	406	88	0	X
18511	HR8578D	452	332	79	0	X
7366	Periplasmic protein	452	261	77	0	X
16262	p68N	452	235	83	0	X
17025	BvR153	452	337	76	0	X
15670	TAF3-PHD finger	452	247	73	0	X
15358	caenopore5 monomer	452	244	84	0	X
15732	jarid1B-bright	452	270	92	0	X
15330	caenopore5 monomer	452	247	84	0	X
17866	S100P	452	327	85	0	X
30505	Hydrophobin	452	365	88	0	X
6587	apolipoprotein A-I	451	466	230	0	X
19297	holo DC-SIGNR CRD	451	431	116	0	X
6769	NE2066	451	348	83	0	X
19942	terminal Ig-like domain from Leptospira interrogans LigB	451	368	91	0	X
25886	acyl carrier protein LipD	451	375	85	0	X
4917	Lipid Transfer Protein	451	0	0	0	X
34141	Breast cancer anti-estrogen resistance 1	451	336	80	0	X
6321	delta25-PYP	451	184	106	0	X
4385	elongation factor-1beta	451	340	85	0	X
18488	Oxydizied Sulfiredoxin C106V	451	435	97	0	X
17206	VHD monomer	451	331	68	0	X
5616	WW domain pair of S.cerevisiae pre-mRNA processing protein 40	451	280	85	0	X
34175	Lipase chaperone	451	314	68	0	X
34146	Dickkopf-related protein 4	450	308	76	0	X
15444	DNA binding domain of NgTRF1 monomer	450	423	114	0	X
10045	ZF-HD homeobox family protein	450	326	82	0	X
15456	dimer	450	345	86	0	X
30494	Uncharacterized protein PF2048.1	450	263	70	0	X
15970	TRAL-TRAILER HITCH	450	327	71	0	X
19803	Anthrax Lethal Factor N-terminal	450	575	217	0	X
11502	Cu(I) bound D1CCS	449	334	94	0	X
17355	meACP	449	304	94	0	X
6367	Hypothetical protein yhgG	449	321	80	0	X
6026	Oxidized Human Ferredoxin	449	401	16	0	X
25649	Human Brd4 ET domain in complex with MLV Integrase C-term	449	354	86	0	X
18819	ApoAcpP-3	449	349	81	0	X
4115	IM9 E9-complex	449	254	81	0	X
34029	Matrix protein p10	449	420	116	0	X
15596	Human macrophage inflammatory protein 3alpha	449	0	0	0	X
15448	ClpS monomer	449	368	95	0	X
17092	DNA-binding protein SATB1	449	326	79	0	X
15655	CopK	449	301	77	0	X
4425	ACETYL-COA CARBOXYLASE	449	267	82	0	X
16519	SDF1a H25R	449	306	75	0	X
25895	PARP-1_WGR_free	449	238	119	0	X
4989	B. subtilis ACYL CARRIER PROTEIN	449	259	84	0	X
25745	N-terminal domain of the metalloprotease PrtV from Vibrio cholerae	449	357	79	0	X
4171	0.5b antibody Fv - V3 antigen	449	431	208	0	X
25449	RNA recognition motif of a cyclophilin33 - like protein from Plasmodium falciparum	449	366	97	0	X
25543	human Myosin VI isoform3 (998-1071)	449	294	82	0	X
25778	spider toxin U4-hexatoxin-Hi1a	448	322	80	0	X
25848	spider toxin pi-hexatoxin-Hi1a	448	299	75	0	X
16795	KpR49	448	251	77	0	X
27667	catalytic and ATP-binding domain of HK853	448	330	138	0	X
7118	Neurabin SAM domain monomer	448	303	83	0	X
5103	s100p dimer	448	324	91	0	X
18090	DP1	448	321	76	0	X
4317	NS1(1-73) dimer	448	303	85	0	X
6338	At1g77540	447	367	95	0	X
18302	calcium-bound CaM N-terminal domain in a complex	447	364	95	0	X
27693	activated HdeA	447	344	84	0	X
16143	CXCL12/SDF1-alpha	447	307	72	0	X
16142	CXCL12/SDF1-alpha	447	307	73	0	X
25377	MDMX-P53	447	0	0	0	X
16986	DP1 subunit	447	183	72	0	X
5662	CPI-17(22-120)	447	183	99	0	X
5022	UMUD PROTEIN	447	290	106	0	X
11250	nuclear valocine containing protein like 2 (NVL2)	447	265	77	0	X
7179	Dispersin, Aap	447	380	96	0	X
6718	DHPs74e protein	447	290	70	0	X
34055	Variant surface glycoprotein MITAT 1.1	447	0	81	0	X
25226	cis-(Tyr39-Pro40) form of the Human Secreted Ly-6/uPAR Related Protein-1 (SLURP-1)	447	247	82	0	X
17593	TM1_TM2 in TFE:water	447	313	89	0	X
34243	von Willebrand factor	446	318	84	0	X
19632	hypothetical protein BACUNI_03114 from Bacteroides uniformis ATCC 8492	446	241	73	0	X
6599	Biotin Carboxyl Carrier Protein	446	314	77	0	X
5298	PPIase monomer	446	187	98	0	X
7102	Designed Protein AYE	446	234	73	0	X
16145	CXCL12/SDF1-alpha	446	307	72	0	X
15166	pac1r/pacap	446	380	83	0	X
6689	human centrin 1	445	0	82	0	X
1875	micrococcal nuclease	445	270	1	0	X
5695	YHR087W gene product	445	355	78	0	X
11313	Zinc finger protein 183-like 1	445	330	72	0	X
4994	C domain of Cardiac Troponin C. complexed to EMD 57033	445	217	74	0	X
17266	SilB(440-521)	445	335	89	0	X
19811	a computational designed protein based on template of human erythrocytic ubiquitin	445	264	76	0	X
30531	Non-structural protein 3	445	324	85	0	X
4023	staphylococcal protein A Z domain	445	329	82	0	X
26637	dengue virus NS4B N-terminal 125 amino acids	445	505	119	0	X
4401	skeletal N-troponin C	444	324	88	0	X
5030	Honeybee antennal specific Protein 2	444	361	119	0	X
5653	MIH	444	343	93	0	X
7084	Dr13312	444	347	77	0	X
16926	E._coli_lipoprotein	444	236	92	0	X
7151	DLC2-SAM monomer	444	318	80	0	X
18955	STRUCTURE OF NAB2P TANDEM ZINC FINGER 12	444	313	74	0	X
36136	dRafX6	444	261	69	0	X
5633	MOLT-INHIBITING HORMONE	444	343	93	0	X
4516	HUMAN PHOSPHATASE HPTP1E/PEPTIDE	444	208	89	0	X
15269	ATC2521	444	335	77	0	X
17574	yeast RNase III dsRBD complex with a non-canonical RNA substrate	444	326	87	0	X
25454	bacterial chaperone	444	337	86	0	X
25894	PARP-1_F1F2F3-WGR-DNA_complex	444	0	444	0	X	X
11052	2SS(6-127_64-80)	443	0	123	0	X
17673	TDRD7	443	306	78	0	X
15564	subunit c of E. coli F1F0 ATP synthas	443	261	80	0	X
11459	1SS[6-127]	443	0	125	0	X
6005	TIS11d TZF/ 5'-UUAUUUAUU-3' complex	443	282	70	0	X		X
15381	NapD	443	266	85	0	X
16853	CD4mut	443	329	68	0	X
15479	CD4mut	443	329	68	0	X
25790	polyQ regulatory protein	442	289	83	0	X
17812	R2 of histone H3 tail by UHRF1 PHD finger	442	240	64	0	X
5086	Hydrogenobacter thermophilus cytochrome c-552	442	0	0	0	X
10292	Zinc fingers and homeoboxes protein 2	442	354	78	0	X
16424	BamE	442	349	89	0	X
4996	MTH865	442	324	81	0	X
11531	the chitin-binding domain of Chi18aC from Streptomyces coelicolor	442	354	99	0	X
6824	SARS CoV 7a protein	442	349	80	0	X
25961	Q388A3 PDZ domain	442	276	102	0	X
26593	Obscurin Ig59	442	356	94	0	X
7191	pat90 monomer	442	337	86	0	X
5828	Horse cytochrome c	442	418	97	0	X
5207	CALBINDIN D9K	442	0	0	0	X
15610	BH09830	442	320	72	0	X
11331	Midline-2	442	329	79	0	X
11265	A-Raf proto-oncogene serine/threonine-protein kinase	442	338	75	0	X
16355	AR3449A	442	342	81	0	X
15317	CPS_2611	442	336	80	0	X
34282	Metallothionein	441	309	85	0	X
18821	ApoAcpP	441	337	82	0	X
4900	C-terminal xylan binding module	441	0	97	0	X
11040	Eps8L1SH3	441	225	62	0	X
30410	DnaJ homolog subfamily C member 2	441	268	85	0	X
18880	MlcB	441	322	85	0	X
34047	Decoration protein	441	332	68	0	X
25225	trans-(Tyr39-Pro40) form of the Human Secreted Ly-6/uPAR Related Protein-1 (SLURP-1)	441	239	81	0	X
5691	30S ribosomal protein S28E	441	333	76	0	X
4703	Macrophage Inflammatory Protein-3 alpha	441	0	0	0	X
30094	Coat protein	441	377	101	0	X
4578	Pseudomonas aeruginosa cytochrome c-551	441	351	88	0	X
4426	ACETYL-COA CARBOXYLASE	441	269	83	0	X
18282	M-PMV MYRISTOYLATED MATRIX PROTEIN	441	419	103	0	X
27581	Sushi1-APPP	441	326	73	0	X
6955	Hypothetical protein ydhA	441	316	79	0	X
18296	BRD1_PHD2_finger	441	289	77	0	X
5356	GS-a3W protein	441	312	66	0	X
25816	PDZ domain	440	276	102	0	X
10244	Zinc finger protein 462	440	322	77	0	X
16176	Prp40-FF4	440	249	61	0	X
7080	NTD-CTD complex	440	304	72	0	X
932	phosphocarrier protein HPr	440	0	0	0	X
18218	HIGD1B	440	351	94	0	X
10301	Crk-like protein	440	327	68	0	X
34189	Nuclear receptor coactivator 3 (E.C.2.3.1.48), CREB-binding protein (E.C.2.3.1.48)	440	179	83	0	X
3466	protein L	440	0	0	0	X
15671	TAF3-PHD finger	440	236	76	0	X
27762	tEI	439	424	439	0	X
10246	Transcriptional repressor CTCF	439	326	70	0	X
18341	Sgt2_NT homodimer	439	329	82	0	X
27041	PipX monomer	439	170	84	0	X
17284	E2_lipoyl_domain	439	327	71	0	X
6904	M-Crystallin Ca2+ loaded (HOLO) monomer	439	311	80	0	X
17089	SH3 monomer	439	319	75	0	X
11115	Complex structure of the zf-CW domain and the H3K4me3 peptide	438	272	75	0	X
6903	M-crystallin Ca2+ free form (APO)	438	309	80	0	X
4286	Snc1	438	0	92	0	X
5344	Neocarzinostatin apo-protein - small molecule complex	438	0	113	0	X
34089	RNA polymerase sigma factor SigA	438	329	79	0	X
4116	Im9 immunity protein	438	239	86	0	X
6908	SNase110 fragment of Staphylococcal Nuclease	438	19	96	0	X
15345	Blo t 5	438	346	106	0	X
15867	GED monomer	438	384	130	0	X
5053	C-terminal domain of Pab1p	438	174	85	0	X
36143	N6-adenosine-methyltransferase catalytic subunit (E.C.2.1.1.62)	438	364	95	0	X
18669	Get5	438	270	78	0	X
4241	Internal xylan binding domain from XYLD	438	0	100	0	X
15590	MSP2	437	615	204	0	X
26946	Ca-S100A4d9	437	0	88	0	X
5535	R3H domain	437	0	0	0	X
5591	cC2 domain	437	368	100	0	X
18606	anti-CRISPR protein Acr30-35	437	239	75	0	X
17276	unbound Alk5 ectodomain	437	247	85	0	X
5221	C-Terminal Region of Ku86	437	448	108	0	X
16910	Prestin STAS monomer	437	372	121	0	X
15462	HI0947 Homodimer	437	330	86	0	X
15406	PapI	437	335	76	0	X
34217	E3 ubiquitin-protein ligase	437	328	73	0	X
19549	RsmZ(36-44)/RsmE(dimer) 2:1 complex	437	274	70	0	X		X
36111	BolA-like protein 2	437	254	76	0	X
17149	Fyn_SH3_A39V-N53P-V55L	437	314	122	0	X
10013	ring finger domain of KIAA1045 protein	437	340	76	0	X
6117	ChaB	437	263	83	0	X
16801	lmo0835	437	321	72	0	X
5590	DNA-binding domain in RTBP1	437	425	115	0	X
18692	HP1264	437	301	71	0	X
30207	Muscleblind-like protein 1	437	262	81	0	X
11233	KIAA1783 protein	436	338	74	0	X
4290	tachycitin	436	0	0	0	X
17262	Calcium bound S100A16	436	408	112	0	X
17892	CylR2 homodimer	436	251	74	0	X
5119	subunit c of ATP synthase	436	266	88	0	X
4914	vMIP-II	436	0	0	0	X
16989	CYP33	436	330	77	0	X
18787	F15L_polypeptide	436	0	73	0	X
4781	SL2 stem loop RNA from HIV-1	436	272	58	0	X		X
17028	Bacteriophage Lambda Tail Tube-gpV-C	436	343	91	0	X
15634	FeoC_monomer	436	322	77	0	X
15687	TA0895	436	273	83	0	X
5179	vav n-terminal SH3 domain	436	266	77	0	X
25853	spider toxin, U33-theraphotoxin-Cg1c	436	290	79	0	X
16189	FKBP3-N	436	325	75	0	X
4558	YopH-NT monomer	436	432	123	0	X
4160	Tn916 integrase subunit 1	435	267	83	0	X
79	plastocyanin	435	0	0	0	X
6158	saposin C	435	377	77	0	X
6129	Copper-transporting ATPase 1 (E.C.3.6.3.4)	435	248	78	0	X
6790	18:0 ACP from spinach	435	296	83	0	X
5563	ParG dimer	435	317	83	0	X
18255	MbtH-like protein	435	339	84	0	X
10053	OppA	435	1371	434	0	X
4102	metallo-beta-lactamase	435	633	213	0	X
16378	GtR34C	435	324	76	0	X
19668	a3Y monomer	435	309	65	0	X
11339	Baculoviral IAP repeat-containing protein 4	435	321	75	0	X
4131	rat ferrocytochrome b5 B form	434	297	90	0	X
495	micrococcal nuclease	434	0	0	0	X
11222	first SH3 domain of human KIAA0769 protein	434	328	74	0	X
16794	ZR215	434	255	79	0	X
6317	CylR2 dimer	434	327	73	0	X
4130	rat ferrocytochrome b5 A form	434	297	90	0	X
19376	Calmodulin, C-terminal domain	434	319	78	0	X
30636	Chaperone protein DnaK,Chaperone protein DnaJ 2 (E.C.3.1.3.1)	434	352	80	0	X
27251	CW42 bound to H3K4me1	434	232	88	0	X
18091	DP2	434	307	76	0	X
6600	Biotin Carboxyl Carrier Protein	434	325	78	0	X
10277	Chromobox protein homolog 2 (isoform 2)	434	308	70	0	X
11213	SH3YL1 protein	434	325	80	0	X
18158	N-terminal domain (6-74) of human ZBP1 protein	433	317	75	0	X
34064	Lipoprotein cytochrome c, 1 heme-binding site	433	0	73	0	X
25964	Structure of human islet amyloid polypeptide in complex with an engineered binding protein	433	354	121	0	X
6466	Ubiquitin	433	325	72	0	X
4666	transcarboxylase 1.3S subunit	433	247	80	0	X
5481	Hub1	433	321	75	0	X
5206	S100B dimer	433	332	93	0	X
6363	Protein XCC2852	433	262	80	0	X
15485	Npl3 RRM1	433	237	73	0	X
7312	VHS domain monomer	433	453	130	0	X
26549	NS5A D2D3	433	689	235	0	X
18352	HR8150A	433	308	70	0	X
18535	Ribonuclease III	433	355	84	0	X
6851	XPF dimer protein	432	251	87	0	X
4817	Mj0307 reduced form	432	253	72	0	X
30007	Type I modular polyketide synthase	432	348	93	0	X
17261	APO S100A16	432	412	98	0	X
11134	WD repeat and HMG-box DNA binding protein 1	432	298	76	0	X
6130	Copper-transporting ATPase 1 (E.C.3.6.3.4)	432	320	77	0	X
15137	CAC monomer	432	0	68	0	X
10044	ZF-HD_homeobox_family_protein	432	308	78	0	X
11228	Rho guanine nucleotide exchange factor 9	432	330	83	0	X
26802	Cold Shock Protein A	432	322	84	0	X
17893	CylR2 homodimer	432	251	74	0	X
30068	Antivirulence protein AVR-Pia	432	152	75	0	X
6594	Leishmania major FYVE domain containing protein 1	432	323	87	0	X
7069	Copper-transporting ATPase 1 (E.C.3.6.3.4)	432	248	79	0	X
4046	Drosophila Heat Shock Factor	432	370	122	0	X
10291	Homeobox protein TGIF2LX	432	318	68	0	X
4589	scaffoldin protein	431	0	86	0	X
15510	Nckalpha-SH3.1	431	213	84	0	X
18190	BC008182	431	244	75	0	X
10281	Paired box protein Pax6	431	316	70	0	X
19274	Dictyostelium discodieum Myosin Light Chain, MlcC	431	320	81	0	X
19327	yahO	431	318	75	0	X
27987	Cytochrome PpcA Gmet	431	263	66	0	X
27550	Shr-HID2	431	357	123	0	X
5904	inhibitor-1a	431	442	101	0	X
18702	RNA BINDING PROTEIN Solution structure of the third KH domain of KSRP in complex with the G-rich target sequence.	431	235	0	0	X		X
15806	Neurotrypsin kringle domain, NT/K	431	0	84	0	X
16053	PROTEIN	431	305	74	0	X
15575	FBP21 entity	431	259	77	0	X
11043	SHH (single chain polypeptide)	431	328	73	0	X
6907	V66W110 fragment of staphylococcal nuclease	431	0	91	0	X
4952	UBX domain of fas accociated factor 1	431	283	87	0	X
5326	D24N61 mutant of ATP Synthase subunit c	431	349	83	0	X
30247	Papain-like proteinase (E.C.3.4.19.12,3.4.22.69)	431	332	83	0	X
15338	YfgJ monomer	430	330	74	0	X
19040	2'-5' AG1 lariat forming ribozyme	430	347	12	0			X
4044	Uracil-DNA Glycosylase Inhibitor Protein	430	0	76	0	X
18841	Antitoxin PaaA2	430	311	70	0	X
15576	NFATC2IP Ubh monomer	430	312	71	0	X
5312	aIF2beta	430	296	122	0	X
18572	hemi-Mg-bound Phl p 7	430	299	79	0	X
18703	2-mercaptophenol-alpha3C	430	293	64	0	X
5078	Lipoyl acid-bearing domain of human BCKD complex	430	345	85	0	X
18944	Gbx1	430	245	74	0	X
25508	Probable Fe(2+)-trafficking protein from Burkholderia pseudomallei 1710b	430	361	93	0	X
15373	Ros87	429	341	85	0	X
5067	lipoyl domain of dihydrolipoyl dehydrogenase P64K	429	265	80	0	X
6247	NifU1	429	344	80	0	X
6586	cdc37hbd	429	386	133	0	X
16523	pfColA monomer	429	576	207	0	X
25878	N-terminus F2 TnC	429	259	87	0	X
18365	WT-ALA	429	363	125	0	X
30495	De novo beta protein	428	237	75	0	X
16534	DCL4 DUF283	428	246	85	0	X
11209	SH3 domain GRB2-like protein B1	428	326	74	0	X
4397	fractalkine	428	257	91	0	X
6845	Ribosome biogenesis protein Nop10	428	273	64	0	X
15475	YuaF	428	362	84	0	X
18831	U14Ub1	428	328	70	0	X
5898	26S proteasome non-ATPase regulatory subunit 10	428	642	217	0	X
15459	TolR dimer	428	312	77	0	X
4729	EGF-like module pair 3-4 from human vitamin K-dependent protein S	428	206	85	0	X
15701	human_C-termal_doamin_of_pirh2	427	308	72	0	X
6261	SH3 domain of Lyn Tyrosine Kinase	427	275	67	0	X
25809	W60G_beta2-microglobulin	427	375	99	0	X
6575	Nck2 SH2 domain	427	370	92	0	X
17880	yeast protein	427	303	110	0	X
27085	HPF	427	435	102	0	X
5329	C. elegans protein ZK652.3	427	365	85	0	X
4623	XYLANASE D	427	0	97	0	X
17199	spRT6	427	380	88	0	X
16246	Prp24-RRM2	426	256	83	0	X
10194	RUN and TBC1 domain containing 3	426	317	72	0	X
11401	Protein kinase C gamma type	426	319	68	0	X
15660	LFV-Z	426	351	84	0	X
19893	Q4D059, a hypothetical protein from Trypanosoma cruzi	426	335	84	0	X
25461	CUE domain of yeast Cue1	426	305	81	0	X
25241	N-domain of the AAA metalloproteinase Yme1	426	318	56	0	X
17808	Structure of PHD domain of UHRF1 in complex with H3 peptide	426	244	66	0	X
17344	CHD4-PHD2/H3K9me3 complex	426	248	61	0	X
11156	Nostrin	426	318	73	0	X
18621	La-type RNA-binding domain	426	383	88	0	X
16408	periplasmic CopK protein complex	426	278	73	0	X
25575	SAP30L corepressor protein	426	247	64	0	X
18573	Ca-bound Phl p 7	426	298	79	0	X
10241	Rho guanine exchange factor (GEF) 16	426	319	77	0	X
25612	OR358	426	306	70	0	X
30627	Alkaline phosphatase,Chaperone protein DnaJ 2 (E.C.3.1.3.1)	425	338	80	0	X
16947	histidine kinase receptor ArcB	425	317	108	0	X
11022	big defensin monomer	425	0	0	0	X
19511	homeodomain transcription factor Gbx1	425	248	75	0	X	X
25688	Acyl Carrier Protein monomer	425	229	78	0	X
4621	NOT4	425	327	80	0	X
4726	TFIIS domain I	425	245	79	0	X
15370	apd monomer	425	328	76	0	X
15678	SeR13	424	345	85	0	X
4494	IGF-I	424	0	76	0	X
10122	Intersectin 2	424	313	78	0	X
36175	ubiquintin-like protein	424	236	81	0	X
7068	Copper-transporting ATPase 1 (E.C.3.6.3.4)	424	243	78	0	X
19160	hL-FABP:GCA	424	360	128	0	X
289	eglin c	424	0	0	0	X
18571	apo-Phl p 7	424	296	79	0	X
34073	Peroxin 14	424	245	68	0	X
16720	mouse prion protein mutant D167S	424	366	131	0	X
19201	TAX1BP1 UBZ1+2	424	295	72	0	X
5745	bovine microsomal cytochrome b5	424	307	83	0	X
17359	CfR130	423	314	74	0	X
15487	Npl3p RRM2	423	230	82	0	X
11155	Abl interactor 2	423	322	70	0	X
7181	Hypothetical protein PA4359	423	250	67	0	X
25459	Fungus protein Q8J180_MAGGR	423	238	86	0	X
16622	SH3 monomer	423	322	74	0	X
34489	sohair	423	644	159	0	X
7120	Rho-GTPase-activating protein 7	423	256	76	0	X
5984	FtsN RNP domain	423	0	76	0	X
6002	p63 monomer	423	337	81	0	X
10193	Zinc finger ZZ-type-containing protein 3	423	303	70	0	X
5558	Sp100b SAND domain	423	296	97	0	X
27349	C. difficile IF1	423	300	74	0	X
5572	spruce budworm antifreeze protein	423	226	93	0	X
15074	IBR domain of Parkin	423	289	81	0	X
6746	phnA-like protein rp4479	422	313	74	0	X
10272	SH3 and PX domain-containing protein 2A	422	317	76	0	X
25706	VirA VirFG fusion	422	321	80	0	X
11214	SH3 domain of Fyn-related kinase	422	322	79	0	X
4254	Mbp1	422	242	126	0	X
10245	Megakaryocyte-associated tyrosine-protein kinase	422	313	69	0	X
16185	Mouse Prion Protein (121-231)	422	367	135	0	X
15755	C-HsCen2/R17-HsSfi1 complex	422	76	75	0	X
4677	cysteine-rich domain of DnaJ Chaperone	422	300	81	0	X
25149	Isolated Ring domain	421	292	76	0	X
16466	plasminogen kringle 5	421	0	95	0	X
11151	Protein kinase C delta type	421	310	68	0	X
17432	Myristoylated msrA	421	393	196	0	X
30301	Hydrophobin	421	320	100	0	X
27363	Cytochrome PpcA Gmet	421	206	73	0	X
16293	CA150 FF1+linker	421	251	78	0	X
11027	SH3-F2 (single chain polypeptide)	421	319	69	0	X
5873	BlaI N-terminal domain	421	351	76	0	X
10295	Homeobox protein BarH-like 1	420	317	70	0	X
15168	LARG PDZ domain	420	297	84	0	X
16684	MS1	420	308	91	0	X
5036	TRANSCRIPTION FACTOR SOX-5	420	0	76	0	X
18478	P75/LEDGF PWWP Domain	420	329	81	0	X
4752	gpnu1-E68	420	309	76	0	X
5231	Stromelysin complex with a ligand	420	477	134	0	X
25214	High-resolution NMR structures of the domains of Saccheromyces cerevisiae Tho1	420	225	66	0	X
27143	PACT-D3 L273R	420	332	88	0	X
16618	J-domain of CbpA	420	331	70	0	X
10287	Zinc fingers and homeoboxes protein 3	420	302	69	0	X
16688	CPE1231	420	327	81	0	X
18607	Avrpiz-t	419	302	85	0	X
18832	SH3 domain of DOCK180	419	212	61	0	X
11131	Zinc finger, FYVE domain containing 27 isoform b	419	311	76	0	X
6022	Copper-transporting ATPase 1	419	0	67	0	X
4960	methionine to histidine mutant of cyt c-551	419	0	0	0	X
25068	High mobility group protein from Plasmodium falciparum 3D7	419	351	80	0	X
15468	NE1242	419	311	76	0	X
18124	D. radiodurans RecQ	418	287	71	0	X
10098	Diacylglycerol kinase, delta	418	318	75	0	X
10276	Tudor domain-containing protein 3	418	321	74	0	X
16864	uvi31+	418	401	111	0	X
30514	Obscurin (E.C.2.7.11.1)	418	315	0	0	X
15486	YmoA monomer	418	319	67	0	X
6322	delta25-PYP	418	180	99	0	X
5091	CYTOCHROME B5	418	0	0	0	X
18956	STRUCTURE OF NAB2P TANDEM ZINC FINGER 34	418	301	72	0	X
18777	MS1	418	616	201	0	X
25460	Fungus protein B9WZW9_MAGOR	418	228	81	0	X
19533	NusE (S10) from Thermotoga maritima	418	316	68	0	X
17883	Lin28-ZnF domains bound to AGGAGAU of pre-let-7 miRNA	418	191	64	0	X		X
10286	Hypothetical protein DKFZp686K21156	417	319	75	0	X
6230	human hemglobin A	417	0	0	0	X
15442	TubCdd dimer	417	308	75	0	X
25905	bromodomain of Trypanosoma brucei Bromodomain Factor 2(BDF2)	417	292	112	0	X
15536	EnHD	417	199	69	0	X
5951	SAP-C	417	0	75	0	X
2539	434 repressor	417	0	0	0	X
34255	Penicillin-binding protein 1B (E.C.2.4.1.129,3.4.16.4)	417	363	72	0	X
18391	R3H domain from human Smubp-2 in complex with 2'-deoxyguanosine-5'-monophosphate	417	0	75	0	X
7225	UPF0291 protein ynzC	417	338	75	0	X
5360	Photosystem I reaction center subunit E	417	0	0	0	X
10293	LIM/homeobox protein Lhx9	417	309	73	0	X
11289	Leupaxin	417	322	72	0	X
4126	single chain three helix bundle	417	312	75	0	X
4734	High mobility group protein of Drosophila complexed to a bulge DNA	417	46	80	0	X	X
17084	prion	417	366	129	0	X
15007	msp-1 c-terminal domain	417	301	87	0	X
30628	Alkaline phosphatase,Chaperone DnaJ domain-containing protein fusion	417	337	77	0	X
16510	first PHD finger/non-modified histone H3 tail complex	417	243	64	0	X
15938	p190-A RhoGAPFF1	416	233	72	0	X
27623	sigma4-70c monomer	416	377	92	0	X
11063	Polymyxin b resistant protein D	416	330	75	0	X
4034	ERR2 DNA binding domain with a C163A mutation	416	96	93	0	X
6188	Acyl-CoA-binding protein	416	249	88	0	X
1756	lipoate acetyltransferase	416	0	0	0	X
16568	DhR29a	416	353	80	0	X
34240	Segmentation polarity homeobox protein engrailed	416	0	0	0	X
11205	Zinc finger protein 435	416	309	66	0	X
10240	cortactin isoform a	416	325	79	0	X
30199	Siderophore yersiniabactin	416	349	79	0	X
16325	lkr136b	416	395	92	0	X
11355	Pre-mRNA-splicing factor 18	416	309	65	0	X
4199	N-term linker Type III Antifreeze protein RD3	415	0	74	0	X
6091	PDZ2 from PTP-BL	415	93	97	0	X
36071	Cytochrome b5	415	302	84	0	X
25650	RNA recognition motif-1 of serine/arginine-rich protein 1	415	356	84	0	X
19317	DNA helicase RecQ	415	283	70	0	X
4146	F1Fo ATP Synthase Subunit c	415	339	76	0	X
19023	RNA polymerase binding protein A (RbpA)	415	252	76	0	X
26842	TMR-3_48nt-5-TAMRA	415	382	157	3			X
15822	A3DK08 PROTEIN	415	305	73	0	X
16988	PtR41O	415	337	87	0	X
4836	Hepatitis A 3C Protease monomer	414	615	206	0	X
6265	armadillo repeat and U-box containing protein	414	256	63	0	X
15824	Prion Protein	414	364	135	0	X
30137	Scavenger receptor class B member 1	414	284	68	0	X
30391	M protein	414	309	76	0	X
6300	Kalirin	414	314	78	0	X
5106	MTH1743	414	305	68	0	X
18390	Fr822A	414	321	78	0	X
15354	NMR Structure of protein Q60C73_METCA	414	301	71	0	X
18586	MS1	414	316	77	0	X
16335	BSU15050	414	306	73	0	X
19700	P33A mutant of non-conventional toxin WTX from Naja kaouthia	414	0	74	0	X
15131	MBP	414	401	144	0	X
27692	Calmodulin	414	442	124	0	X
19356	MS6	413	274	91	0	X
17886	holo-acyl carrier protein monomer	413	333	83	0	X
25923	BMI1-PHC2 complex	413	469	129	0	X
18442	R. rickettsii cold shock-like protein	413	293	77	0	X
4896	response-regulator protein CheY2	413	344	118	0	X
5968	dematin	413	291	73	0	X
16261	Microplusin	413	254	99	0	X
16803	RanE66S dimer	413	310	67	0	X
16252	A13	412	232	70	0	X
16184	Mouse Prion Protein (121-231)	412	364	135	0	X
30632	Alkaline phosphatase,Chaperone protein DnaJ 2 (E.C.3.1.3.1)	412	354	79	0	X
27830	Complex of MarH with L-Trp	412	391	103	0	X
15386	str82	412	317	75	0	X
27056	sas-5N	412	356	107	0	X
27432	SLy1 SAM dimer	412	316	72	0	X
15543	rna bound nelfe-rrm	412	224	91	0	X		X
5849	COP9 complex subunit 4	412	338	83	0	X
4895	TmCsp	411	254	69	0	X
15347	NE0084	411	323	83	0	X
25032	bacterial immunoglobulin-like domain form a surface protein of Leptospira	411	193	108	0	X
4208	CytC(Y64A)	411	0	0	0	X
6008	tn3 with calcium bound	411	323	111	0	X
19485	SVIP mutation	411	280	67	0	X
6981	BsaL	411	284	85	0	X
4195	Alpha-Bungaratoxin/Library Peptide Complex	411	0	0	0	X
11026	SHA (single chain polypeptide)	411	320	69	0	X
25093	EcMazE homodimer	411	323	79	0	X
19613	HOP2	411	310	82	0	X
17079	PROTEIN	411	254	50	0	X
18559	MLL5	410	298	74	0	X
18551	C2H2-type Zinc-fingers 4 and 5 from human Insulinoma-associated protein 1 (fragment 424-497)	410	307	79	0	X
18351	MS3	410	308	79	0	X
4913	cAMP-regulated phosphoprotein-19 monomer	410	337	104	0	X
5334	NTD HTLV-I capsid protein	410	361	115	0	X
18492	SANT2 domain of NCoR2	410	287	71	0	X
11162	RING finger protein 126	410	307	74	0	X
4155	Eotaxin	410	0	64	0	X
19049	Solution structure of chicken Engrailed 2 homeodomain	410	332	85	0	X
30197	E3 ubiquitin-protein ligase parkin (E.C.6.3.2.-)	410	335	80	0	X
27405	Sis1 J-domain	410	323	73	0	X
15100	YfgJ with Zn+2	410	302	71	0	X
17504	RNA Duplex-Quadruplex Junction Complex with FMRP RGG peptide	410	0	0	0	X		X
17212	Rap1 BRCT domain	409	344	89	0	X
15843	ECA1580	409	297	70	0	X
5551	LEKTI domain 6 (HF7665) monomer	409	0	0	0	X
7099	wsv230	409	240	80	0	X
19628	protein NP_419126.1 from CAULOBACTER CRESCENTUS	409	302	74	0	X
27949	HNH monomer	409	408	107	0	X
19229	PHD Domain from Human SHPRH	409	285	68	0	X
5250	GlcT-RBD dimer	409	298	71	0	X
5317	Telomeric repeat binding factor 1	409	196	78	0	X
19368	Structure of Pex14 in complex with Pex5 LVxEF motif	409	212	62	0	X
18422	holoprotein	409	348	134	0	X
6771	Regulatory protein cro	408	227	74	0	X
27573	SUMO1 F64L	408	197	86	0	X
10063	Intersectin 2	408	304	74	0	X
6358	Xcc975 monomer	408	295	70	0	X
6539	hSH3-1 domain	408	226	77	0	X
5247	murine mts1	408	361	90	0	X
15520	EnHD L16A	408	163	58	0	X
30457	Type II HSP40 co-chaperone	408	323	73	0	X
25147	DNA binding domain of sigma 54 from E.coli	408	281	71	0	X
7192	YqaI	408	306	75	0	X
18121	CdnL N-terminal domain	408	271	70	0	X
11309	Cell growth regulating nucleolar protein LYAR	408	299	72	0	X
16269	n-NafY	408	233	81	0	X
15035	h6CarA(Nter)	408	0	86	0	X
18922	PmrAn dimer	408	352	117	0	X
17316	T box riboswitch Specifier domain and GA motif	408	347	18	0			X
17602	Phosphomannomutase/Phosphoglucomutase Monomer	407	1125	407	0	X
18115	C-terminal Domain (537-610) of Human Heat Shock Protein 70	406	310	78	0	X
5084	PABC-Paip1 complex	406	0	101	0	X
4478	PKD1 HUMAN	406	176	80	0	X
19498	bacteriophage T7 encoded inhibitor (gp1.2)	406	266	75	0	X
17145	Pitx2 homeodomain R24H	406	310	78	0	X
18425	S100A11 dimer	406	353	87	0	X
7094	EColi	406	0	100	0	X
19987	MIT1 domain of a chitin synthase	406	278	73	0	X
11234	Tripartite motif-containing protein 31	406	299	63	0	X
5148	METHANE MONOOXYGENASE COMPONENT C	406	312	79	0	X
16666	Sd5	405	270	65	0	X
16545	CV0237	405	306	64	0	X
19830	reduced Jaburetox	405	297	84	0	X
17993	EC2	405	348	78	0	X
18393	dsRBD	405	309	67	0	X
4838	bungarotoxin/Acetylcholine receptor peptide	405	0	0	0	X
18216	acyl-carrier protein from Rickettsia prowazekii	405	350	78	0	X
6536	hSH3-1 domain	405	239	85	0	X
11364	Splicing factor 3 subunit 1	405	291	66	0	X
19165	HdeA homodimer	405	358	91	0	X
1396	transcriptional regulator GCN4	405	0	0	0	X
1398	transcriptional regulator GCN4	405	0	0	0	X
10247	NEDD9 interacting protein with calponin homology and LIM domains	405	312	73	0	X
30296	FACT complex subunit SSRP1	405	269	68	0	X
19003	Core Domain (10-76) of the Feline Calicivirus VPg protein	405	307	81	0	X
25477	oxidized triheme cytochrome PpcA	405	0	63	0	X
19560	Middle domain of Hsp90alpha	404	1181	404	0	X
5239	dvh c3ox	404	0	108	0	X
11356	Rho guanine nucleotide exchange factor 6	404	299	72	0	X
15372	TCI monomer	404	258	81	0	X
4122	Hematopoietic cell kinase	404	307	73	0	X
18194	CarD1-72	404	296	73	0	X
15569	PAH1	404	321	74	0	X
25887	SLURP-2, a secreted isoform of Lynx1	404	300	78	0	X
4121	Isl-1 homeodomain	404	162	68	0	X
6084	dh434(0-63)	404	0	0	0	X
19719	PFI1780w-PHIST	404	419	148	0	X
17027	lynx1	404	40	79	0	X
5382	the C-terminal domain of EPSP synthase	404	384	194	0	X
8	alpha-bungarotoxin	404	0	0	0	X
27574	TGF-b2 homodimer	403	383	92	0	X
17525	ATR13	403	320	77	0	X
1399	transcriptional regulator GCN4	403	0	0	0	X
15995	TM1_TM2 in LPPG micelles	403	350	76	0	X
1397	transcriptional regulator GCN4	403	0	0	0	X
15871	XACb0070 dimer	403	337	51	0	X
10212	SRC-like-adapter	403	304	68	0	X
19449	BolA-like hypothetical protein RP812	403	320	80	0	X
30504	Hydrophobin	403	326	85	0	X
11349	Skeletal muscle LIM-protein 3	403	289	66	0	X
15037	human beta-microseminoprotein	403	0	0	0	X
34408	Insulin-like growth factor I	403	189	74	0	X
25380	HP0268 from Helicobacter pylori	403	328	80	0	X
25735	The selective autophagy receptor TAX1BP1 is required for autophagy-dependent capture of cytosolic Salmonella typhimurium	402	179	63	0	X
4808	ferrous cytochrome b5 complexed with ferrous cytochrome c	402	212	78	0	X
17667	TgMIC4-apple5 monomer	402	315	73	0	X
6906	Bicoid Homeodomain Bound to DNA	402	310	76	0	X	X
17452	Pitx2HD	402	237	89	0	X	X
6622	reduced and S-methylated hen egg white lysozyme	402	332	116	0	X
16647	CPF_0587	402	307	76	0	X
27436	MBD6	402	305	64	0	X
17628	Alk1	402	361	84	0	X
4581	CALBINDIN D9K	402	0	70	0	X
4809	bovine ferrous cytochrome b5-N17D in complex with horse heart ferrous cytochrome c	402	211	78	0	X
4239	f29-SSB bacteriophage	402	220	88	0	X
1869	BSPI-2	402	0	0	0	X
11293	Cysteine-rich protein 2	401	300	62	0	X
4314	HCC-2 chemokine	401	0	0	0	X
50010	rsFolder	401	836	206	0	X
6736	NMR structure of PA2021	401	206	71	0	X
4145	Tec Src Homology 3 (SH3) domain	401	0	76	0	X
30518	LIM and senescent cell antigen-like-containing domain protein 1	401	240	76	0	X
15102	KCNE1	401	336	112	0	X
5492	5K Ribonuclease Sa	401	0	89	0	X
17668	ZiaAn sub mutant	400	403	99	0	X
4572	PBX homeodomain	400	244	72	0	X
17606	RBBP1 chromobarrel domain	400	327	73	0	X
10261	Methionyl-tRNA synthetase	400	290	69	0	X
15844	GmR137	400	311	77	0	X
11123	SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily C member 1	400	317	74	0	X
11316	Transcriptional repressor CTCF	400	298	61	0	X
11194	SH3 and PX domain-containing protein 2A	399	294	70	0	X
11219	Sorbin and SH3 domain-containing protein 1	399	295	63	0	X
4204	Insulin-like growth factor-I (Somatomedin C)	399	0	0	0	X
16256	Drosha	399	244	68	0	X
4743	CYTOCHROME C7	399	0	0	0	X
5218	24 kDa N-terminal fragment of Gyrase B	399	551	196	0	X
11305	Actin Binding LIM Protein 2	399	308	65	0	X
2498	insulin-like growth factor-I	399	0	0	0	X
16590	EF-hand domain of polycystin-2	399	157	76	0	X
17381	putative surface protein	399	228	84	0	X
16848	PFUC	398	221	88	0	X
17484	HR6470A	398	285	65	0	X
6776	YFHJ	398	300	69	0	X
30374	Alpha-crystallin B chain	398	375	98	0	X
30635	Alkaline phosphatase,Chaperone protein DnaJ 2 (E.C.3.1.3.1)	398	327	76	0	X
25158	Doc48S monomer	398	299	78	0	X
19496	FLNa3-5	398	670	258	0	X
5279	cytochrome c7	398	0	0	0	X
7383	Nucleolar_protein_3	398	258	75	0	X
18181	GspC-HR of typeII secretion system	398	260	72	0	X
16818	PFUC_trans	398	221	87	0	X
30352	U21-hexatoxin-Hi1a	398	282	78	0	X
5933	Ste11 Regulatory Domain	398	299	72	0	X
15012	Atu4866	398	282	73	0	X
34002	Insulin-like growth factor II	397	279	73	0	X
25953	CCHC zinc finger domain of Pcf11	397	291	77	0	X
30556	Cytochrome c oxidase assembly factor 6 homolog	397	275	78	0	X
27141	PupB-NTSD monomer	397	309	82	0	X
6638	lmp2a NTD	397	385	101	0	X
6197	Src homology-3 domain	397	286	59	0	X
11530	chitin binding domain1	397	302	75	0	X
5868	UV excision repair protein RAD23 homolog B	397	269	82	0	X
17615	RfaH carboxyterminal domain	397	211	62	0	X
30208	Muscleblind-like protein 1	397	220	72	0	X
6457	Ubiqutin assembly	397	342	83	0	X
17132	amino-terminal UBA domain of OTUD7A	397	302	73	0	X
5294	beta subunit of translation initiation factor 2	397	181	103	0	X
7362	UPF0165	397	229	62	0	X
4112	bacteriocin_cas48	397	0	0	0	X
34194	Nonribosomal peptide synthetase StoB	397	288	70	0	X
15948	RING Finger monomer	397	290	71	0	X
25344	CaM Tr2C, monomer	397	305	71	0	X
34001	Insulin-like growth factor II	396	184	71	0	X
15845	Prion Protein	396	367	135	0	X
25299	Human Small Ubiquitin like Modifier protein-1 (SUMO-1)	396	383	94	0	X
11287	Zinc finger protein 292	396	297	62	0	X
11469	the plant homeodomain (PHD) of the E3 SUMO ligase Siz1 from rice	396	308	72	0	X
11278	Activating signal cointegrator 1 complex subunit 2	396	296	70	0	X
19299	MLV CTD IN	396	334	74	0	X
6574	MrR5	396	306	68	0	X
30177	PHD finger protein 20, Histone H3.1	396	289	62	0	X
5364	Tap	396	0	0	0	X
16168	PHOSPHOLEMMAN	396	138	68	0	X
11153	130 kDa phosphatidylinositol 4,5-biphosphate-dependent ARF1 GTPase-activating protein	396	296	69	0	X
6131	Cytochrome b5	396	0	0	0	X
6416	apo-NikA	396	1275	396	0	X
6171	Gamma-aminobutyric acid type B receptor, subunit 1	395	230	72	0	X
5706	TipAS	395	345	103	0	X
17371	hs00113	395	305	77	0	X
6166	Gamma-aminobutyric acid type B receptor	395	230	72	0	X
18119	ITK-SH3	395	276	67	0	X
19179	mol1	395	307	75	0	X
17147	Pitx2 homeodomain	395	306	79	0	X
18657	nfeAFP11	395	292	67	0	X
17962	putative oxidoreductase from Ehrlichia chaffeensis	395	381	99	0	X
4231	ferredoxin	395	0	0	0	X
4151	F1FO ATP Synthase Subunit c	395	315	80	0	X
4590	EOTAXIN-2	395	252	76	0	X
19779	Solution structure of the SGTA N-terminal domain	395	303	73	0	X
17652	S108C mutant of Phosphomannomutase/Phosphoglucomutase	395	1077	395	0	X
18776	Hordeum vulgare glycine rich- RNA binding protein 1	394	248	91	0	X
1333	cytochrome c551	394	0	0	0	X
25849	Gbx1[E17R,R52E]	394	298	76	0	X
7320	PufX	394	299	76	0	X
18840	CPEB1-ZZ_G-P-504-566	394	283	76	0	X
11440	Mg(2+) -bound form of calmodulin C-terminal domain	394	297	66	0	X
16452	pUL89	394	0	0	0	X
6127	p1 encoded protein	394	341	87	0	X
15482	rhr95	393	296	80	0	X
25177	De Novo Designed Peptide that Sequesters Toxic Heavy Metals	393	298	69	0	X
759	cytochrome c551	393	0	0	0	X
17243	PROTEIN	393	219	70	0	X
16791	yaiA	393	281	58	0	X
4413	p73	393	205	74	0	X
34067	RNA-binding protein 5, Survival motor neuron protein	393	292	65	0	X
19110	PI3-SH3	393	328	92	0	X
27839	IgA1 protease G5 monomer	393	329	78	0	X
4001	apo-S100beta	393	294	78	0	X
5041	DNA Ligase III, BRCT domain (E.C.6.5.1.1)	393	310	82	0	X
7129	SH3 domain	392	314	80	0	X
5099	N-terminus of Tissue Inhibitor of Metalloproteinases-1/Matrix MetalloProteinase-3(E202Q)(deltaC) complex	392	327	113	0	X
6301	DESIGNED HETERODIMERIC LEUCINE ZIPPER	392	0	73	0	X
5809	human hemglobin A	392	0	0	0	X
19966	N-terminus of SOCS5	392	232	63	0	X
11325	cellular modulator of immune recognition	392	299	68	0	X
16656	Q251Q8_DESHY	392	289	69	0	X
16961	Dsy0195(21-82)_protein	392	289	69	0	X
6505	hypothetical protein MM1357	392	304	64	0	X
11225	SLIT-ROBO Rho GTPase-activating protein 2	392	296	70	0	X
5961	complement type repeats 5 and 6 from LRP	392	0	80	0	X
11220	second SH3 domain of human KIAA0769 protein	392	297	72	0	X
19553	Blo 1 12 CBD domain	392	292	66	0	X
4732	High mobility group protein of Drosophila	391	149	89	0	X
18193	TtCdnLNt	391	278	58	0	X
16698	ORF57	391	361	119	0	X
19391	MBD3	391	309	68	0	X	X
4294	human MBF1(57-148) core domain	391	340	79	0	X
11352	inhibitor of growth family, member 1-like	391	293	66	0	X
4382	Rubredoxin	391	246	68	0	X
19198	SP18156A	391	233	70	0	X
5172	Oxidized cytochrome c553 from Bacillus pasteurii	391	0	73	0	X
18794	module 2 from the E1 domain of C. elegans APL-1	391	252	68	0	X
15198	all-Ala-hen egg white lysozyme	391	363	125	0	X
17112	PKC-delta C1B	391	319	73	0	X
4355	tetramerization domain of the Mnt repressor	391	266	68	0	X
17075	TatAd	391	324	75	0	X
60	tendamistat	391	0	0	0	X
7421	COMPLEMENT FACTOR H	390	282	68	0	X
6458	Ubiquitin	390	0	0	0	X
16430	Nep1 dimer	390	1198	390	0	X
19671	3rC34Y	390	273	91	0	X
16008	SUD-C	390	291	66	0	X
5692	4th LIM domain of PINCH protein	390	227	71	0	X
11300	Cell division cycle 5-like protein	390	273	66	0	X
4428	HEADPIECE DOMAIN FROM CHICKEN VILLIN	390	0	69	0	X
11357	Transcription elongation regulator 1	390	295	61	0	X
5754	VASP EVH1 domain	390	332	110	0	X
7305	R21A Spc-SH3 monomer	389	0	0	0	X
16068	gp16	389	357	97	0	X
7224	Phage-like element PBSX protein xkdW	389	216	63	0	X
5886	TF1 ATPase Beta Subunit	389	776	389	0	X
34495	CooT	389	289	78	0	X
11217	SH3 domain of Stac protein	389	289	68	0	X
7075	conserved hypothetical protein pa2412	389	285	70	0	X
15477	Prod1	389	300	69	0	X
18355	Rv0603-SSD	389	308	76	0	X
4974	Chymotrypsin Inhibitor 2	389	269	69	0	X
36012	Ubiquitin, putative	389	223	77	0	X
7306	R21A Spc-SH3 monomer	389	0	0	0	X
19178	MS1	388	300	85	0	X
34494	CooT	388	290	77	0	X
36160	G-quadruplex DNA (26-MER)	388	0	0	0		X
6050	Endoribonuclease SSO7D single point mutant K12L	388	0	0	0	X
11404	Rho GTPase-activating protein 4	388	301	67	0	X
11185	RIM binding protein 2	388	298	69	0	X
6947	FurD	388	517	135	0	X
15733	chicken Lamin B Receptor	388	230	69	0	X
4583	RNA POLYMERASE ALPHA SUBUNIT (2.7.7.-)	388	251	83	0	X
17402	LBR_Tudor_domain	388	230	69	0	X
11020	Cu(I)Cox17	388	207	64	0	X
34078	Alpha-mammal toxin BeM9	387	151	71	0	X
10289	Zinc finger homeobox protein 1b	387	292	63	0	X
27606	NZF domain	387	282	63	0	X
18049	RNA-binding subunit of the TRAMP complex	387	240	89	0	X
34116	Agnoprotein	387	0	0	0	X
5050	Bungarus fasciatus IX	387	0	0	0	X
4963	Rat Nedd4 WWIII domain - ENaC bP2 Peptide Complex	387	281	76	0	X
16099	FSTL-3	387	284	67	0	X
4296	Major cold shock protein from E. coli	387	244	72	0	X
16633	prokineticin Bv8	387	0	0	0	X
5006	alpha-bungarotoxin	387	0	0	0	X
4236	THIII-NADP	387	549	182	0	X
5729	C-terminal SH3 domain of SEM-5 from C. elegans	387	293	68	0	X
11179	SH3-domain kinase binding protein 1	387	288	72	0	X
5620	ribosomal protein S28E	387	281	58	0	X
17824	Rbx1	387	321	76	0	X
30040	Antifreeze protein	386	317	82	0	X
15828	PF0385	386	248	85	0	X
19061	S100A15	386	305	76	0	X
19429	bacteriophage transcription regulator complex with p7 peptide	386	289	66	0	X
16177	E73 Homodimer	386	227	69	0	X
4872	DESIGNED HETERODIMERIC LEUCINE ZIPPER	386	0	0	0	X
34000	Insulin-like growth factor II	386	174	72	0	X
11332	Polycomb group RING finger protein 6	386	300	66	0	X
6222	Kurtoxin	386	0	0	0	X
19717	Yah1 Oxidized	386	395	100	0	X
6513	non structural protein 7	386	323	75	0	X
5242	prohormone convertase 1 pro-domain	386	257	76	0	X
11196	Uncharacterized protein KIAA1666	385	293	68	0	X
27426	MBD2 mutant IDR	385	335	107	0	X
25600	LigA4 Big domain	385	247	105	0	X
50007	proIAPP-K4D	385	294	67	0	X
7420	COMPLEMENT FACTOR H	385	275	68	0	X
34211	PACSIN 3, hsP1	385	227	68	0	X
17113	PKC-delta C1A	385	295	72	0	X
5573	spruce budworm antifreeze protein	385	316	82	0	X
16127	SAP30_ZnF	385	297	78	0	X
4349	Fv fragment of the catalytic antibody NPN43C9	385	564	195	0	X
27022	PGK:3PG:MgF3:ADP:Mg2+	385	1186	385	0	X
5977	TM1492	385	283	57	0	X
30629	Alkaline phosphatase,Chaperone protein DnaJ 2 (E.C.3.1.3.1)	385	308	65	0	X
17072	Cbx7 H3K9me3 complex	385	251	44	0	X
5105	EC298	385	209	66	0	X
34318	Histone H1.0	385	311	78	0	X
19849	reduced BolA2 from Arabidopsis thaliana	385	244	95	0	X
11319	Zinc finger BED domain containing protein 1	385	290	66	0	X
34195	Nonribosomal peptide synthetase StoC	385	274	72	0	X
6479	Excisionase from transposon Tn916	384	310	77	0	X
18808	Nterminal domain of splicing factor 1	384	468	209	0	X
30193	HTH-type transcriptional regulator SinR	384	309	66	0	X
10283	Alpha-fetoprotein enhancer binding protein	384	294	66	0	X
5322	gamma-bungarotoxin monomer	384	0	0	0	X
25793	RNA-Binding domain of non-structural protein 1 from the 1918 H1N1 influenza virus	384	311	71	0	X
6419	Variant surface glycoprotein MITAT 1.2	383	231	79	0	X
15931	E2plipD4 dimer	383	0	72	0	X
15206	Needle Monomer	383	297	71	0	X
34193	Nonribosomal peptide synthetase StoA	383	282	72	0	X
10302	SH3-containing GRB2-like protein 2	383	296	67	0	X
16983	PHD3 finger of MLL	383	262	67	0	X
6762	Tor inhibition protein	383	111	62	0	X
30172	Cytotoxin 1	383	285	61	0	X
30	histone H5	382	0	0	0	X
34039	VC-1=CYTOTOXIN	382	277	61	0	X
15710	Eps8L1SH3	382	235	62	0	X
11224	Phospholipase C, gamma 2	382	284	63	0	X
2580	bacteriorhodopsin	382	0	0	0	X
25037	N terminal domain of the MuB AAA+ ATPase	382	183	68	0	X
7203	HOP	382	143	68	0	X
4991	thioredoxin like protein	382	144	78	0	X
6517	PA4738	382	280	68	0	X
18332	Escherichia coli Porins	382	239	67	0	X
11354	inhibitor of growth family, member 4 ING1-like protein	382	287	65	0	X
27737	FKBP12 FK506 complex	382	353	100	0	X
18005	Molecular system	382	211	68	0	X
5178	chitinase fibronectin type III domain	381	316	85	0	X
7190	CaM2/3	381	283	70	0	X
16816	HR4547E	381	218	61	0	X
30634	Alkaline phosphatase,Chaperone protein DnaJ 2 (E.C.3.1.3.1)	381	320	63	0	X
30309	protein XPH1	381	255	77	0	X
25636	AVR-Pia monomer	381	196	61	0	X
17832	HISTONE_CHAPERONE_RTT106	381	286	66	0	X
11035	TTHA1718	381	222	63	0	X
15351	Nck1-1 SH3	381	281	67	0	X
4798	yeast frequenin	381	355	114	0	X
26770	CP12 reduced	381	263	85	0	X
16792	SAP domain of MKL/myocardin-like protein 1	381	218	61	0	X
10284	Alpha-fetoprotein enhancer binding protein	381	285	67	0	X
17234	Lrp_DNA-binding_domain	381	275	62	0	X
17357	PsbQ protein	380	401	112	0	X
2196	complement protein C5a	380	0	0	0	X
19704	Neurotoxin II from snake venom Naja Oxiana	380	282	83	0	X
10269	Chromodomain helicase-DNA-binding protein 4	380	285	65	0	X
30330	Mediator of RNA polymerase II transcription subunit 15	380	379	87	0	X
5012	the third domain of MMP-2	380	0	75	0	X
25744	RpfC	380	227	72	0	X
88	cardiotoxin CTXIIa	380	0	0	0	X
19315	HHARI Catalytic Domain	380	222	87	0	X
6489	F1Fo-ATP synthase subunit c	380	306	67	0	X
19293	calcium-bound human S100A12	379	296	75	0	X
15719	calponin monomer	379	307	83	0	X
25404	VPg of porcine sapovirus	379	277	67	0	X
16377	RPA3574	379	287	72	0	X
5071	troponin C, skeletal muscle	379	228	74	0	X
4375	Ubiquitin	379	313	71	0	X
25542	MyUb (1080-1131) of human Myosin VI	379	273	64	0	X
11362	Zinc finger CW-type PWWP domain protein 1	379	273	71	0	X
6882	sushi domain of the interleukin-15 receptor	379	287	65	0	X
34082	Anti-sigma-F factor Fin	379	272	79	0	X
4063	Oncostatin M	379	616	176	0	X
18007	Molecular system	378	212	68	0	X
25036	CsUbl	378	244	80	0	X
17719	esophageal cancer-related gene 2	378	289	64	0	X
4731	human melanoma inhibitory activity (MIA) protein	378	255	97	0	X
16296	FCP1 monomer	378	321	86	0	X
15415	monomer	378	279	51	0	X
18187	Get5 carboxyl domain from A. fumigatus	378	321	75	0	X
1478	toxin AaH IT	378	0	0	0	X
4453	alpha-actinin/titin complex	377	291	68	0	X
16902	ALS1 monomer	377	941	291	0	X
6555	protein YBL071w-A	377	308	79	0	X
18399	ubiqutin-like protein from Trypanosoma bucei	377	224	77	0	X
6519	Calsensin	377	217	79	0	X
11269	KIAA0733 protein	377	284	74	0	X
36060	TAR DNA-binding protein 43	377	275	78	0	X
18328	CHCHD7	377	273	74	0	X
26650	SIX3_HD	377	260	62	0	X
1198	alpha-amylase inhibitor	377	0	0	0	X
16110	Borealin	377	225	68	0	X
4090	Transposase	376	237	74	0	X
4744	cytochrome c7	376	0	0	0	X
15252	UvsW.1	376	231	78	0	X
7293	recoverin bound to rhodopsin kinase fragment (RK25)	376	383	187	0	X
17050	Solution structure of the Tudor domain from Drosophila Polycomblike (Pcl)	376	220	66	0	X
4024	The first zinc finger domain of SWI5	376	0	0	0	X
4674	mt1615	376	242	61	0	X
11315	Non-SMC element 1 homolog	376	280	61	0	X
4352	Inhibitor (Im9)-bound DNase domain of colicin E9	376	347	123	0	X
1120	IgG Fc region-binding protein	376	0	0	0	X
11240	Lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex, mitochondrial	376	274	61	0	X
5081	Gallium protoporphyrin IX-HasAsm complex	375	504	173	0	X
15407	CD2AP SH3-C monomer	375	275	68	0	X
5597	cytochrome c	375	1	75	0	X
30658	Paxillin	375	276	72	0	X
17816	Lcn972	375	0	0	0	X
19331	HR7992A	375	265	76	0	X
15833	GsR195	375	207	77	0	X
30051	Cyclic peptide mimetic of HIV-1 Tat/RNA Complex	375	162	0	0	X		X
11193	SH3 and PX domain-containing protein 2A	375	280	72	0	X
30049	Cyclic peptide mimetic of Tat/RNA Complex	375	162	0	0	X		X
11284	Hypothetical protein FLJ21522	375	279	60	0	X
11242	Vinexin	375	277	61	0	X
17196	Cu-binding protein	375	290	73	0	X
15430	PDEgamma	375	325	77	0	X
19600	CEH37 Homeodomain	375	199	64	0	X
27868	CHIKV protein	375	633	201	0	X
15695	chromobox protein homolog 4	375	262	56	0	X
30046	Cyclic peptide mimetic of HIV-1 Tat/RNA Complex	375	162	0	0	X		X
30493	Partner and localizer of BRCA2	374	211	59	0	X
16219	PTK6-SH3	374	256	72	0	X
11548	MA	374	281	64	0	X
7330	Alpha-neurotoxin_TX12	374	0	0	0	X
25197	wrapping silk W2	374	786	374	0	X
25800	Plasmodium falciparum SR1-RRM1 in complex with ACAUCA RNA	374	398	84	0	X		X
19171	TRD of MBD1	374	258	91	0	X
19585	computational designed dimer based on the engrailed homeodomain structure	374	260	63	0	X
6811	cadmium-transporting ATPase (E.C.3.6.3.3)	374	0	75	0	X
27353	Protein RHE_CH00563	374	301	85	0	X
25351	RING finger monomer	374	291	65	0	X
5174	ARR10	374	302	66	0	X
15609	ribosomal protein L28	374	210	61	0	X
10294	Homeobox protein OTX2	374	292	66	0	X
4418	cytotoxin 2, minor form	373	0	0	0	X
19684	HR9129A	373	270	66	0	X
34124	Loquacious, isoform B	373	237	76	0	X
10257	Zinc finger BED domain-containing protein 2	373	282	59	0	X
5600	rubredoxin	373	310	111	0	X
15133	Uncharacterized BCR	373	214	63	0	X
6855	CIN85 B domain	373	218	76	0	X
5217	UvrC C-terminal domain	373	261	67	0	X
15339	Ribosome Modulation Factor	373	258	71	0	X
34153	Transcriptional regulator WhiB1	373	322	86	0	X
18820	ApoAcpP-1	373	186	73	0	X
15215	XCL1/Lymphotactin	373	344	85	0	X
19739	Calcium Bound S100P - V Domain of RAGE complex	373	214	81	0	X
12021	PPTI	373	64	0	0	X
5213	CopZ from Bacillus subtilis	373	0	73	0	X
5768	Potential copper-transporting ATPase	373	0	77	0	X
30598	Venom toxin Hj1a	373	262	66	0	X
5797	Hypothetical protein ta1414	372	221	73	0	X
4134	den-LysN	372	219	115	0	X
25083	Putative uncharacterized protein BTH I2711	372	321	76	0	X
7375	ATP7A	372	390	373	0	X
11178	Olygophrenin-1 like protein	372	280	62	0	X
25819	Leptospiral LigA4 Big Domain	372	233	100	0	X
4884	1st LIM domain of PINCH protein	372	202	67	0	X
26649	IF1 monomer	372	269	70	0	X
4043	Centruroides sculpturatus Ewing-V	372	0	0	0	X
27086	single polypeptide chain	372	222	61	0	X
19497	Ca free domain 6 of villin	372	321	100	0	X
19163	J-domain of human DnaJA1	372	277	63	0	X
6480	Copper-transporting ATPase 1(E.C.3.6.3.4)	371	0	70	0	X
15698	Lethocerus F1 troponin C isoform	371	198	71	0	X
6648	Zap1-monomer	371	268	64	0	X
18582	gp78CUE bound to ubiquitin	371	228	121	0	X
11402	Chromodomain-helicase-DNA-binding protein 6	371	287	63	0	X
1495	soybean proteinase inhibitor	371	0	0	0	X
7349	CONSERVED_DOMAIN_PROTEIN	371	279	59	0	X
27093	MOZART1	371	298	77	0	X
26641	MurD monomer	371	0	371	0	X
7078	LCTI monomer	371	0	0	0	X
18171	atTic-hip/hop domain (Residue 310-371)	371	262	67	0	X
15085	RP4601_assembly	370	267	62	0	X
5223	SH3 domain of the tyrosine-protein kinase Lck	370	178	68	0	X
15997	HUMAN RIBOSOME PROTEIN P2	370	210	67	0	X
4792	ParD dimer	370	321	89	0	X
11154	Sorbin and SH3 domain-containing protein 1	370	277	64	0	X
5355	Hsp90 N-terminal ATPase domain	370	572	192	0	X
18006	Molecular system	370	203	67	0	X
6482	Copper-transporting ATPase 1(E.C.3.6.3.4)	370	0	70	0	X
4419	cytotoxin 2, major form	370	0	0	0	X
15692	TgMIC1 in complex with TgMIC6-EGF3	370	355	115	0	X
5806	penaeidin-3	370	0	0	0	X
19817	mutation G159D in troponin C bound to the anchoring region of troponin I	370	219	75	0	X
6925	Kid toxin	370	308	102	0	X
6108	Glycogen synthesis protein glgS	370	188	63	0	X
7401	designed engrailed homeodomain variant UVF	370	256	66	0	X
5700	p63 DNA-binding domain	370	608	200	0	X
16153	SvtR08	369	261	64	0	X
25487	Purotoxin-2 in DPC micelles	369	176	62	0	X
19212	rhodostomin 48ARGDWN-67NPWNG mutant	369	0	70	0	X
10009	SH3 domain of mouse Kalirin-9a protein	369	284	66	0	X
26545	Prostate associated gene 4 phosphorylated	369	353	88	0	X
11350	Skeletal muscle LIM-protein 3	369	273	67	0	X
10290	Homeobox protein DLX-5	369	280	62	0	X
18008	Molecular system	369	200	67	0	X
4815	CYTOTOXIN 2	369	0	0	0	X
5810	cysteine proteinase inhibitor	369	140	94	0	X
4309	HasA	369	337	172	0	X
17239	UBA+Ub complex	369	201	65	0	X
16995	bolA protein (ECH_0303)	369	272	66	0	X
19306	an inhibitor bound dengue NS3 protease	369	712	217	0	X
5769	Potential copper-transporting ATPase	369	0	77	0	X
10296	Homeobox protein goosecoid	369	280	63	0	X
358	ascaris trypsin inhibitor 1	369	0	0	0	X
19305	an inhibitor bound dengue NS3 protease	369	712	217	0	X
25119	cTnI[1-73]-cTnC	369	282	67	0	X
11540	esf3	369	177	68	0	X
25163	three-way junction from the VS ribozyme	368	286	39	0			X
11244	Nuclear receptor corepressor 1	368	273	59	0	X
25164	three-way junction from the VS ribozyme	368	286	39	0			X
17988	Mesobuthus {alpha}-scorpion toxins affecting sodium channels	368	0	0	0	X
19033	SH3 domain of human RAS GAP 1	368	214	69	0	X
17244	PROTEIN	368	206	82	0	X
4042	high-potential iron-sulfur protein I	368	0	66	0	X
6028	ribosomal protein S17E	368	264	64	0	X
15164	ATP7A	368	833	376	0	X
27632	NRASQ61K/HLA-A*01:01/human beta2m	367	786	247	0	X
18980	NC inhibitor 3 complex	367	154	61	0	X
4856	S100A2 homodimer	367	201	85	0	X
17238	UBA	367	200	65	0	X
4686	I-309	367	0	0	0	X
6103	Calcium-dependent protein kinase SK5 (E.C.2.7.1.-)	367	202	80	0	X
25064	PCP7T	367	156	70	0	X
18805	HR4490C	367	259	60	0	X
16115	p80-Coilin	367	323	71	0	X
4147	Cold Shock domain	367	285	71	0	X
15353	BoR54	366	262	65	0	X
11555	the YAM domain of E. coli Transporter YajR	366	285	68	0	X
6288	Neurotoxin I	366	0	0	0	X
17549	mvWFA2 monomer	366	325	167	0	X
15438	IP1*	366	221	72	0	X
4890	CDK-ACTIVATING KINASE ASSEMBLY FACTOR MAT1	366	0	0	0	X
4966	Cardiotoxin A3	366	59	0	0	X
19617	Big domain from Leptospira interrogans	366	248	92	0	X
7000	Rv2302	366	292	74	0	X
4287	Sso1	366	0	76	0	X
15561	DREAM	365	370	183	0	X
6180	LEKTI Domain 15	365	0	79	0	X
7350	CONSERVED_DOMAIN_PROTEIN	365	257	59	0	X
4510	The Second Fibronectin Type II Module From Human Matrix Metalloproteinase 2	365	0	72	0	X
5262	first fibronectin type II module of human matrix metalloproteinase 2	365	0	62	0	X
26544	Prostate associated gene 4	365	341	88	0	X
27112	OA-dFABP	365	327	119	0	X
4998	E2 DNA-binding domain	365	291	76	0	X
16449	XPF DNA complex	365	199	73	0	X	X
34292	DNA protecting protein DprA	365	221	55	0	X
4237	MinE topological specificity domain	365	254	57	0	X
17571	MUTANT UNLIGANDED BOVINE NEUROPHYSIN	364	169	74	0	X
4758	SKLP	364	254	86	0	X
15604	SgR42 protein	364	268	66	0	X
5698	C-terminal domain of poly(A)-binding protein	364	0	80	0	X
16310	apo cL-BABP T91C	364	234	114	0	X
6072	Protein inhibitor of activated STAT protein 1	364	295	68	0	X
5166	hemolysin expression modulating protein Hha	364	236	66	0	X
36082	relaxed pUb	364	295	69	0	X
6893	Fibrinogen alpha chain	364	328	118	0	X
19211	rhodostomin 48ARGDWN-67NGLYG mutant	364	0	71	0	X
15405	RGD-hirudin	364	0	0	0	X
25033	Chlamydomonas reinhardtii NAB1 cold shock domain, CSD1	364	265	71	0	X
5690	cobra neurotoxin II	364	254	71	0	X
16447	apo-PGK	364	1058	364	0	X
11314	Synaptotagmin-like protein 4	364	268	61	0	X
6185	Regulatory protein cro	363	214	68	0	X
4369	S19	363	172	72	0	X
17436	45-MER	363	76	0	0			X
26907	hydrophobin from Phanerochaete carnosa	363	311	79	0	X
18602	soluble domain of MmpS4	363	296	74	0	X
10243	Zinc finger protein 24	363	268	62	0	X
18214	tstm1273	363	259	61	0	X
25142	Hox homeodomain	363	285	71	0	X
7210	Plant HomeoDomain of ING4	363	256	56	0	X
4256	Mbp1(2-124)	363	156	115	0	X	X
16464	alf4-tsa-PGK	363	1049	363	0	X
5243	5'-D(CPAPCPTPAPCPTPCPTPTPTPGPTPAPGPTP*G)-3'	363	0	0	0		X
18848	LTBP1-E3cb15	363	291	95	0	X
5060	TM006 protein from Thermotoga maritima	363	253	81	0	X
18491	Th255-316 dimer	362	0	0	0	X
15729	Tick Carboxypeptidase Inhibitor	362	0	0	0	X
17071	Cbx3 H3K9me3 complex	362	241	56	0	X
6816	RNA polymerase sigma factor RpoN	362	214	67	0	X
16321	UbcH8	362	460	140	0	X
19718	Yah1 reduced	362	347	83	0	X
25086	truncated EcMazE	362	269	65	0	X
16642	CD2AP SH3-B monomer	362	0	0	0	X
5323	Thermal hysteresis protein isoform YL-1 (2-14)	362	0	85	0	X
18189	DocA	361	266	76	0	X
15404	CBP homodimer	361	276	80	0	X
11353	Inhibitor of growth protein 3	361	265	64	0	X
916	trp repressor	361	0	0	0	X
18186	Get5 carboxyl domain from S. cerevisiae	361	270	65	0	X
11019	Cox17 monomer	361	251	62	0	X
15987	ORF56	361	0	0	0	X
16600	cgGFP	361	612	209	0	X
3	acyl carrier protein	361	0	0	0	X
18753	biofilm matrix promoter AbbA from B. subtilis	361	274	68	0	X
18869	HR8910C	361	283	65	0	X
30501	ZZ-type zinc finger-containing protein 3, Histone H3	361	177	63	0	X
4324	B domain of protein A	361	0	69	0	X
17483	hsp12	361	293	99	0	X
17949	CssII	361	0	0	0	X
15324	RPA2121 doamin-swapped dimer	360	267	64	0	X
30070	Uncharacterized protein	360	246	68	0	X
15021	homodimer	360	206	61	0	X
1128	desulfatohirudin	360	0	0	0	X
18764	Phf19 links methylated lysine 36 of histone H3 to regulation of Polycomb activity	360	198	59	0	X
4353	p13 c-terminal domain	360	344	101	0	X
18813	human PHF1 in complex with H3K36me3	360	239	61	0	X
15547	GlUb(S27a)	360	265	66	0	X
17621	Solution structure of the EF-hand domain of Human Polycystin 2	360	152	69	0	X
15674	chromobox protein homolog 7	360	248	51	0	X
19329	HR8700A	359	268	68	0	X
6846	H/ACA ribonucleoprotein complex subunit 3	359	234	58	0	X
30502	ZZ-type zinc finger-containing protein 3, H3K4ac	359	194	62	0	X
2856	kistrin	359	0	0	0	X
4540	ARC repressor	359	0	66	0	X
6920	Midline-1 B-box Type 1	359	174	73	0	X
30684	SAM domain-containing protein SAMSN-1	359	266	62	0	X
4095	SacY(1-55)	359	0	53	0	X
18475	P2_gpX	359	208	68	0	X
11164	TNF receptor-associated factor 3	359	270	59	0	X
4344	CopZ	359	0	74	0	X
4289	C-terminal domain of bacteriophage P22 scaffolding protein	358	0	62	0	X
15016	WW4 - peptide complex	358	305	63	0	X
5766	DNA polymerase lambda (E.C.2.7.7.7)	358	328	76	0	X
18963	Dido_PHD	358	268	68	0	X
6805	anti-Ztaq	358	247	66	0	X
4207	CRO Repressor Insertion Mutant K56-[DGEVK]	358	0	77	0	X
15132	Top7 monomer	358	271	102	0	X
11323	Zinc finger MYND domain containing protein 10	357	262	63	0	X
11159	Retinoblastoma-binding protein 6	357	276	63	0	X
15933	NOGO	357	200	67	0	X
25902	actinin-1 EF bound to IQ	357	258	64	0	X
34068	RNA-binding protein 5	357	282	65	0	X
19428	entity	357	272	64	0	X
15809	myr-yARF1.GDP, monomer	357	525	163	0	X
6841	Calmodulin-like protein 5	357	0	64	0	X
4977	lipid transfer protein	357	0	61	0	X
17000	E1-69 of Yeast V-ATPase	357	202	68	0	X
10298	Homeobox and leucine zipper protein Homez	357	273	62	0	X
18662	SH3_domain_of_GAS7	357	266	64	0	X
19552	Blo t 19, a minor dust mite allergen from Blomia tropicalis	357	253	77	0	X
6686	Calmodulin N-Terminal Domain	356	0	0	0	X
6682	Zinc finger protein 593	356	278	68	0	X
11336	RING finger protein 4	356	265	63	0	X
17963	Rhodostomin G50L mutant	356	0	67	0	X
25386	zinc finger domain	356	267	78	0	X
6087	HCV p7	356	167	0	0	X
19667	carboxyterminal domain of NusG	356	263	60	0	X
16706	H2H3	356	193	72	0	X
27532	RbfA	356	339	102	0	X
5003	reduced yeast iso-2 cytochrome c	356	428	105	0	X
19150	NpF2164-GAF3	356	509	179	0	X
18570	zinc finger AFV1p06 protein	356	271	59	0	X
19087	C-terminal RV0431	356	351	88	0	X
2169	(5-55)Ser BPTI folding intermediate	355	0	0	0	X
17894	CylR2	355	202	72	0	X
16451	adp-PGK	355	701	355	0	X
6804	Ztaq	355	237	66	0	X
16574	NEDD4 3RD WW DOMAIN/HUMAN T-CELL LEUKEMIA VIRUS complex	355	122	46	0	X
18793	BCL-xL in complex with PUMA BH3 peptide	355	541	173	0	X
25059	dCSD1	355	270	72	0	X
4855	(14-38, 30-51)Ser BPTI folding intermediate	355	0	0	0	X
4524	Endoglucanase SS dockerin domain	355	0	69	0	X
17895	CylR2	355	202	72	0	X
5381	anneal2_3	354	0	0	0	X
7211	Erabutoxin b monomer	354	0	56	0	X
15473	dSUMO	354	261	90	0	X
11297	Lamin-B receptor	354	258	59	0	X
6299	alpha 1 type II collagen isoform 1	354	177	65	0	X
4229	Fe8S8 Fd	354	0	0	0	X
15874	Supervillin Headpiece	354	183	60	0	X
26991	Mouse CCL5 dimer	354	288	75	0	X
15873	Supervillin_Headpiece	354	183	60	0	X
15763	Human Mia40	353	240	66	0	X
17425	island 1 protein gp6	353	212	70	0	X
6286	SMRT deacetylase activation domain	353	0	73	0	X
15439	FF	353	0	0	0	X
7358	rmBG21	353	546	192	0	X
15524	RLIP76	353	0	60	0	X
2024	beta-amyloid precursor protein	353	0	0	0	X
6432	At2g23090 monomer	353	307	79	0	X
16649	CtR69A	352	255	63	0	X
18670	Sgt2 homodimerization domain	352	284	70	0	X
5895	S100B	352	251	91	0	X
25464	MbtH-like protein from Mycobacterium marinum	352	267	65	0	X
4853	LQH III ALPHA-LIKE TOXIN	352	0	0	0	X
7399	Rhodostoxin-disintegrin_rhodostomin	352	0	67	0	X
3433	Src tyrosine kinase	352	0	68	0	X
11326	RING finger protein 146	352	266	56	0	X
5697	ZASP-PDZ domain in complex with Alpha-Actinin-2 EF-hand domains	352	0	82	0	X
5097	bucandin	352	0	0	0	X
4794	human wild type gelsolin domain 2	352	215	105	0	X
19493	purotoxin-2	351	0	0	0	X
11344	RING finger protein 141	351	255	61	0	X
6481	Copper-transporting ATPase 1(E.C.3.6.3.4)	351	0	68	0	X
16473	Rv3250c	351	265	71	0	X
6633	HIV-1 frameshift RNA signal	351	273	18	0			X
6262	CG4244-PB	351	0	82	0	X
5346	platelet aggregation inhibitor disintegrin	351	0	0	0	X
27794	RNA-ligand complex	351	324	146	0			X
4892	S100A4 dimer	351	244	85	0	X
16386	Human Fibulin-4	351	264	67	0	X
4268	7-Fe Ferredoxin	351	0	0	0	X
15341	full length SiR90	351	206	62	0	X
11081	DDEF1 SH3	351	279	60	0	X
34304	polb4	350	257	61	0	X
6483	Copper-transporting ATPase 1(E.C.3.6.3.4)	350	0	68	0	X
17035	asr4154	350	254	67	0	X
1639	IgG Fc region-binding protein	350	0	0	0	X
34125	Cytotoxin 1	350	0	0	0	X
17716	Cu(I)Cu(II)-CopK	350	252	68	0	X
2999	HiPIP	350	0	0	0	X
34024	Fusion protein 5.5/5.7	350	272	67	0	X
25426	MBD2 IDR	350	331	106	0	X
4908	a'-domain of ERp57	350	312	95	0	X
17322	W protein of bacteriophage lambda	350	206	62	0	X
16575	NEDD4 3RD WW/ILPTAPPEYMEA complex	350	0	45	0	X
19879	a computational designed protein based on structure template 1cy5	350	214	57	0	X
25720	Regnase-1 C-terminal domain	350	268	58	0	X
5117	Rhodostomin	350	0	68	0	X
4951	HIV-1 Nef	350	0	0	0	X
27851	RNF135 PRY-SPRY monomer	350	543	174	0	X
17950	AtTRB2	350	260	66	0	X
19210	rhodostomin P48A/M52W/P53N mutant	349	0	68	0	X
4768	human parvulin 14	349	179	92	0	X
27734	FKBP12	349	334	98	0	X
16208	NmerAHg	349	176	60	0	X
1870	BSPI-2	349	0	0	0	X
15286	Bungatoxin	349	0	0	0	X
26821	apoTrpR	349	218	90	0	X
19251	Nlh2	349	187	58	0	X
27	hirudin	349	0	0	0	X
15129	SH3	348	242	58	0	X
15349	Nck1-2 SH3	348	263	58	0	X
19915	cold shock protein, TaCsp	348	155	66	0	X
4279	Centruroides sculpturatus Ewing Toxin I	348	0	0	0	X
19916	cold shock protein, TaCsp with dT7	348	155	66	0	X
11595	Zalpha domain	348	169	70	0	X
10297	Transcription factor 8	348	264	62	0	X
5466	Cytochrome c, iso-1	348	0	72	0	X
5005	oxidized yeast iso-2 cytochrome c	348	418	104	0	X
18423	holoprotein	348	0	135	0	X
6175	F-spondin TSR domain 1	348	243	64	0	X
6302	Four-helix bundle model	348	0	0	0	X
26871	Dpo4 Binary	348	927	294	0	X
6649	Sporulation-specific N-acetylmuramoyl-L-alanine amidase (E.C.3.5.1.28)	348	212	72	0	X
5043	Lamina-Associated Polypeptide 2	347	0	0	0	X
11274	ETEA protein	347	251	68	0	X
4391	candoxin	347	182	66	0	X
27058	MOAG-4	347	314	79	0	X
15014	hTraf6 2Zn	347	256	61	0	X
17301	Sso7c4	347	0	55	0	X
4868	BPTI-R52	347	0	0	0	X
19403	Clip-segment of the von Willebrand domain 1 of Crossveinless 2	347	195	63	0	X
15384	4HB homodimer	347	177	61	0	X
394	P22 arc repressor	347	0	0	0	X
36049	Envelope small membrane protein	346	274	65	0	X
16833	WR73	346	602	189	0	X
4619	Human immunodeficiency virus type 2 integrase	346	184	62	0	X
30039	Antibacterial factor-related peptide 2	346	197	59	0	X
11335	Cell growth regulator with RING finger domain protein 1	346	245	63	0	X
16207	NmerA	346	173	62	0	X
4389	Ribosome Recycling Factor	346	357	173	0	X
18917	tstm1395	346	262	67	0	X
25734	TBK1 recruitment to cytosol-invading Salmonella induces anti-bacterial autophagy	345	174	49	0	X
6926	TSP9	345	313	87	0	X
34095	Tumor protein 63	345	113	61	0	X
5064	GABAA receptor associated protein	345	343	91	0	X
19698	preQ1 Class II riboswitch from Streptococcus pneumoniae	345	245	20	0			X
6915	Dendroaspin monomer	345	0	59	0	X
5948	Disintegrin kistrin, AKGDWN Mutant	345	0	64	0	X
30157	Phosphocarrier protein NPr (E.C.2.7.11.-)	345	312	88	0	X
26815	HSC70-NBD / ADP	345	1057	341	0	X
4926	chymotrypsin inhibitor 2	345	0	63	0	X
17321	W protein of bacteriophage lambda	345	203	61	0	X
18642	Protein	344	256	62	0	X
18782	Solution structure of the QUA1 dimerization domain of pXqua, the Xenopus ortholog of Quaking.	344	246	52	0	X
6266	Copper transport protein ATOX1	344	0	66	0	X
4930	Human Trefoil Factor Family 1 protein homodimer	344	0	59	0	X
5711	Biotinoyl domain of HP0371	344	211	68	0	X
17909	StarD5	344	705	190	0	X
6854	the first SH3 domain of Nck	344	182	67	0	X
4329	E.coli Transhydrogenase domain III	344	343	164	0	X
17203	Acyl carrier protein	344	299	74	0	X
15940	Saccharomyces cerevisiae V(1)V(O) ATPase	344	237	55	0	X
4933	Human Trefoil Factor Family 1 protein	344	0	59	0	X
11312	Zinc finger protein 64, isoforms 1	344	249	51	0	X
19713	Domain-Swapped GLPG	343	193	69	0	X
17882	CssII	343	0	0	0	X
5949	Disintegrin kistrin, ARGDWN Mutant	343	0	64	0	X
16620	hs00184	343	244	60	0	X
4873	(30-51)Ser BPTI folding intermediate	343	0	54	0	X
11276	CUE domain-containing protein 1	343	261	64	0	X
11299	Proline-serine-threonine phosphatase-interacting protein 1	343	256	65	0	X
11093	Tyrosine-protein kinase ITK/TSK (E.C.2.7.10.2)	343	245	46	0	X
4159	Long Neurotoxin 1 (Component LSIII)	343	0	0	0	X
5940	third domain of the interleukin-6 receptor	342	393	103	0	X
25837	chromodomain 3 (CD3) of cpSRP43	342	242	67	0	X
19666	DC1A	342	245	60	0	X
18225	AR55	342	281	70	0	X
5867	INTERSECTIN 2	342	289	67	0	X
4067	brazzein	342	126	0	0	X
5617	Bowman-Birk inhibitor from snail medic seeds (Medicago Scutellata) (MSTI)	342	0	0	0	X
17912	third SH3 domain of R85FL	342	229	66	0	X
4272	synaptobrevinII cytoplasmic domain residues 1-96	341	351	86	0	X
6097	U1C zinc finger domain	341	0	0	0	X
5335	YacG	341	256	61	0	X
18680	LmCsp	341	239	72	0	X
4987	maltodextrin-binding protein	341	1043	341	0	X
19036	Calmodulin/a-syn peptide complex	341	308	157	0	X
6209	N-domain of At3g03410.1	341	261	69	0	X
7400	Rhodostoxin-disintegrin_rhodostomin	340	0	67	0	X
17475	Structural basis of p63a SAM domain mutants involved in AEC syndrome	340	157	75	0	X
19328	HR7375C	340	251	62	0	X
27588	ANSII homotetramer	340	561	186	0	X
25890	DNA free	340	0	0	0		X
16157	Parvulustat	340	250	70	0	X
34457	Voltage-dependent anion-selective channel protein 1	340	739	255	0	X
27646	KRas-G12C(1-169)-GDP	340	619	164	0	X
30192	Protein SinI	340	252	51	0	X
5682	30S ribosomal protein S27e	340	239	58	0	X
27036	prr7 dissordered protein	340	273	74	0	X
19260	RNA_(48-MER)	339	247	32	0			X
15863	EAS D15	339	0	72	0	X
18301	MBD2	339	281	69	0	X
4120	TYMV pseudoknot	339	297	0	0			X
1479	complement factor H	339	0	0	0	X
34334	UPF0339 family protein	339	235	63	0	X
30024	RaCI2	339	203	62	0	X
18562	VvMARTX	339	323	73	0	X
7174	Hdm2 RING finger domain	339	97	65	0	X
5052	neurotoxin II	339	0	0	0	X
5583	MHC CLASS II-ASSOCIATED P41 INVARIANT CHAIN FRAGMENT (P41icf)	339	0	0	0	X
26745	SrtC1 monomer	339	310	192	0	X
25857	Aureocin A53	339	0	0	0	X
17765	EAS	338	0	0	0	X
19841	Ptr ToxB	338	192	69	0	X
4447	p23fyp	338	494	161	0	X
30310	XPH2	338	227	64	0	X
19191	eIF4E	338	262	60	0	X
4910	LEKTI domain one	338	0	51	0	X
15419	RPA3401	338	249	57	0	X
25647	p75-TMDCD/DPC	338	245	61	0	X
18503	RNA (49-MER)	338	234	64	0			X
16228	ubiquitin	338	323	80	0	X
5088	Hydrogenobacter thermophilus cytochrome c-552	338	0	0	0	X
18227	AR55	338	271	70	0	X
19821	Stf76 from the Sulfolobus islandicus plasmid-virus pSSVx	338	77	77	0	X
19914	KDM5B PHD1 finger in complex with H3K4me0(1-10aa)	338	165	51	0	X
1675	kappa-bungarotoxin	337	0	0	0	X
25693	xcL1	337	257	62	0	X
62	thioredoxin	337	0	0	0	X
19845	Coronavirus Envelope Proteins-1	337	260	63	0	X
15418	Complex of S100A6 and SIP(189-219)	337	295	113	0	X
18103	G_protein_alphai3_subunit	337	1000	337	0	X
4877	(30-51, 5-38)Ser BPTI folding intermediate	337	0	0	0	X
19390	EBNA-2 N-terminal Dimerization (END) domain	337	211	54	0	X
15350	sr478 dimer	337	244	72	0	X
11301	Cell division cycle 5-like protein	337	249	56	0	X
30316	Interleukin-8	337	251	61	0	X
27833	tEIN	337	807	229	0	X
11318	Cdc42-interacting protein 4	337	257	61	0	X
5709	TPR domain of hSGT	336	342	115	0	X
6335	redox-switch domain of Hsp33	336	242	63	0	X
6477	Telomerase RNA P2b-P3 pseudoknot	336	273	73	0			X
15490	NusG	336	254	54	0	X
25646	p75-TMICD/LPN	336	0	0	0	X
17813	NMR structure of the UHRF1 PHD domain	336	248	64	0	X
6102	Hypothetical UPF0250 protein ybeD	336	157	78	0	X
27096	apo_AFABP	336	0	123	0	X
4218	Toxin 2 from Centruroides noxius hoffmann	336	0	0	0	X
25891	PARP-1_F1F2F3-DNA_complex	335	348	335	0	X	X
27469	PETNR:FMNox:NADPH4	335	1033	335	0	X
4986	maltodextrin-binding protein	335	1021	335	0	X
19753	Plectin repeat domain 6	335	662	195	0	X
6499	distinctin chain A/distinctin chain B	335	0	0	0	X
25827	metal-binding domain 1 of ATP7B	335	293	72	0	X
18679	LmCsp_dT7	335	232	73	0	X
30585	Histone-lysine N-methyltransferase 2D (E.C.2.1.1.43), Histone H4	334	219	58	0	X
34045	Phosphoprotein	334	245	53	0	X
18700	XIAP(RING)-binding domain of XAF1	334	237	57	0	X
6588	apolipoprotein A-I(1-186)	334	360	173	0	X
19693	oxidized dimeric form of human defensin 5	334	236	62	0	X
15180	Spinophilin PP1 binding domain	334	302	68	0	X
25772	Elafin	334	0	0	0	X
15382	Huwentoxin-xi	334	0	0	0	X
27470	PETNR:FMNox:NADH4	334	1029	334	0	X
16137	AIDA1	333	257	61	0	X
6850	PRP40 FF1	333	182	65	0	X
18424	holoprotein	333	0	135	0	X
16160	MYPT1 1-98 monomer	333	380	92	0	X
19074	DidoPHD/H3K4me3	333	266	66	0	X
5238	heparin-binding domain of vascular endothelial growth factor-165	333	0	55	0	X
19303	(HhH)2 domain of human FAAP24	333	196	56	0	X
4680	C-terminal domain of MLTD	333	219	61	0	X
16544	RECQL4	333	243	52	0	X
5056	Arabidopsis thaliana trypsin/chymotrypsin inhibitor	333	237	68	0	X
5236	RCK4	333	0	76	0	X
11031	pHtrII	333	243	66	0	X
27224	PETNR FMNox	333	1028	333	0	X
17285	PHD finger (PHD1) from CHD4 (Mi2b)	332	215	55	0	X
25892	PARP-1_F1F2F3	332	350	332	0	X
4457	E-cadherin	332	321	167	0	X
27249	pMHC	332	801	233	0	X
5029	Centruroides sculpturatus Ewing, toxin variant 5	332	0	0	0	X
16138	34-MER, SILVER ION	332	0	0	0		X
15825	PsR76A	332	246	59	0	X
1162	bacteriorhodopsin	332	0	0	0	X
16587	W60G beta2-microglobulin	332	0	65	0	X
4891	chinese cobrotoxin	331	0	0	0	X
17898	CylR2	331	186	69	0	X
19312	hr4784b	331	253	62	0	X
25665	cMSD1	331	734	176	0	X
17210	NBD(1-392)	331	1026	331	0	X
17896	CylR2	331	186	69	0	X
34355	Cadmium-metallothionein	331	167	63	0	X
19816	C-domain of troponin C bound to the anchoring region of troponin I	331	216	70	0	X
26564	DbhS C31S monomer	331	868	276	0	X
30559	PSHCP	331	247	61	0	X
5300	ORF C32E8.3	331	496	175	0	X
6680	A219 monomer	331	181	68	0	X
18221	FAM14B	330	350	107	0	X
18874	ING4 PHD mutant N214D	330	0	61	0	X
4348	Nitrogen Regulatory protein C-C-term-3Ala	330	281	77	0	X
34356	Cadmium-metallothionein	330	167	62	0	X
6579	JX EGFR monomer	330	238	51	0	X
6229	Thermus Thermophilus Dnak Nucleotide binding domain	330	1009	330	0	X
15173	SMRT-MYND	330	248	73	0	X
25468	PDFL2.1	330	161	55	0	X
5861	gtpase domain MnmE	329	462	159	0	X
11260	ubiquitin associated protein	329	245	57	0	X
26995	chd	329	249	55	0	X
19542	Mambalgin-2	329	143	58	0	X
6571	theta	329	270	69	0	X
4784	Tyrosine repressor	329	0	63	0	X
6542	Arginine kinase	328	662	328	0	X
4571	RPB10	328	243	54	0	X
11298	TFIIH basal transcription factor complex p62 subunit	328	242	58	0	X
4033	Estrogen Related Receptor	328	0	69	0	X
19800	PrgK first periplasmic domain	328	250	57	0	X
18863	MS1	328	278	78	0	X
5604	ZNTA (E.C.3.6.3.3/E.C.3.6.3.5)	328	0	72	0	X
17208	NBD(1-388)	328	1015	328	0	X
48	basic pancreatic trypsin inhibitor	328	0	0	0	X
30239	Uncharacterized protein	328	164	62	0	X
30511	Protein Tat/RNA Complex	328	134	47	0	X		X
421	complement protein C5a	328	0	0	0	X
5753	Genome polyprotein [Core protein P3A]	328	253	67	0	X
16876	ERD14	328	532	182	0	X
7354	LAC_REPRESSOR	328	248	70	0	X	X
4584	DNA BINDING DOMAIN OF THE TRAM PROTEIN	327	0	62	0	X
4065	designed four-alpha-helix bundle protein	327	263	60	0	X
25755	non-sweet mutant (ins18RI19) of sweet protein Brazzein	327	159	59	0	X
5761	gamma-adaptin ear domain	327	330	105	0	X
18374	AIRE-PHD2	327	192	62	0	X
11327	Ubiquitin ligase TRIM63	327	243	54	0	X
36180	Thioredoxin (H-type,TRX-H)	327	188	95	0	X
25729	EGFR transmembrane and juxtamembrane domains	327	246	57	0	X
17603	T4_L99A/G113A/R119P	327	474	159	0	X
4832	GROWTH-FACTOR IGF-1	327	0	0	0	X
16721	BRD1 PHD1 finger	327	223	65	0	X
17209	NBD(1-388)	326	685	326	0	X
19319	RasGRP2 EF hands bound to calcium	326	303	77	0	X
16497	Integrin aIIbb3 transmembrane complex	326	203	71	0	X
6478	Transition state regulatory protein abrB	326	222	55	0	X
4210	hTRF1	326	0	0	0	X
18947	SpnDE1	326	237	65	0	X
4875	(30-51, 5-14)Ser BPTI folding intermediate	326	0	0	0	X
11024	VRAR DNA binding domain	326	256	60	0	X
15930	4 sigma70	326	279	101	0	X
5900	complement receptor type 1	326	0	61	0	X
25532	Gag	326	1013	326	0	X
4281	AbrBN	325	238	54	0	X
10002	F-spondin TSR4	325	229	58	0	X
18910	NMR solution structure of the AVR3a11 from Phytophthora Capsici	325	205	58	0	X
15309	cardiotoxin A5	325	0	0	0	X
5199	necrosis inducing protein	325	0	65	0	X
4929	Tctex1 dimer	325	403	110	0	X
18524	DNA_OUH	325	130	0	0		X
27355	AHNAK	325	315	94	0	X
2283	toxin AaH III	325	0	0	0	X
15087	PABC monomer	325	0	78	0	X
4639	human Rap1	325	0	0	0	X
19605	PASTA domain of PonA2	324	245	61	0	X
18339	FTSA	324	1049	324	0	X
18958	Integrin L Transmembrane Domain	324	170	54	0	X
30452	DAB-VAL-ARG-THR-ARG-LYS-GLY-ARG-ARG-ILE-NOR-ILE-DPR-PRO/RNA Complex	324	171	11	0	X		X
15305	cardiotoxin A3	324	0	0	0	X
18226	AR55	324	267	70	0	X
17063	hPgn (K57D)rK3	324	0	91	0	X
4037	periplasmic cyclophilin type cys-trans peptidyl-prolyl isomerase	323	328	153	0	X
27476	Cardiac troponin I	323	307	74	0	X
18224	AR55	323	271	70	0	X
11173	Ubiquitin carboxyl-terminal hydrolase 5	323	249	57	0	X
2208	cyclophilin	323	318	156	0	X
5325	Plant nsLTP2	323	0	0	0	X
16771	alphaIIb_beta3	323	231	62	0	X
34170	NFAP	323	218	59	0	X
15793	CopR-NTD	323	230	52	0	X
15726	La NTD apo	323	479	172	0	X
16518	Tc GPXI monomer	323	473	149	0	X
16676	Oryctin	323	238	64	0	X
17689	Uracil-DNA glycosylase inhibitor p56	323	0	58	0	X
19710	CDYL2 chromodomain	322	232	54	0	X
18531	GB3	322	185	54	0	X
19082	thymidylate_synthase	322	774	230	0	X
5101	ubiquitin fragment	322	174	49	0	X
440	complement protein C3a	322	0	0	0	X
5375	anneal10_2	322	0	0	0	X
25102	rubredoxin domain of the NO Reductase Flavorubredoxin	322	0	54	0	X
4950	HIV-1 Nef	322	0	0	0	X
30389	M protein	321	236	54	0	X
25973	V26A mutant of Ubiquitin at pH 2.0	321	302	71	0	X
5555	Chromodomain helicase-DNA-binding protein 4	321	0	50	0	X
6822	hypothetical protein AF1503	321	229	55	0	X
10214	Membrane-associated guanylate kinase	321	253	57	0	X
6747	50S ribosomal protein L40e	321	235	47	0	X
19208	Arginine kinase transition state analogue complex	321	963	320	0	X
11377	POZ-, AT hook-, and zinc finger-containing protein 1	321	237	53	0	X
25753	sweeter mutant (D40K) of sweet protein Brazzein	321	156	57	0	X
16215	wt-brazzein	321	221	59	0	X
27631	TAX/HLA-A*02:01/human beta2m	320	796	235	0	X
5621	yoag_ecoli	320	180	64	0	X
19840	ToxB	320	186	62	0	X
16141	HACS1 SH3 domain	320	249	60	0	X
25972	V26A mutant of Ubiquitin at pH 6.0	320	305	70	0	X
30379	Sodium/calcium exchanger 1	320	258	62	0	X
5514	GFPuv	319	536	184	0	X
18437	gpFI C-terminal domain	319	187	60	0	X
10048	Tudor domain containing protein 3	319	237	59	0	X
25376	RING Domain of human Promyelocytic Leukemia Protein (PML)	319	173	57	0	X
17106	36-MER, 7-DEAZA-7-AMINOMETHYL-GUANINE	319	229	67	0			X
18097	rhesus SPRY domain	319	326	143	0	X
30532	Immunoglobulin G-binding protein G	319	242	62	0	X
6016	beta-site APP Cleaving Enzyme 1	319	917	324	0	X
26804	POTRA1-5	319	0	319	0	X
4223	TATA box binding protein associated factor II 230	318	239	69	0	X
6069	Precarnobacteriocin B2	318	173	74	0	X
5073	macrophage inflammatory protein 1-beta (MIP-1beta)	318	190	62	0	X
18051	myb-like1 domain of hDMP1	318	230	57	0	X
16966	DEBS_ACP6	318	243	79	0	X
25897	Holo F2 TnC	318	462	153	0	X
5956	Max*VL homodimer	318	239	75	0	X
36114	WW domain with PPxY motif	318	170	56	0	X
19416	Rrp7 C-terminal Domain	318	218	49	0	X
17763	TdPI	318	0	0	0	X
4968	Bovine Pancreatic Trypsin Inhibitor monomer	318	119	52	0	X
27452	env9b_SAH	318	313	126	0			X
25593	HER2/ErbB2 dimeric transmembrane domain	318	219	54	0	X
19558	Crc	318	825	235	0	X
27177	Coronavirus nsp1 truncated proteins; nsp1(13-50)	318	330	112	0	X
19473	Sp140 PHD finger cis conformer	318	159	53	0	X
16567	Nab3 RRM	318	201	60	0	X
4735	olfactory marker protein	317	453	150	0	X
17825	HSJ1a	317	185	66	0	X
15811	S27A	317	224	51	0	X
11328	Zinc finger FYVE domain-containing protein 19	317	232	53	0	X
6139	Oela europea pollen allergen ole e 6	317	0	52	0	X
17779	the intermediate IIIb of the TdPI-short	317	0	0	0	X
4257	Vpr_HIV-1_(LAI)	317	0	0	0	X
4200	c-Myc-Max Heterodimeric Leucine Zipper	317	0	0	0	X
18778	LIMD2	317	161	64	0	X
27880	RYMV P1	317	422	152	0	X
1657	ribonuclease H	317	122	148	0	X
19444	murine norovirus CR6 NS1/2 protein	317	109	52	0	X
16636	ComAC	317	292	69	0	X
26579	hLCN2-R-NTD	316	255	88	0	X
27380	ataxin-3	316	316	316	0	X
1378	epidermal growth factor	316	0	0	0	X
25909	in vitro GB1	316	251	62	0	X
17804	AAT	316	966	316	0	X
16877	PROTEIN/RNA Complex	316	0	0	0	X		X
16381	VDAC-1	316	513	233	0	X
15916	ATU0232	316	235	59	0	X
25143	RING finger of the tripartite 19	316	176	57	0	X
25541	MyUb (1080-1122) of human Myosin VI	316	232	55	0	X
18299	K60A mutant of Atox1	316	259	68	0	X
6916	Protein E7	316	241	56	0	X
15555	SPINK2 monomer	315	0	0	0	X
18971	WW3*-aENaC PY peptide complex	315	219	60	0	X
16210	JARID1A PHD finger 3	315	203	58	0	X
25858	Lacticin Q	315	0	0	0	X
4123	second PDZ domain from human phosphatase hPTP1E	315	173	91	0	X
11018	Itk SH3	315	261	69	0	X
36075	Synaptotagmin-like protein 4	315	246	55	0	X
15178	RGS3	315	418	140	0	X
27691	Boman26A	315	953	316	0	X
16031	Nav1.5	315	296	97	0	X
16664	lambda lysozyme	315	302	151	0	X
18327	atypical SH3 domain of DOCK180	314	177	57	0	X
49	basic pancreatic trypsin inhibitor	314	0	0	0	X
16901	Human Relaxin-like Factor	314	48	5	0	X
27520	shp2-fl-iso2-dC	314	772	314	0	X
7101	Designed protein TOP7	314	223	59	0	X
27236	hTE-CCR monomer	314	324	118	0	X
18654	Single-chain Insulin	314	191	54	0	X
5747	Homodimeric Alpha2 Four-Helix Bundle	313	0	0	0	X
7265	Cex catalytic domain	313	631	308	0	X
16354	A1AO ATP synthase	313	155	52	0	X
5672	Neurotoxin 5	313	0	0	0	X
4899	SMN tudor domain	313	188	61	0	X
17609	Hr4436B	313	238	67	0	X
26940	LITAF delta114-139	313	380	126	0	X
16350	pheromone En-A1	313	167	0	0	X
30031	E3 ubiquitin-protein ligase Midline-1 (E.C.6.3.2.-)	313	231	52	0	X
19472	Sp140 PHD finger trans conformer	313	159	52	0	X
5305	Peptidyl-prolyl cis-trans isomerase NIMA-interacting 1	313	462	154	0	X
15098	CHROMODOMAIN-HELICASE-DNA-BINDING PROTEIN 8	312	241	53	0	X
25851	TRIM24 PHD-Bromo	312	327	154	0	X
27682	NIH:H-2Ld:hb2m	312	765	235	0	X
6179	LEKTI Domain 15 short	312	0	51	0	X
18219	TMEM14A	312	350	97	0	X
25656	Translation initiation factor IF-1 from Burkholderia thailandensis E264	312	281	71	0	X
19814	mPanx1CT(374-426)	312	231	54	0	X
17720	NGlpG	312	251	68	0	X
18220	TMEM14A	312	350	97	0	X
7185	Positive cofactor 2 glutamine/Q-rich-associated protein	312	254	75	0	X
16719	Crammer	311	215	73	0	X
4029	Sxl-RBD1+2	311	297	149	0	X
18945	k-Ssm1a	311	209	63	0	X
26923	RCL	311	554	228	0	X
4424	ribonuclease HI	311	190	58	0	X
16484	CIP75_UBA	311	162	58	0	X
4637	MATING-TYPE PROTEIN A-1	311	119	58	0	X
15058	En-6 monomer	310	0	0	0	X
30372	Sm2a toxin	310	115	43	0	X
6172	apo ScAtx1	310	0	67	0	X
27835	HRduo mPrP	310	169	106	0	X
4470	ThiS	310	186	63	0	X
25221	PHD domain of Yeast YNG2	310	213	49	0	X
5151	IgG-binding (B1) domain of Streptococcal protein G	310	0	0	0	X
5025	ALPHA-BUNGAROTOXIN/ACETYLCHOLINE RECEPTOR PROTEIN (ALPHA CHAIN) COMPLEX	309	0	15	0	X
18265	WIP C-terminal domain	309	325	111	0	X
34123	Loquacious	309	142	59	0	X
6238	ZZ domain of CBP	309	222	56	0	X
25609	RsAFP2	309	142	51	0	X
15537	Gb88	309	247	57	0	X
15742	CsmA	309	0	64	0	X
11341	Tripartite motif-containing protein 39	309	234	53	0	X
15123	Ntail	309	162	70	0	X
27392	DnaK	309	943	309	0	X
11282	Protein FAM100B	309	234	63	0	X
395	P22 arc repressor	309	0	0	0	X
17753	HR3111A dimer	309	236	51	0	X
17188	35-MER	309	235	61	0			X
4622	UvrB C-terminal domain	308	190	64	0	X
36081	retracted phosphorylated ubiquitin	308	282	65	0	X
10150	SPCC24B10.08c protein	308	240	61	0	X
10012	troponin complex	308	195	49	0	X
17803	InsulinGR	308	145	0	0	X
25856	translation initiation factor from Staphylococcus aureus Mu50	308	269	65	0	X
18010	FF11-60	308	217	51	0	X
4422	Apis mellifera chymotrypsin inhibitor	308	0	0	0	X
6543	HIV-1 frameshift inducing RNA	308	91	24	0			X
34044	Bacteriocin BacSp222	308	228	55	0	X
6014	matrilysin	308	464	147	0	X
6223	YCD dimer	308	424	145	0	X
16556	SCO3027	308	234	51	0	X
5944	CD4 cytoplasmic tail - Lck N terminus	307	195	55	0	X
17391	protein from Haloferax volcanii	307	183	75	0	X
16139	caskinSH3	307	246	55	0	X
17358	nectin-1	307	170	84	0	X
25605	HsAFP1	307	99	39	0	X
5348	ati monomer	307	0	0	0	X
34087	Insulin	307	0	0	0	X
25661	rna-ligand complex	307	265	117	7			X
6890	dNedd4 WW3* Domain - Comm PY Motif Complex	307	151	46	0	X
11529	a regulatory domain of meiosis inhibitor	307	225	50	0	X
18581	gp78 CUE domain	306	231	53	0	X
18527	beta tubulin 394-445	306	0	0	0	X
1729	epidermal growth factor	306	0	0	0	X
19740	CYP101	306	960	297	0	X
18893	d3'-hairpin of the group II intron Sc.ai5gamma including EBS1 bound to IBS1	306	78	13	0			X
19237	AhPDF1 from Arabidopsis halleri	306	128	30	0	X
18789	Kunitz-type neurotoxin LmKKT-1a	306	157	58	0	X
19771	CPEB1ZZ	306	173	59	0	X
15857	29-MER	306	77	13	0			X
17703	RDE-4DC	306	775	229	0	X
16094	anntoxin	306	0	0	0	X
30390	M protein	306	239	55	0	X
16363	CBP	306	236	49	0	X
30579	Vicilin	306	90	46	0	X
42	ovomucoid third domain	305	0	0	0	X
4071	Antifungal Protein 1	305	0	0	0	X
6399	TPR domain in p67phox	305	675	215	0	X
19439	murine norovirus NS1/2 CW3 WT	305	108	51	0	X
1674	epidermal growth factor	305	0	0	0	X
18941	LFA-1 I-Domain	305	447	175	0	X
16319	Carnocyclin_A	305	260	64	0	X
6303	Four-helix bundle	305	0	0	0	X
34084	UpsB-Q-1 DNA (34-MER)	305	0	0	0		X
19506	Human eRF1	305	516	299	0	X
25634	ABD monomer	305	214	53	0	X
1743	cro repressor	304	0	62	0	X
17419	HTH-TYPE TRANSCRIPTIONAL REPRESSOR CYTR	304	169	62	0	X
7264	Cex catalytic domain	304	939	301	0	X
25875	C-terminus F2 TnC	304	205	66	0	X
5383	IP-10	304	0	0	0	X
25140	apo EL_LovR	304	186	68	0	X
19185	PilA	304	221	58	0	X
34398	DNA (5'-D(CPGPTPCPTPCPAPTPGPAPTPAPCPG)-3')	304	0	0	0		X
36165	Integrin beta-2	304	235	56	0	X
17634	Cytidine Repressor DNA-Binding Domain	304	169	62	0	X
15476	SR384-1-46	304	221	52	0	X
25213	High-resolution NMR structures of the domains of Saccheromyces cerevisiae Tho1	304	175	48	0	X
15739	hydramacin-1	304	172	62	0	X
11347	PHD finger protein 21A	303	224	50	0	X
18246	porcine pepsin	303	928	303	0	X
27321	hZIP4 ICL2	303	350	82	0	X
18501	NEDD4L WW2 domain in complex with a Smad7 derived peptide	303	0	0	0	X
19197	C-terminal structure of (Y81F)-EhCaBP1	303	266	68	0	X
34151	Inactive poly [ADP-ribose] polymerase RCD1	303	245	60	0	X
5684	MTH1821 monomer	303	274	90	0	X
18497	autoinhibitory domain of human AMP-activated protein kinase catalytic subunit	303	231	62	0	X
11034	SpoVTN dimer	303	241	49	0	X
30030	CDC48-associated ubiquitin-like/zinc finger protein 1	303	219	62	0	X
30510	Protein Tat/RNA Complex	303	120	20	0	X		X
4163	Aesculus hippocastanum Antimicrobial Protein 1	303	0	0	0	X
27565	TMEM106B	303	179	88	0	X
1634	calmodulin	303	296	147	0	X
547	calmodulin	303	296	147	0	X
19657	Penicillium Antifungal Protein PAF	303	203	59	0	X
17435	C-terminal domain of Salmonella H-NS	302	173	51	0	X
18912	ADAM17	302	8	63	0	X
11016	Lysarg	302	0	0	0	X
15761	JHP0511	302	242	56	0	X
16035	BamC	302	929	302	0	X
19880	Copsin	302	161	67	0	X
19660	pmf-g	302	171	56	0	X
17639	Ebolavirus Fusion Loop pH 7.0	302	228	58	0	X
16808	HR3057H	302	233	54	0	X
10024	PufX	302	133	74	0	X
34061	Protein PCF11	301	228	52	0	X
19015	Galphai3 bound to GDP	301	925	301	0	X
7386	homeobox	301	164	45	0	X
26889	bound chains A and B	301	179	0	0	X
34083	UpsB-Q-1, DNA (34-MER)	301	0	0	0		X
29	phosphocarrier protein HPr	300	0	0	0	X
34113	Defensin-1	300	200	51	0	X
19743	Pseudomonas aeruginosa Dimethylarginine Dimethylaminohydrolase	300	486	236	0	X
5237	Type II R67 Dihydrofolate Reductase	300	161	66	0	X
19287	NACI	300	184	58	0	X
18710	recombinant brazzein	300	223	59	0	X
10338	Ubiquitin carboxyl-terminal hydrolase 5	300	235	53	0	X
15691	RelB	300	0	52	0	X
15550	hPCIF1 WW domain monomer	300	187	52	0	X
18935	African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA	300	571	165	0	X	X
5930	aADT	299	290	145	0	X
7010	Merozoite surface protein 1	299	0	0	0	X
17841	GB98-T25I,L20A	299	238	59	0	X
34345	Big defensin 1	299	98	53	0	X
26535	PmrA-DNA complex	299	502	200	0	X
19818	metNgb	299	427	140	0	X
7258	Protein PB1-F2 (50-87)	299	0	0	0	X
5152	IMMUNOGLOBULIN G BINDING PROTEIN G	299	0	0	0	X
18588	Tyr_tRNA_Synthase	299	900	299	0	X
16116	Ga95	299	234	59	0	X
6038	Small inducible cytokine B11	298	0	0	0	X
17415	cytochrome P450cam	298	596	295	0	X
15408	delta1.5	298	241	61	0	X
30005	Protein phosphatase 1 regulatory subunit 12A	298	206	50	0	X
18677	RING domain in ubiquitin ligase gp78	298	232	70	0	X
19815	COILED COIL DOMAIN OF Protein phosphatase 1 regulatory subunit 12A	298	206	50	0	X
25924	Drosha Quad	298	298	67	0	X
5801	T1E	298	0	56	0	X
6945	PSD-1	298	211	60	0	X
4928	WSTF-PHD	298	202	49	0	X
4393	spectrin	298	301	149	0	X
26942	Hup	298	322	85	0	X
6609	dendritic cell-derived ubiquitin-like protein	298	176	84	0	X
34160	Growth hormone receptor	297	226	45	0	X
18924	chain_A	297	0	0	0	X
1696	micrococcal nuclease	297	165	33	0	X
1517	transcriptional activator GAL4	297	0	0	0	X
25298	Tetramerization domain of the Ciona intestinalis p53/p73-b transcription factor protein	297	218	46	0	X
34164	Growth hormone receptor	297	226	45	0	X
16915	Human Insulin Mutant A22Gly-B31Lys-B32Arg	297	0	0	0	X
11583	P2XHD monomer	297	227	56	0	X
19799	LysM the peptidoglycan binding domain of autolysin AtlA from Enterococcus faecalis	297	230	59	0	X
5469	omsvp3 monomer	297	0	0	0	X
25260	human insulin	297	131	40	0	X
19789	N domain of cardiac troponin C bound to the switch fragment of fast skeletal troponin I	296	94	82	0	X
18380	dvCcmE'	296	270	93	0	X
4487	API	296	0	0	0	X
34112	Competence protein ComGC	296	236	61	0	X
11443	Sequestosome-1	296	219	51	0	X
5065	CYSTEINE-RICH PROTEIN 2	296	231	56	0	X
11149	p62 UBA domain	296	219	51	0	X
4795	human D187N gelsolin domain 2	296	201	94	0	X
287	transcriptional regulator ner	296	0	67	0	X
26001	antifungal protein sfPAFB	296	195	58	0	X
16162	beta1D integrin tail	295	0	60	0	X
16537	UCH-L1	295	597	203	0	X
19181	PorH	295	0	66	0	X
30567	Myb family DNA-binding protein shaqkyf family	295	0	0	0	X
6814	Class I RNA aptamer to GTP	295	0	0	0			X
26532	PmrA dimer	295	684	193	0	X
34070	Insulin	295	0	0	0	X
19438	Tgam	295	417	136	0	X
295	cytochrome b5	295	0	0	0	X
19484	tm67	295	0	0	0	X
6374	AIRE1-PHD1	295	201	61	0	X
4676	apomyoglobin pH 2.3	294	445	147	0	X
34149	Endothelial transcription factor GATA-2	294	178	64	0	X
11259	Toll-interacting protein	294	209	55	0	X
30088	Immunoglobulin G-binding protein G	294	224	65	0	X
25312	MBD1 CXXC1	294	0	62	0	X
7071	Kis antitoxin	294	241	80	0	X
7280	GB1 domain	294	167	63	0	X
30127	Flagellar protein FliT,Flagellum-specific ATP synthase (E.C.3.6.3.14)	294	500	139	0	X
5875	The B1 Domain of Streptococcal Protein G	294	175	61	0	X
25384	BecN-150CSY monomer	293	438	142	0	X
30611	Autonomous glycyl radical cofactor	293	76	57	0	X
5074	EMERIN	293	0	0	0	X
17108	Human Insulin Mutant	293	0	0	0	X
25145	B1 box monomer of the tripartite 19	293	195	54	0	X
5847	Sda	293	201	49	0	X
5470	p14c/n39c monomer	293	0	0	0	X
36097	FLN IG21 domain	293	159	87	0	X
4983	YUH1	293	1182	293	0	X
17897	CylR2	293	168	67	0	X
19099	human beta-2 microglobulin	292	308	76	0	X
34244	DNA (5'-D(CPGPTPCPTPCPAPTPGPAPTPAPCPG)-3')_major	292	0	0	0		X
18921	[L-HisB24] insulin analogue at pH 1.9	292	0	0	0	X
6691	PSI AB region free protein	292	0	60	0	X
5744	human alpha-synuclein	292	262	134	0	X
19052	Ebolavirus_Fusion_Loop_L529A/I544A	292	209	49	0	X
15003	PinA WW domain	292	145	49	0	X
19978	[AibB8,LysB28,ProB29]-insulin analogue	292	0	0	0	X
16117	Gb95	292	242	59	0	X
17820	IsdH-N2N3 monomer	292	878	292	0	X
15466	PinA WW domain	292	145	49	0	X
18767	Hug1	291	211	70	0	X
15333	Pirh2 RING domain	291	215	49	0	X
19486	Hr7298f	291	212	51	0	X
6252	EscJ protein	291	446	145	0	X
18514	MSL2	291	207	50	0	X
7290	PB(30-70)	291	0	0	0	X
17430	Arenicin-2 dimer	291	201	56	0	X
18245	porcine pepsin	291	613	291	0	X
50011	rsFolder	291	671	201	0	X
16169	Barnase	291	0	0	0	X
18920	Entamoeba histolytica HP1 chromodomain	290	234	65	0	X
19606	UBA Domain of Human NBR1	290	176	50	0	X
4922	unfolded apoplastocyanin	290	270	92	0	X
19051	calcium_channel_beta_subunit	290	900	292	0	X
5654	Immunoglobulin G binding protein G	290	250	61	0	X
19819	cyanometNgb	290	425	136	0	X
18490	TDRD3 complex	290	176	53	0	X
30108	riboswitch (47-MER)	290	240	19	0			X
25613	[B26-B29 triazole cross-linked]-insulin analogue	290	106	7	0	X
34014	Gallinacin-7	289	136	43	0	X
25509	APOBEC3G NTD variant, sNTD	289	317	147	0	X
4907	Phospholamban (C41F)	289	0	0	0	X
25615	insulin analogue	289	0	0	0	X
132	dendroaspis	289	0	0	0	X
4498	GAG MPMV	289	110	55	0	X
26790	AvBD7	289	0	0	0	X
7327	En-2	289	66	0	0	X
45	basic pancreatic trypsin inhibitor	289	0	0	0	X
34431	KRAS32R G9T	289	167	13	0		X
17107	Human Insulin Mutant	289	0	0	0	X
18951	MYB-like DNA binding domain of KNL-2 from C. Elegans	289	170	47	0	X
15591	P62_UBA	288	227	53	0	X
15535	Ga88	288	238	56	0	X
26750	MycG-MIV complex	288	562	285	0	X
25044	Hug1	288	209	69	0	X
30194	HTH-type transcriptional regulator SinR	288	210	54	0	X
6250	G88W121	288	185	99	0	X
18881	d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid	288	56	41	0		X	X
26977	Beta-chain labeled B4.2.3 TCR	288	698	197	0	X
15744	Lipid-free human apolipoprotein E	288	579	288	0	X
25261	[GlnB22]-insulin mutant	288	0	0	0	X
18858	Biosynthetic engineered B28K-B29P human insulin monomer	287	0	0	0	X
4600	GAG Polyprotein	287	110	54	0	X
25835	OtTx1a - AMP in DPC micelles	287	125	0	0	X
4769	yeast ubiquitin	287	133	76	0	X
30033	Hge-scorpine	287	139	50	0	X
5459	EL5 RING-H2 finger domain	287	233	51	0	X
19592	Molecular Binding of TFF1 Estrogen Response Element	287	0	0	0		X
16663	HUMAN INSULIN MUTANT	287	0	0	0	X
16170	Barnase	287	0	0	0	X
25784	CssA Thermometer from Neisseria meningitidis	287	31	26	0			X
25405	C-terminal domain of MvaT	287	207	50	0	X
2204	echistatin	287	0	0	0	X
6679	G311	287	226	60	0	X
17840	GB98	286	213	56	0	X
17638	Ebolavirus Fusion Loop pH 5.5	286	137	48	0	X
16492	Anti-TRAP	286	223	53	0	X
34238	Alpha-S2-casein	286	0	0	0	X
2575	IgG Fc region-binding protein	286	0	0	0	X
5390	DNA-binding Protein H-NS	286	193	62	0	X
17938	CAP-Gly	286	247	86	0	X
4568	apomyoglobin	286	429	149	0	X
15682	Epidermal Growth Factor-like domain 2	286	218	54	0	X
19224	PTP1B	286	553	286	0	X
11367	spliceosomal protein SF3b155	285	206	42	0	X
2206	echistatin	285	0	0	0	X
19464	HicA	285	176	50	0	X
15105	clip monomer	285	213	50	0	X
4363	Metallothionein MTA	285	0	0	0	X
2061	echistatin	285	0	0	0	X
26978	MeCP2-DNA	285	266	72	0	X	X
34258	RNA-binding protein FUS/RNA Complex	285	155	47	0	X		X
30159	Phosphocarrier protein NPr (E.C.2.7.11.-), Phosphoenolpyruvate-protein phosphotransferase PtsP (E.C.2.7.3.9)	285	821	285	0	X
17204	ubiquitin-like small archaeal modifier protein	285	179	61	0	X
6695	FNR polypeptide	285	878	285	0	X
5092	beta2 subunit of BK channels	284	0	0	0	X
6291	hypothetical membrane protein ta0354_69_121	284	205	48	0	X
27586	alpha-synuclein	284	266	133	0	X
26951	USP7 catalytic domain	284	872	284	0	X
11343	RING finger and CHY zinc finger domain-containing protein 1	284	221	46	0	X
17003	N-terminal Vpr peptides	284	0	0	0	X
25504	Staphylococcus aureus FusB:EF-GC3 complex	283	246	283	0	X
15592	P62_UBA in complex with ubiquitin	283	227	53	0	X
7365	WW domain	283	131	50	0	X
4669	HEPATITIS C CAPSID PROTEIN	283	0	0	0	X
15464	Human Insulin Monomer	283	0	0	0	X
26746	GNAI1 monomer	283	962	282	0	X
18082	Calmodulin N-lobe bound with ER alpha peptide	283	157	78	0	X
27879	DnaB (double-)hexamer	283	721	191	0	X
5171	BPTI G37A, TRYPSIN INHIBITOR	283	0	0	0	X
18836	S-YibK-C	283	387	145	0	X
17930	monophosphorylated (747pY) beta3 integrin	283	212	50	0	X
18614	Myo10 anti-CC	283	155	51	0	X
4689	Human Growth Hormone	283	282	137	0	X
4740	MTH1184 monomer	283	127	68	0	X
2205	echistatin	283	0	0	0	X
16259	beta7 integrin tail	282	0	50	0	X
30220	Immunoglobulin G-binding protein G	282	221	61	0	X
5472	Ovomucoid Third Domain	282	205	60	0	X
34298	Secreted protein	282	115	67	0	X
16944	CpR82G	282	244	61	0	X
15534	c-Cbl_UBA	282	220	64	0	X
34437	Transcription activator BRG1	282	172	48	0	X
18153	thermomacin	282	125	67	0	X
17860	RNA (37-MER)	282	0	0	0			X
26751	2B4 TCR	282	827	282	0	X
4749	DNA THREE-WAY JUNCTION	282	0	0	0		X
65	trypsin inhibitor E	282	0	0	0	X
19383	Complete Internal Fusion Loop mutant I544A from Ebolavirus GP2	281	190	47	0	X
30580	Ribosome-inactivating protein luffin P1 (E.C.3.2.2.22)	281	103	44	0	X
18601	GGBP_unbound	281	542	281	0	X
6520	Pcf monomer	281	0	49	0	X
17643	YtvA Dimer	281	782	242	0	X
16026	INSULIN A CHAIN, INSULIN B CHAIN	281	0	0	0	X
1480	complement factor H	281	0	0	0	X
34108	Toll-like receptor 4	281	221	49	0	X
27277	CBM14	281	187	50	0	X
17931	biphosphorylated (747pY, 759pY) beta3 integrin	281	213	48	0	X
18222	TMEM141	281	197	103	0	X
34157	DNA (5'-D(CPGPAPTPGPTPAPCPAPTPCPG)-3')	281	131	0	22		X
3322	endoglucanase Cel45A	281	0	62	0	X
17544	second domain of human Nedd4L in complex with a doubly phosphorylated human Smad3 (res 178-189) derived peptide	281	98	33	0	X
6826	AbhN dimer	281	219	50	0	X
30289	Villin-4	280	253	66	0	X
16968	Derivative of HRF	280	58	0	0	X
5059	EC005	280	126	59	0	X
16667	TaITX-1	280	183	55	0	X
6592	Chromo2 domain of cpSRP43	280	0	52	0	X
6388	Penaeidin-4d	280	0	0	0	X
30221	Immunoglobulin G-binding protein G	280	240	61	0	X
16916	spMDD complex with ligands	280	855	280	0	X
15721	ATU1203	279	221	49	0	X
25352	Acidocin B	279	0	0	0	X
26766	USP7	279	883	279	0	X
18857	alpha-synuclein	279	270	134	0	X
17291	PYY	279	0	0	0	X
26936	nanobody 33	279	369	133	0	X
15501	human PCNA trimer	279	778	261	0	X
2546	dihydrolipoamide succinyltransferase	279	0	0	0	X
34289	metallothionein	279	203	53	0	X
4068	turkey ovomucoid third domain	278	191	56	0	X
11363	Zinc finger HIT domain containing protein 2	278	211	46	0	X
25718	Regnase-1 N-terminal domain	278	214	50	0	X
4226	lead-dependent ribozyme	278	206	92	0			X
15870	H1-47_subunit_A_ATP_synthase	278	160	49	0	X
25935	Membrane-bound mouse CD28 cytoplasmic tail	278	188	48	0	X
5917	translation	278	566	278	0	X
18515	RNA (37-MER)	277	0	0	0			X
2249	epidermal growth factor	277	0	0	0	X
34288	Uncharacterized protein	277	201	51	0	X
4367	OspA+1bh	277	813	277	0	X
17861	RNA (37-MER)	277	0	0	0			X
17932	monophosphorylated (747pY) beta3 integrin	277	0	50	0	X
19822	B25-(alpha, beta)-dehydro-phenylalanine insulin	277	138	39	0	X
17375	hPCNA trimer complexed with C-terminal region of p21	277	0	261	0	X
17396	Zn bound FCS domain of hPh1	276	198	46	0	X
17376	hPCNA trimer complexed with C-terminal region of p21	276	676	258	0	X
16395	M.HhaI-DNA-cofactor ternary complex	276	557	276	0	X
16343	INSULIN A CHAIN, INSULIN B CHAIN	276	0	0	0	X
17529	Nedd4LW3/smad3 complex	276	61	22	0	X
18749	Ligase 10C	276	227	61	0	X
6865	TRAP-TSR domain	276	150	51	0	X
17839	Ga98	276	213	56	0	X
6160	somatomedin B domain of vitronectin monomer	276	0	53	0	X
4012	Ribonuclease H1	276	138	138	0	X
15364	NCp8	276	163	54	0	X
7036	NCK2 3rd SH3	276	177	55	0	X
30422	Granulin-A	276	0	55	0	X
162	transforming growth factor	276	0	0	0	X
15753	ILTat1.24 C1 domain	276	0	0	0	X
6099	VP16ad	276	224	73	0	X
6506	Conkunitzin-S1	276	209	55	0	X
5473	Ovomucoid Third Domain	276	204	61	0	X
7384	Gag_polyprotein_(Pr55Gag)	276	163	54	0	X
4303	LH1b	276	0	0	0	X
25228	aSyn H50Q monomer	275	399	131	0	X
19460	ShK-like immunomodulatory peptide from Ancylostoma caninum	275	196	56	0	X
6205	insulin analogue	275	0	0	0	X
6204	insulin analogue	275	0	0	0	X
15374	rubrdoxin monomer	275	0	44	0	X
34293	metallothionein	275	188	51	0	X
6203	insulin analogue	275	0	0	0	X
4616	Light-harvesting protein b-875, beta chain	275	0	0	0	X
19083	SENP1	275	447	216	0	X
26843	NCP15 + Zncl2	275	296	104	0	X
3394	Jun leucine zipper domain	275	0	0	0	X
26000	delta-J-delta-K domain of EMCV IRES	274	0	0	0			X
27554	Hck	274	225	77	0	X
4906	C-terminal domain (44-84) of the inhibitor of F1 ATPase	274	180	54	0	X
26937	nanobody 39	274	359	133	0	X
34086	DNA (26-MER)	274	0	0	0		X
17625	Microvirin:mannobiose complex	274	397	121	0	X
19249	PAI subdomain of Sleeping Beauty transposase	274	0	54	0	X
34159	DNA (5'-D(CPGPAPTPGPTPAPCPAPTPCPG)-3')	274	131	0	22		X
34028	Putative uncharacterized protein	273	0	0	0	X
19522	Complex Between BCL-xL and the p53 Core Domain	273	646	209	0	X
26045	HHH_06	273	155	49	0	X
19885	SENP1	273	609	215	0	X
6059	Nore1	273	110	55	0	X
17471	p38_alpha	273	585	273	0	X
19520	BCL-xL in its p53-bound conformation	273	646	209	0	X
19193	(Y81F)-EhCaBP1	273	248	60	0	X
1377	epidermal growth factor	273	0	0	0	X
26858	BASV-U1	273	395	124	0	X
25247	FliFc-FliG complex	273	557	273	0	X
25238	Human Relaxin-2	273	87	0	0	X
27262	dsRBD1 of TAR RNA Binding Protein 2	272	225	97	0	X
19596	pdx1c	272	261	74	0	X
18804	ErbB1 (EGFR, HER1)	272	202	46	0	X
1208	cytochrome b5	272	0	0	0	X
11273	Protein KIAA0794	272	211	54	0	X
5962	wildtype domain 5 of the ai5gamma group II intron	272	97	41	0			X
15817	HPLC-12	272	279	60	0	X
16247	F1Fo ATP synthase	272	210	51	0	X
6320	U6 extended ISL	272	189	14	0			X
30132	Telomerase RNA P2ab	272	206	37	0			X
25674	MALT1 subunit 1	272	864	272	0	X
5773	HIV-1 STEM LOOP SL1 MONOMERIC RNA	272	237	0	0			X
15869	single polyribonucleotide	272	270	47	29			X
6836	HndAc domain	272	130	64	0	X
5370	beta alanine linked polyamide bound to purine tract DNA	272	0	0	0		X
15508	lipoyl domain	271	0	76	0	X
34397	DNA (5'-((DC5)PGPAPTPGPTPAPCPAPTPCP(DG3))-3')	271	0	0	0		X
19426	kv14_pep61	271	210	56	0	X
25219	UBM1 domain of human HUWE1/ARF-BP1	271	195	45	0	X
6969	S2-HR2 trimer	271	213	58	0	X
30222	Immunoglobulin G-binding protein G	271	230	61	0	X
19267	OEP16	271	443	150	0	X
19272	YopH	271	760	271	0	X
1207	cytochrome b5	271	0	0	0	X
30223	Immunoglobulin G-binding protein G	271	230	61	0	X
18318	CHCH5	271	264	73	0	X
6533	DNA binding domain of STPA	271	198	44	0	X
4168	Alpha-2-macroglobulin receptor binding domain	271	138	130	0	X
19196	(Y81F)-EhCaBP1	271	248	60	0	X
16294	Pru p 3 (nsLTP)	270	0	0	0	X
15840	RhR2	270	215	53	0	X
18400	CTD-StpA	270	182	43	0	X
16668	RhoA-GDP monomer	270	479	152	0	X
50126	PACSIN 1 domain SH3	270	216	70	0	X
6136	E. coli L-Arabinose Binding Protein	270	818	270	0	X
25223	mu-SLPTX3-Ssm6a	270	188	49	0	X
16592	BT9727_4915	270	149	53	0	X
25974	calcium-bound form of Penicillium antifungal protein (PAF)	270	0	52	0	X
16878	Reecognition of H3 by the PHD Finger	270	163	47	0	X
246	growth factor	270	0	0	0	X
66	trypsin inhibitor homologue K	269	0	0	0	X
25227	aSyn WT monomer	269	388	131	0	X
18132	THERMOSTABLE PROTEIN FROM HYPERTHERMOPHILIC VIRUS SSV-RH	269	171	69	0	X
36142	Chitinase, lysozyme	269	210	55	0	X
15143	nsLTP1b	269	0	0	0	X
26990	Regulatory domain of Calcineurin	269	376	95	0	X
2219	HiPIP	269	0	0	0	X
5556	PHD_WSTF	269	0	0	0	X
25403	Clathrin Heavy Chain	269	869	268	0	X
5276	DIPETALIN	269	183	53	0	X
16542	Pdcd4 MA-3 M-C	269	643	269	0	X
4172	Rev-erb beta response element	268	0	0	28		X
19143	FepB	268	860	268	0	X
25910	in-cell GB1	268	217	57	0	X
27273	dp-p38 alpha	268	550	268	0	X
16780	CobR	268	467	158	0	X
6115	Rhonivirus CRE	268	0	0	0			X
7319	polyermase beta in complex with substrate DNA	268	775	268	0	X	X
15378	VraR	268	239	55	0	X
18334	trypsin inhibitor BWI-2c	268	21	45	0	X
16919	spMDD	268	832	268	0	X
30241	EEHEE_rd3_1049	268	202	42	0	X
25763	MbtH-like protein from Mycobacterium avium	268	235	62	0	X
19004	CcP(His)6CN	267	820	267	0	X
30600	M protein	267	198	50	0	X
5749	Sl-moricin monomer	267	0	0	0	X
26733	p38g monomer	267	769	281	0	X
18770	TatA T22P	267	144	48	0	X
55	alpha 1-purothionin	267	0	0	0	X
30402	DNA (26-MER)	267	0	0	0		X
34102	Anti-sigma-G factor Gin	267	166	47	0	X
15643	KPR	267	787	267	0	X
6877	HPV-16 E2C-DNA complex	267	245	76	0	X	X
16209	JARID1A PHD finger 3	267	199	57	0	X
25458	Odin-Sam1 fragment	267	0	0	0	X
19564	DHFR	267	275	170	0	X
5268	tachystatin A	267	0	0	0	X
26627	CaM+Fas47-83	267	376	179	0	X
6386	aei monomer	267	0	0	0	X
18859	Biosynthetic engineered B28K-B29P human insulin monomer	267	0	0	0	X
5265	moricin monomer	267	0	0	0	X
25110	left-handed G-quadruplex	267	0	0	0		X
18392	EIC dimer	266	810	266	0	X
6350	LH1 Beta polypeptide	266	154	51	0	X
17923	defensin Lc-def from germinated lentil seeds	266	54	45	0	X
5771	tff3 dimer	266	0	57	0	X
15360	DNA 12mer	266	0	0	22		X
4377	type X cellulose binding domain from Pseudomonas xylanase A	266	0	0	0	X
19094	Enterocin 7A	266	0	0	0	X
16982	D-allose binding protein	266	775	266	0	X
7092	VrD2	266	0	0	0	X
15883	CTL9	266	267	88	0	X
16062	En-1	266	139	0	0	X
19278	d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid	266	0	0	0		X
36047	SsTx	266	0	0	0	X
275	neurotoxin I	265	0	0	0	X
6576	monomer	265	0	0	0	X
16729	SipDND38	265	801	274	0	X
25349	WW3	265	184	44	0	X
27795	FLNa4-6	265	556	245	0	X
30565	Protein RALF-like 8	265	221	50	0	X
27959	Rpo4/Rpo7	265	594	145	0	X
25354	Abp1p SH3 domain	265	215	57	0	X
19495	FLNc4-5	265	495	169	0	X
27274	dp-p38a MKK3bKIM Complex	265	532	265	0	X
4055	Coiled Coil domain of Chicken Cartilage Matrix Protein	264	163	46	0	X
25118	cTnI[1-73]	264	227	66	0	X
4587	Viscotoxin A3 from Viscum album L.	264	0	0	0	X
5665	Clpx Zinc Finger dimer	264	203	47	0	X
19189	hL-FABP	264	364	125	0	X
27183	EIC dimer	264	821	264	0	X
16849	rubredoxin	264	0	0	0	X
11037	TTHA1718	264	207	62	0	X
16253	Rv2377c	264	210	52	0	X
19280	d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid	263	0	0	0		X
25363	crotalicidin in DPC micelles	263	105	0	0	X
6387	aei-analogue monomer	263	0	0	0	X
26904	P1-163_tetramer	263	370	121	0	X
4423	GATA-1 N-terminal zinc finger	263	0	36	0	X
16626	Ubiquitin	263	210	72	0	X
15375	rubrdoxin monomer	263	0	0	0	X
5856	human normal adult hemoglobin carbonmonoxy form	263	749	263	0	X
6509	ScYLV RNA pseudoknot	263	217	96	28			X
16812	MED1:DNA complex	263	145	65	0	X	X
19970	Enterocin NKR-5-3B	263	154	62	0	X
27594	CsuC-CsuA/B	262	834	262	0	X
16027	INSULIN A CHAIN, INSULIN B CHAIN	262	0	0	0	X
12020	wild-type SPINK1	262	0	45	0	X
16978	CKR-brazzein	262	198	51	0	X
5632	telomerase RNA p2b hairpin	262	201	25	0			X
16777	hahellin	262	240	82	0	X
17604	T4_L99A	262	248	158	0	X
26054	omega-agatoxin IVA	262	0	48	0	X
16857	Exon 6 of human Jagged-1	262	0	0	0	X
19018	E. coli ribosomela decoding site with apramycin	262	256	101	27			X
5024	ALPHA-BUNGAROTOXIN	262	0	0	0	X
11044	Magi4	262	0	0	0	X
19566	DHFR	262	275	167	0	X
19567	DHFR	262	418	172	0	X
19027	rubredoxin type protein from Mycobacterium ulcerans	262	206	51	0	X
15552	beta3 integrin	261	0	54	0	X
19005	(His)6CcPCN	261	789	261	0	X
7288	BNIP3 TM dimer	261	114	45	0	X
26825	Lunasin monomer	261	124	51	0	X
10005	ChiC ChBD	261	188	61	0	X
30475	Flower-specific gamma-thionin	261	99	37	0	X
26824	Lunasin monomer	261	126	51	0	X
19462	HlyIIC-Trans	261	193	59	0	X
6076	stem-loop RNA	261	226	34	0			X
18528	alpha tubulin 404-451	261	0	0	0	X
4182	reduced rubredoxin	261	0	0	0	X
11271	Ubiquilin-3	261	195	52	0	X
5295	brazzein	261	0	0	0	X
4757	C-terminal UBA Domain of HHR23A	261	137	44	0	X
27455	CzrA homodimer	261	266	100	0	X
34111	RNA chaperone ProQ	261	156	54	0	X
16159	beta1A integrin tail	261	0	51	0	X
4028	Sex-lethal protein	261	308	149	0	X		X
26691	ZnF-Bcd1	261	186	43	0	X
17878	La(4-325)	260	687	260	0	X
329	acylphosphatase	260	0	0	0	X
30552	DNA (27-MER)	260	32	0	0		X
36159	G-quadruplex DNA (26-MER)	260	0	0	0		X
19281	d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid	260	0	0	0		X
1447	transcriptional regulator GCN4	260	0	0	0	X
1449	transcriptional regulator GCN4	260	0	0	0	X
16445	K2	260	174	43	0	X
19565	DHFR	260	260	170	0	X
1381	cobratoxin	260	0	0	0	X
4876	Ca2+-bound state of canine milk lysozyme	260	244	125	0	X
30089	Hge-scorpine	260	0	0	0	X
34006	Enterococcin K1	260	149	35	0	X
18267	DNA Polymerase beta uncomplexed	260	802	260	0	X
17913	SH3C	259	186	61	0	X
50131	KL Sup35NM	259	0	259	0	X
4570	SSO7D	259	0	0	0	X
27128	VDAC-1	259	470	259	0	X
50009	Bacteriorhodopsin	259	515	156	0	X
5594	U-box from Prp19	259	141	46	0	X
11380	POZ-, AT hook-, and zinc finger-containing protein 1	259	190	44	0	X
34154	Receptor tyrosine-protein kinase erbB-2 (E.C.2.7.10.1)	259	202	47	0	X
4075	DnaB helicase	259	253	124	0	X
7035	NCK2 2nd SH3	259	99	53	0	X
6838	PSE-4	258	782	258	0	X
10215	Membrane-associated guanylate kinase	258	198	44	0	X
25921	IF7	258	226	74	0	X
146	bull seminal inhibitor IIA	258	0	0	0	X
34441	KRAS32R G25T	258	34	12	0		X
5848	S-locus pollen protein	258	0	0	0	X
18004	Structural and functional analysis of the DEAF-1 and BS69 MYND domains	258	179	52	0	X
15450	ThrA3-DKP-insulin	258	0	0	0	X
4103	14mer DNA duplex containing the operator sequence BS2	258	188	22	0		X
2787	cardiotoxin VII2	258	0	0	0	X
30312	De novo mini protein gHEEE_02	258	181	46	0	X
6110	mutant of LEKTI domain 1	258	0	56	0	X
7241	Chromo domain 2 complexed with cpSRP54 peptide	258	151	57	0	X
36174	DNA (5'-D(CPGPCPGPAPAPAPTPTPTPCPGPCPG)-3')	258	0	0	0		X
19913	KDM5B PHD1 finger	258	189	51	0	X
1450	transcriptional regulator GCN4	258	0	0	0	X
1448	transcriptional regulator GCN4	258	0	0	0	X
16171	Barnase	257	0	0	0	X
4990	Betacellulin-2	257	0	0	0	X
30064	Choline binding protein (E.C.3.2.1.96)	257	165	49	0	X
34359	Nucleoid-associated protein Lsr2	257	0	53	0	X
18609	GGBP - Glucose	257	495	257	0	X
4104	BS2 operator DNA complexed with the Antennapedia Homeodomain	257	176	23	0	X	X
16941	47-MER	257	0	0	0	X		X
26771	C. elegans TDP2 Ubiquitin Association domain	257	232	59	0	X
15231	ErbB2 dimer	257	160	40	0	X
19101	Enterocin 7B	257	0	0	0	X
25280	mouse BMAL1 transactivation domain	257	200	49	0	X
27614	AIPL1-TPR	257	404	129	0	X
27459	CzrA homodimer	257	260	99	0	X
34358	Nucleoid-associated protein Lsr2	257	0	53	0	X
25024	RP domain of MiSp	257	136	112	0	X
4462	mouse [Cd7]-metallothionein-1	257	0	0	0	X
30058	DNA (25-MER)	256	0	0	0		X
5246	Human insulin mutant	256	0	0	0	X
7314	L11 in complex with rRNA	256	350	136	0	X		X
26034	membrane proximal external region of HIV-1 gp41 in DPC micelles	256	87	0	0	X
18502	Smurf2 WW3 domain in complex with a Smad7 derived peptide	256	0	0	0	X
7067	Reticulon-4	256	0	57	0	X
16673	BS3	256	781	256	0	X
16172	barnase	256	0	0	0	X
374	anthopleurin-A	256	0	0	0	X
26589	yAAC3	256	669	256	0	X
53	proteinase inhibitor IIA	256	0	0	0	X
15538	RNA apatamer	256	193	31	0			X
27110	env45	256	179	42	0	X
7082	PutA45	256	200	42	0	X
27528	WDR5	256	838	256	0	X
4997	[Thr(B27)->Pro,Pro(B28)->Thr]-insulin	256	109	0	0	X
30026	5'-terminal hairpin of the 7SK snRNA	256	68	23	0			X
17939	a protein from Haloferax volcanii	255	98	55	0	X
6740	Cysteine-rich secretory protein-2	255	78	58	0	X
25713	HLA-B2709_pVIPR	255	758	255	0	X
6319	nkx2.5 homeodomain plus NK2 specific domain in DNA bound state	255	169	134	0	X	X
18925	chain_A	255	0	0	0	X
19535	SGTX-Sf1a	255	182	49	0	X
26722	PhyR	255	497	252	0	X
18923	[L-HisB24] insulin analogue at pH 8.0	255	0	0	0	X
27027	AcBS	255	385	126	0	X
16505	octarepeats	255	160	50	0	X
19959	Structural basis for binding of Pan3 to Pan2 and its function in mRNA recruitment and deadenylation	255	121	36	0	X
17001	ASIP(80-132,_P103A,_P105A,_Q115Y,_S124Y)	255	0	0	0	X
4346	L30 MRNA	255	193	24	0			X
17926	CP12 protein	254	187	53	0	X
25836	OtTx1a - ICK	254	130	55	0	X
4364	stromelysin-ligand complexes	254	252	142	0	X
17543	first domain of human Smurf1 in complex with a human Smad1 derived peptide	254	44	17	0	X
19670	lysine-free (K0) ubiquitin	254	219	70	0	X
17129	25-mer DNA oligomer	254	139	0	25		X
15784	NikA(1-51) homodimer	254	201	51	0	X
15079	ER382A	254	188	50	0	X
25991	E1A-CR3	254	191	50	0	X
15488	ABL kinase domain with imatinib	254	516	254	0	X
18741	Fibroblast Growth Factor Recoptor	254	814	254	0	X
375	anthopleurin-A	254	0	0	0	X
17331	GIP in Bicellular media	254	0	0	0	X
19259	Pin1	253	182	39	0	X
7138	FRE-FAD complex	253	658	202	0	X
5670	Hellethionin D	253	0	0	0	X
5257	Thymosin beta-9	253	0	0	0	X
16940	Thrombin	253	525	253	0	X
17823	AvBD15 (GALLIN)	253	0	0	0	X
25003	BlaP216Q0	253	765	255	0	X
19729	HEN EGG BETA-DEFENSIN GALLIN (CHICKEN OVO-DEFENSIN)	253	0	0	0	X
30577	DNA (5'-D(TPGPAPGPGPGPTPGPGPGPTPAPGPGPGPTPGPGPGPTPAPA)-3')	253	0	0	0		X
5251	lymphotactin	253	262	86	0	X
30065	Voltage-dependent anion-selective channel protein 1	253	466	252	0	X
5244	endonuclease V	253	395	131	0	X
30599	M protein	253	195	49	0	X
5919	Loop E of 5S rRNA from spinach chloroplasts	253	110	20	0			X
18141	novel conotoxin im23a from Conus imperialis	253	29	43	0	X
30561	Defensin-2	252	171	44	0	X
36265	VG16KRKP, Heparin cofactor 2	252	0	0	0	X
19962	Truncated L126Z-sod1	252	230	117	0	X
7326	En-1 monomer	252	55	0	0	X
5167	AT-Rich DNA with the GAA-Hairpin Loop	252	0	0	0		X
27843	hGluR2-LBD	252	488	252	0	X
2956	lac repressor headpiece	252	0	0	0	X
25957	D19S variant of the Penicillium Antifungal Protein (PAF)	252	112	60	0	X
1474	bovine seminal fluid protein	252	0	0	0	X
36266	VG16KRKP, Heparin cofactor 2	252	0	0	0	X
34040	Epidermal growth factor receptor (E.C.2.7.10.1)	252	190	42	0	X
25269	ASM1	252	152	45	0	X
15752	ILTat1.24 C2 domain	252	0	0	0	X
5750	BLyS Receptor 3	252	176	51	0	X
19992	Kelch domain	252	0	252	0	X
15706	DFP inhibited mature subtilisin E	252	776	252	0	X
7263	Meg-A12	252	0	0	0	X
25715	HLA-B2709_TIS	252	767	252	0	X
27783	PAS-GAF-PHY monomer	251	791	251	0	X
26568	The structure of the SOLE element of oskar mRNA	251	213	38	30			X
19188	hL-FABP:OLA	251	373	126	0	X
17545	first domain of human PIN1 in complex with a human Smad3 derived peptide( resi 173-186)	251	65	42	0	X
17807	Ca2+/CaM L-selectin peptide complex	251	438	144	0	X
27841	hGluR2-LBD	251	734	251	0	X
7240	scPCNA trimer	251	768	250	0	X
34349	Gallinacin-11	251	139	39	0	X
27842	hGluR2-LBD	251	480	251	0	X
18353	Kelch domain of mouse Keap1	251	490	251	0	X
18896	BI-FUNCTIONAL LYSOZYME-PROTEASE INHIBITOR	251	199	57	0	X
15454	ALOA3-DKP-insulin	251	0	0	0	X
25821	BlaPdPG	251	251	251	0	X
7289	PB(1-40)	251	0	0	0	X
25881	yeast Hit1 protein zinc finger	251	190	47	0	X
15495	iodowillardiine-S1S2	250	509	250	0	X
15496	kainate-S1S2	250	509	250	0	X
27840	hGluR2-LBD	250	732	250	0	X
17627	alpha-actinin	250	135	67	0	X
15493	fluorowillardiine-S1S2	250	509	250	0	X
5147	metallothionein	250	0	41	0	X
34296	DNA (5'-D(CPGPAPTPGPTPAPCPAPTPCPG)-3')	250	0	0	0		X
15492	willardiine-S1S2	250	498	250	0	X
15494	bromowillardiine-S1S2	250	509	250	0	X
19149	actinobacterial transcription factor RbpA	250	189	45	0	X
19787	FKBP51	250	351	114	0	X
19333	HIV-1 Vif SOCS-box with Elongin BC	250	417	160	0	X
5854	NAD+ synthetase	250	759	250	0	X
27403	hFEN1-336-P188A	250	780	250	0	X
4776	Sud dimer	250	368	117	0	X
6033	C10A/C13A cytochrome c552 from Hydrogenobacter thermphilus	249	0	76	0	X
5156	calretinin	249	256	81	0	X
6525	Mungbean Defensin, VrD1	249	0	0	0	X
7166	CgNa toxin	249	0	0	0	X
19458	Recombinant CR1 fragment, domains 2-3	249	152	67	0	X
18498	YAP WW2 in complex with a Smad7 derived peptide	249	0	0	0	X
4209	M13 major coat protein	249	157	50	0	X
50125	VDAC-E73V	249	0	249	0	X
15766	hCSD1	249	256	122	0	X
28053	VDAC-MSP1D1	249	0	249	0	X
16468	PcTx1	249	161	42	0	X
15417	34mer_RNA	249	137	11	0			X
4988	HUWENTOXIN-II	249	0	0	0	X
18500	Smurf1 WW2 domain in complex with a Smad7 derived peptide	249	0	0	0	X
25327	Bd0108	249	271	69	0	X
19724	Ig-alpha Ig-beta construct	249	119	83	0	X
15513	VpU polypeptide	249	185	50	0	X
15455	AbaA3-DKP-insulin	249	0	0	0	X
15161	ETO MYND	249	202	59	0	X
5658	ISG15	249	530	162	0	X
27445	GII.4 Saga Norovirus Protruding Domain	249	767	249	0	X
17614	UCP2	249	695	236	0	X
16969	Sam68 Qua1 domain	249	176	39	0	X
6024	Beta-lactamase TEM	249	759	249	0	X
4197	M13 major coat protein	248	204	51	0	X
5173	Epiregulin monomer	248	0	0	0	X
7237	Mutants Y105G of TEM-1 beta-lactamase	248	248	248	0	X
27617	KPC-2	248	761	248	0	X
17023	Znf_A20	248	207	65	0	X
7238	Mutants Y105N of TEM-1 beta-lactamase	248	248	248	0	X
5134	dAAUAA DNA Bulge: 5'-D(GPCPAPTPCPGPAPAPUPAPAPGPCPTPAPCP*G)-3'	248	0	0	27		X
5163	RUBREDOXIN	248	0	0	0	X
27067	BlaC	248	769	248	0	X
6357	Beta-lactamase TEM	248	727	248	0	X
15108	p1	248	0	0	0	X
19504	baa38	248	0	0	0	X
11008	FBP28WW2-PPPLIPPPP	248	0	0	0	X
15271	SMB domain from vitronectin	248	166	44	0	X
5192	neuropeptide F	248	0	0	0	X
7239	Mutants Y105D of TEM-1 beta-lactamase	248	248	248	0	X
16059	Chv DNA Ligase Monomer	248	733	248	0	X
19258	Pin1 WW domain	248	182	37	0	X
18763	FGFR3tm	248	189	47	0	X
18603	RBP	248	473	248	0	X
7236	Mutants Y105W of TEM-1 beta-lactamase	247	668	247	0	X
26035	membrane proximal external region of HIV-1 gp41 in hexafluoroisopropanol	247	100	0	0	X
16727	culbertcidin	247	0	0	0	X
19038	complex of cytochrome P450cam and its electron donor putidaredoxin	247	0	247	0	X
4111	Intimin cell adhesion domain	247	478	247	0	X
4400	H-y5 Triple Helix	247	0	0	0		X
5234	TyrR transcription factor central domain of E.coli	247	672	246	0	X
25651	active G-quadruplex motif from AGRO100	247	0	0	0		X
27314	E1 Y245G monomer	247	803	247	0	X
27032	DANCER-3	247	218	56	0	X
17660	LmrA-NBD ADP complex	247	724	247	0	X
1757	cGMP-dependent protein kinase	247	0	0	0	X
16806	SgR145	247	567	159	0	X
4473	Camp dependent protein kinase type ii regulatory chain	247	156	41	0	X
18357	Acanthaporin	247	0	0	0	X
15654	Insulin-like growth factor-I (IGF-I)	247	192	62	0	X
25714	HLA-B2705_pVIPR	247	719	247	0	X
26063	dermcidin peptide DCD-1L	247	0	45	0	X
26586	TEM-1(M68L-M69T)	247	458	248	0	X
10028	the second WW domain of mouse salvador homolog 1 protein (mWW45)	247	184	39	0	X
27160	hFEN1-336	247	797	247	0	X
26791	holo_LangCRD	247	463	150	0	X
19499	HUR RRM3	246	297	118	0	X
5182	GluR2 Extracellular Ligand-Binding Domain	246	740	246	0	X
80	toxin ATX Ia	246	0	0	0	X
15884	CTL9	246	257	82	0	X
15680	Phosphatase domain of PTPN7	246	763	245	0	X
6440	PAS1-PAS2 monomer	246	742	246	0	X
1991	rubredoxin	246	0	0	0	X
26832	Protein Tyrosine Phosphatase 1B YAYA (Y152A, Y153A) variant	246	494	246	0	X
18634	human beta-defensins 1 and 6	246	183	47	0	X
16150	jerdostatin R24K	246	119	46	0	X
15298	beta-synuclein	246	383	124	0	X
25066	UBA domain of DNA-damage-inducible 1 protein (Ddi1)	246	0	45	0	X
4588	ChBD-ChiA1	245	0	51	0	X
15917	blaKR	245	735	245	0	X
6494	BsCM trimer	245	354	118	0	X
4465	His117Gly azurin	245	0	123	0	X
17975	PPARgamma LBD + rosigliazone	245	750	245	0	X
4742	ChBD-ChiA1	245	0	51	0	X
4642	HUMAN BETA-DEFENSIN-2	245	0	0	0	X
300	toxin RP III	245	0	0	0	X
11007	FBP28WW2-PTPPPLPP	245	0	0	0	X
19279	d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid	245	0	0	0		X
30314	Insulin	245	205	48	0	X
27030	DANCER-0	245	203	47	0	X
34266	Exendin-4	245	0	0	0	X
27888	BlaC	245	262	245	0	X
15880	Rab11-FIP2	245	65	37	0	X
4032	bovine pancreatic [C65S,C72S] ribonuclease A	244	363	119	0	X
15174	[L-Phe44]iota-RXIA (r11a)	244	44	0	0	X
11608	DNA CONTAINING METALLO-BASE-PAIR	244	0	0	0		X
25275	eEF1Bdelta CAR domain	244	173	44	0	X
4201	[ABA6,20] mEGF4-48	244	0	0	0	X
19976	BlaP197	244	746	244	0	X
16482	LRP-1	244	169	40	0	X
6021	subunit a of the ATP synthase	244	753	244	0	X
4944	Arsenate reductase	244	358	122	0	X
4031	bovine pancreatic ribonuclease A	244	368	119	0	X
5019	mNPAS2(78-240)	244	466	154	0	X
50133	Chimeric SC Sup35NM, 5MT-B	244	0	244	0	X
30077	Guanine nucleotide-binding protein G(i) subunit alpha-1	244	0	244	0	X
481	toxin BDS-I	244	0	0	0	X
25904	DERA mutant (K58E-Y96W)	244	507	244	0	X
16831	C-domain of Lsr2	244	196	54	0	X
50134	Chimeric SC Sup35NM, 4MT-A	244	0	244	0	X
15518	GW1929-PPARgamma Ligand-Binding Domain Complex	244	772	244	0	X
26757	Glucocorticoid Receptor Ligand Binding Domain	244	252	231	0	X
6074	PaDDAH	244	736	244	0	X
27784	PAS-GAF-PHY monomer	244	768	244	0	X
5767	Viscotoxin C1	244	0	0	0	X
7205	ErbB4 TM dimer	244	179	40	0	X
27269	gHEEE_02	244	176	39	0	X
50132	Chimeric SC Sup35NM, 5MT-A	244	0	244	0	X
18084	Calmodulin C-lobe bound with ER alpha peptide	244	129	67	0	X
17941	IV-B_RNA	243	179	47	2			X
4555	SRY-14mer duplex	243	0	0	26		X
30417	Putative cytoplasmic protein	243	238	123	0	X
17434	C-terminal domain of Bv3F	243	188	40	0	X
7057	hbSBD monomer	243	154	46	0	X
6849	Grassostrea gigas defensin	243	0	0	0	X
30078	Guanine nucleotide-binding protein G(i) subunit alpha-1	243	0	243	0	X
11609	histone H2A-H2B heterodimer	243	736	242	0	X
15202	Rub184_GppNHp	243	379	131	0	X
17330	GIP	243	0	0	0	X
15453	FBP28WW2-PPLIPPPP	243	0	0	0	X
4979	Er-23 pheromone	243	51	0	0	X
4093	RNase H domain of human HIV-1 Reverse Transcriptase	243	239	117	0	X
5033	Defensin Heliomicin	243	0	0	0	X
4347	Alpha2D	242	0	0	0	X
6384	Tumor necrosis factor receptor superfamily member 13B	242	150	45	0	X
36115	WW2 domain and PPxY motif complex	242	0	49	0	X
25865	rNedd4 WW2 Domain-Cx43CT Peptide Complex	242	119	35	0	X
17488	ErbB3tm	242	176	47	0	X
30672	SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1	242	172	41	0	X
34321	RNA (31-MER)	242	207	77	11			X
4882	Pin1 WW domain	242	0	0	0	X
5802	Outer mitochondrial membrane cytochrome b5	242	359	120	0	X
30240	HHH_rd1_0142	242	168	40	0	X
15170	M.HhaI monomer	242	483	242	0	X
548	neuropeptide Y	242	0	0	0	X
6646	firefly luciferase domain residues 420-550	242	356	123	0	X
5936	bADT	241	248	116	0	X
25934	Nizp1-C2HR zinc finger	241	0	37	0	X
5135	dAATAA DNA Bulge: 5'-D(GPCPAPTPCPGPAPAPTPAPAPGPCPTPAPCP*G)-3'	241	0	0	26		X
480	toxin BDS-I	241	0	0	0	X
15106	clip monomer	241	198	51	0	X
11150	Ectonucleotide pyrophosphatase/phosphodiesterase family member 1	241	172	47	0	X
4266	[D-AlaB26]destetra(B27-B30)insulin-B26-amide	241	0	0	0	X
27429	KIBRA	241	241	115	0	X
5264	Human Beta-defensin 3	241	0	0	0	X
16000	XD_domain	241	0	0	0	X
25711	HLA-B2705_TIS	241	251	241	0	X
5296	brazzein_RI	241	0	0	0	X
18499	YAP WW1 in complex with a Smad7 derived peptide	241	0	0	0	X
18048	NPM1_C70	241	276	73	0	X
26773	a17	241	368	123	0	X
2217	nucleocapsid protein	241	0	0	0	X
5853	Calbindin D28k	240	706	240	0	X
4728	EGF 3 module from human vitamin K-dependent protein S	240	0	0	0	X
25614	insulin analogue	240	77	0	0	X
16890	G61-101	240	122	43	0	X
18251	Cdc42Hs	240	220	142	0	X
15983	ShK-192	240	35	33	0	X
34348	Gallinacin-11	240	76	34	0	X
19277	d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid	240	0	0	0		X
19387	intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative	240	0	0	23		X
30075	E3 ubiquitin-protein ligase TRIM21 (E.C.6.3.2.-)	240	175	40	0	X
26974	Hsp31 dimer	240	763	240	0	X
25355	EphB2 kinase domain	240	799	240	0	X
19884	CcP	240	757	240	0	X
16503	RNase A	239	359	118	0	X
19615	PaDDAH_TM	239	481	235	0	X
30249	HEEH_rd4_0097	239	173	46	0	X
27729	Il37 dimer	239	444	145	0	X
27373	Src kinase domain dasatinib complex	239	719	239	0	X
16044	PyLTNT	239	406	142	0	X
6559	Formin-binding protein 3/Formin complex	239	122	42	0	X
15741	TM hisF	239	720	239	0	X
6652	GAAA tetraloop/Recptor homodimer	239	88	23	0			X
4692	TELOMERE FRAGMENT	239	0	0	21		X
19148	actinobacterial transcription factor RbpA	239	189	44	0	X
25922	K1	238	0	0	0	X
5491	scarabaecin monomer	238	36	0	0	X
19477	P130Cas SD	238	0	238	0	X
18345	anti-fungal defensin DEF4 (MTR_8g070770)	238	22	48	0	X
6061	T1-61-DNase fusion protein	238	169	60	0	X
25052	Nucleocapsid protein p10 and RNA (68-MER)	238	0	0	0	X		X
6853	TAP-N	238	507	238	0	X
17329	PROTEIN	238	603	162	0	X
19397	FAT10 first domain	238	0	52	0	X
19616	Dimethylarginine Dimethylaminohydrolase	238	486	237	0	X
26835	Protein Phosphatase 1B T178A variant	238	484	238	0	X
5958	MAP-LC3 monomer	237	235	114	0	X
16701	the C-terminal domain of Stt3p	237	714	236	0	X
30604	Outer membrane protein G	237	725	237	0	X
15175	[D-Phe44]iota-RXIA	237	0	39	0	X
5350	human cytoplasmic tyrosine phosphatase A	237	276	134	0	X
6832	lipase PG	237	671	237	0	X
6681	Gastric inhibitory polypeptide	237	0	0	0	X
18568	NS4B	237	132	0	0	X
27121	Hematopoietic Protein Tyrosine Phosphatase (PTPN7, HePTP)	237	404	237	0	X
26653	Nogo-A-Delta20	237	352	170	0	X
26836	Protein Tyrosine Phosphatase 1B L192A variant	237	469	237	0	X
16025	Ec-1 metallothionein	237	0	50	0	X
6077	stem-loop RNA	237	89	0	0			X
34158	DNA (5'-D(CPGPAPTPGPTPAPCPAPTPCPG)-3')	237	130	0	22		X
4976	LL mutant of Defensin Heliomicin	237	0	0	0	X
25691	kallikrein inhibitor SPINK6	237	0	55	0	X
16516	APE1 (39-318)	237	766	237	0	X
19746	synthetic Mamba-1 peptide	236	0	0	0	X
5183	BetaCore	236	0	17	0	X
16431	TAR-2Lig	236	172	57	0	X		X
19532	mutant dimeric TM domain of VEGFR2 receptor	236	181	44	0	X
36168	DNA (5'-D(GPGPGPTPAPCPCPCPGPGPGPTPGPAPGPGPTPGPCPGPGPGPGPT)-3')	236	11	0	24		X
25967	ZitP zinc finger	236	164	43	0	X
15900	MMP23-BgK	236	0	0	0	X
25789	CmPI-II, a serin protease inhibitor	236	170	55	0	X
27228	SLP-65	236	698	236	0	X
1885	gp120	236	0	0	0	X
27091	EarP	236	188	237	0	X
16152	jerdostatin R24K -N45G46 polypeptide	236	116	43	0	X
19531	trimeric mutant TM domain of VEGFR2 receptor	236	171	44	0	X
6146	nisin/3LII complex	236	73	34	2	X
25632	TBD_1-22	236	135	46	0	X
11014	TAR-TAR*GA aptamer kissing complex	235	176	9	0			X
19744	Pseudomonas aeruginosa Dimethylarginine Dimethylaminohydrolase	235	486	235	0	X
19742	Dimethylarginine Dimethylaminohydrolase	235	486	235	0	X
6235	SNARE complex	235	238	235	0	X
16136	jerdostatin polypeptide	235	102	45	0	X
25906	Glucose as a nuclease mimic in DNA	235	0	0	0		X
6935	lipase WT	235	435	235	0	X
34435	VK2	235	0	0	0		X
6756	D6short	235	143	11	0			X
17533	Sex Peptide from Drosophila melanogaster	235	77	36	0	X
7352	GAG POLYPROTEIN	235	0	0	0	X
17770	VDRLBD	235	717	235	0	X
5210	subgroup A Rous Sarcoma virus receptors PG800 and PG950	235	135	44	0	X
10233	Zinc finger protein 347	234	174	38	0	X
6642	chicken liver BABP	234	206	112	0	X
25154	DMXAA-bound mSTING dimer	234	663	221	0	X
28048	BRG1 ATBD	234	272	113	0	X
25368	EF-GC3 monomer	234	727	234	0	X
26902	P1-126	234	311	119	0	X
7130	Rhodanese	234	720	233	0	X
19283	RXFP2_LDLa	234	107	43	0	X
11452	stomagen	234	153	50	0	X
10309	Zinc finger protein 484	234	171	36	0	X
10154	Zinc finger protein 473	234	165	35	0	X
27169	solubility domain GB1	234	244	65	0	X
26756	Glucocorticoid Receptor Ligand Binding Domain	234	463	221	0	X
5730	Benzo[a]Pyrene Adducted Adenine in a DNA duplex	234	0	0	0		X
34280	Tc-DNA/DNA duplex	234	59	0	0		X
30258	14-mer Peptide/RNA Complex	234	0	13	0	X		X
25229	Human FAAP20 UBZ	233	142	40	0	X
16817	dermcidin-1L	233	0	47	0	X
7123	BR2	233	0	0	0	X
34221	DNA (27-MER)	233	0	0	0		X
11369	Zinc finger protein 224	233	166	38	0	X
26837	Protein Tyrosine Phosphatase 1B N193A variant	233	467	233	0	X
27430	KIBRA	233	245	116	0	X
10198	Zinc finger protein 224	233	169	36	0	X
16151	jerdostatin -N45G46 polypeptide	233	111	44	0	X
18279	human CEB25 minisatellite G-quadruplex	233	56	0	25		X
15651	KpOmpA transmembrane domain	233	673	170	0	X
19673	p75 transmembrane domain	233	170	42	0	X
5945	CD8a cytoplasmic tail - Lck N terminus	232	148	41	0	X
36170	Pin-II type proteinase inhibitor 15	232	184	50	0	X
19692	Divalent Cations at the Active Site of the Neurospora VS Ribozyme	232	173	91	0			X
4862	[Ala31, Aib32]-NEUROPEPTIDE Y	232	0	0	0	X
17292	26-MER	232	173	91	0			X
17877	RNA (32-MER)	232	0	0	0			X
18847	stacked G-quadruplex formed by human TERRA sequence	232	0	0	0			X
1453	transcriptional regulator GCN4	232	0	0	0	X
4332	bovine alpha-lactalbumin	232	0	118	0	X
4234	delta-atracotoxin-Hv1 (versutoxin)	232	0	0	0	X
7124	B-box2 monomer	232	124	47	0	X
19907	L7Ae apo	232	338	111	0	X
25378	A G-quadruplex structure	232	0	0	0		X
4185	gurmarin	232	0	0	0	X
5203	cysteine-rich domain of KSR	232	138	44	0	X
4995	GlyTM1bZip coiled-coil dimer	232	160	41	0	X
5120	mEGF/TGFalpha44-50 chimera	232	0	0	0	X
1451	transcriptional regulator GCN4	232	0	0	0	X
17722	CBD12	232	373	232	0	X
19041	VEGFR2tm	232	169	42	0	X
6702	yeast TBP associated factor 1 (yTAF1)	232	462	232	0	X
11006	Extracellular domain of mouse NOTCH 1EGF12	232	0	0	0	X
5164	5'-D(PCPCPAPTPAPAPTPTPTPAPCPC)-3' duplex	232	0	0	0		X
19223	PTP1B	232	512	232	0	X
11157	Cytoplasmic tyrosine-protein kinase BMX	232	176	39	0	X
17241	YAP	232	193	46	0	X
30162	Envelope glycoprotein	232	187	49	0	X
27577	Rac1-Mg-GDP	232	540	153	0	X
19296	Pin1 WW domain mutant 6-1g	231	0	0	0	X
27135	Brr2 C-terminal Sec63 unit	231	436	231	0	X
18248	ThrRS-dTP(2-60)	231	49	51	0	X
36171	Pin-II type proteinase inhibitor 38	231	188	55	0	X
27080	UNG2	231	692	231	0	X
16225	5'-D(DGPDTPDGPDCPDGP(TG)PDGPDTPDTPDTPDGPDT)-3'	231	0	0	20		X
25781	CssA3 (top stem) of CssA thermometer	231	67	14	0			X
34354	Evasin-3	231	122	44	0	X
19662	I-V kissing-loop interaction of the Neurospora VS ribozyme	231	186	67	0			X
16852	siRNA construct	231	0	0	0			X
4467	chicken MeCP2/ARBP monomer	231	319	109	0	X
26062	toxin ISTX-I from Ixodes scapularis	231	126	0	0	X
16963	U1-Liotoxin-Lw1a	231	0	0	0	X
15965	TM1b(1-19)Zip/TM9d252-284 complex	231	123	41	0	X
15708	N-terminal_domain_of_Y4_receptor	231	0	0	0	X
27672	GNAI1	231	794	230	0	X
16226	5'-D(DGPDTPDGPDCPDGP(TG)PDGPDTPDTPDTPDGPDT)-3'	230	0	0	0		X
30637	Alkaline phosphatase,Chaperone protein DnaJ 2 (E.C.3.1.3.1)	230	311	132	0	X
16747	Glycocin A	230	125	43	0	X
5208	Palm-Thumb Domain of DNA Polymerase B	230	621	168	0	X
34264	Exendin-4	230	0	0	0	X
5205	Calreticulin P-domain fragment 221-256	230	0	0	0	X
1155	metallothionein-2	230	0	0	0	X
34119	Exendin-4	230	0	0	0	X
4559	mouse mammary tumor virus nucleocapsid protein	230	0	42	0	X
18252	Cdc42Hs	230	209	138	0	X
5966	headpiece subdomain	230	0	0	0	X
26839	MLV-CAH	230	203	69	0	X
1454	transcriptional regulator GCN4	230	0	0	0	X
27774	PhDim1	230	733	230	0	X
1452	transcriptional regulator GCN4	230	0	0	0	X
26846	full length Dengue NS4B	230	699	230	0	X
16435	LDTI	229	0	0	0	X
26590	cTEM-19m	229	419	229	0	X
18791	WzcCD	229	702	229	0	X
5979	DNA	229	0	0	0		X
25551	Covalent, disulfide crosslink of V197C/C128A yeast cytochrome c peroxidase and A81C/C102T yeast iso-1 cytochrome c	229	0	229	0	X
19402	antiparallel (2+2) G-quadruplex	229	0	0	0		X
34302	DNA (28-MER)	229	0	0	0		X
18099	CIB1	229	591	159	0	X
6741	Pulmonary surfactant-associated protein B	229	0	0	0	X
26046	EEH_04	229	109	43	0	X
17715	Itch WW2	229	187	44	0	X
25727	HBPd24r bound to histamine	229	381	160	0	X
27166	LisH dimer	229	210	54	0	X
15261	lcnGb	229	0	39	0	X
18373	bLAC	229	444	229	0	X
19242	apo-HisJ	229	697	229	0	X
17347	PAP248-286	229	0	0	0	X
19994	protein YgaP from Escherichia coli	228	12	61	0	X
16598	cTEM-17m	228	680	228	0	X
4923	omega-atracotoxin-Hv2a	228	0	0	0	X
4048	p53 nuclear phosphoprotein	228	145	39	0	X
30603	M protein	228	173	50	0	X
5955	VASP EVH2 domain	228	148	49	0	X
27929	BlaC bound to avibactam	228	245	228	0	X
15224	AB_G_beta	228	0	0	0		X
34276	Tc-DNA/RNA duplex	228	121	0	0		X	X
5342	Zinc finger domain of Superman protein	228	0	0	0	X
15223	AB_G_alpha	228	0	0	0		X
30009	mu-TRTX-Pre1a toxin	228	161	38	0	X
18288	Ninjurin1 monomer	228	233	73	0	X
3427	parathyroid-hormone-related protein	228	0	0	0	X
25276	eEF1Bdelta CAR domain in TCTP-bound state	228	159	44	0	X
16010	bovine pancreas ribonuclease A	228	353	115	0	X
34351	Polyubiquitin-B	228	325	79	0	X
25205	analgesic sea anemone peptide APETx2	228	0	0	0	X
17091	PROTEIN	228	0	0	0	X
16489	IBDV_pep46	228	0	0	0	X
26833	alpha-N Catenin C-terminal domain	228	719	228	0	X
30592	Uncharacterized protein ORF47	228	114	35	0	X
6690	PSI AB complex with U1-70k proline-rich peptide	228	128	59	0	X
19245	HisJ and Histidine	228	697	228	0	X
19269	E7N	227	133	0	0	X
11239	Zinc finger protein 473	227	162	38	0	X
16937	apoWCBD4-6	227	667	227	0	X
18792	BCL-xL	227	536	171	0	X
25096	MciZ from Bacillus subtilis	227	0	0	0	X
25913	RNF126 N-terminal zinc finger domain	227	183	38	0	X
12040	Rpn12_246	227	693	227	0	X
26734	PAF D53S-D55S	227	103	54	0	X
15527	Mbp1_14	227	116	0	25		X
6737	Bacteriocin curvacin A	227	0	34	0	X
141	cecropin A	227	0	0	0	X
7173	tachystatin B2	227	0	0	0	X
27083	Holo FGFR3	227	289	231	0	X
6257	Abeta(1-40)	227	97	0	0	X
34008	tau-AnmTx Ueq 12-1	227	99	45	0	X
5550	Neuropeptide Y	227	0	32	0	X
15426	ompg	226	697	226	0	X
10232	Zinc finger protein 95 homolog	226	163	37	0	X
6428	alpha-KTx12.1	226	0	0	0	X
15064	WT cTIM homodimer	226	688	226	0	X
18888	EGFR transmembrane - juxtamembrane (TM-JM) segment	226	223	55	0	X
25430	GADD34 PP1 complex	226	203	63	0	X
15259	lcnGa	226	0	47	0	X
4475	Low Density Lipoprotein Receptor Related Protein	226	122	41	0	X
16605	MAUROCALCINE	226	0	0	0	X
2192	adenylate kinase	226	0	0	0	X
7171	tachystatin B1	226	0	0	0	X
5527	Huwentoxin-IV	226	0	0	0	X
17346	PAP248-286	226	0	0	0	X
7233	Pancreatic hormone	226	0	0	0	X
4640	DEFENSIN MGD-1	226	0	0	0	X
26935	KISS-1	225	324	103	0	X
15227	duplex DNA containing an abasic site with opposite T (alpha anomer)	225	0	0	0		X
6530	CC45	225	0	35	0	X
3449	parathyroid-hormone-related protein	225	0	0	0	X
34237	Alpha-S2-casein	225	0	0	0	X
17547	Hevein-type Antifungal Peptide with a Unique 10-Cysteine Motif	225	0	0	0	X
19797	NA,K-ATPASE REGULATORY PROTEIN FXYD2b	225	169	60	0	X
6143	apolipoprotein C-II	225	0	66	0	X
15420	MgTX, monomer	225	0	40	0	X
17015	CUPIENNIN 1A	225	35	0	0	X
18939	C-terminal AbrB	225	168	43	0	X
5379	PANCREATIC POLYPEPTIDE	225	0	30	0	X
27406	Er-23	225	112	56	0	X
6549	ligand binding domain of peroxisome proliferator-activated receptor gamma	225	692	225	0	X
15228	duplex DNA containing an abasic site with opposite T (beta anomer)	225	0	0	0		X
30011	W7A mu-TRTX-Pre1a Toxin	225	155	36	0	X
19332	p15(PAF)	225	422	107	0	X
10203	Zinc finger protein 484	225	165	35	0	X
6184	N-terminal domain of the epsilon subunit of E. coli DNA polymerase III	225	534	157	0	X
18907	Duplex DNA	225	0	0	0		X
1071	coagulation factor X	224	0	0	0	X
16768	hEGF	224	184	48	0	X
10185	Zinc finger protein 268	224	161	36	0	X
6068	Peptide YY	224	0	31	0	X
1494	lac repressor headpiece	224	0	0	0	X
18323	calcium-bound CaM C-terminal domain in a complex	224	261	68	0	X
25150	human ubiquitin conjugating enzyme Ube2w	224	367	113	0	X
26972	SET domain of human methyltransferase NSD3	224	691	224	0	X
63	toxin RP II	224	0	0	0	X
25771	Cementoin	224	0	0	0	X
5400	beta-amyloid 1-42	224	0	0	0	X
16984	ALBP	224	690	224	0	X
5676	Pandinus imperator potassium channel blocking toxin 4	224	0	0	0	X
19159	d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex	224	0	0	22		X
11238	Zinc finger protein 473	224	158	34	0	X
19500	HUR RRM3	224	311	110	0	X
4816	INFLUENZA A VIRUS PROMOTER RNA	224	39	23	22			X
19764	dimeric transmembrane domain of Toll-like receptor 3	224	168	34	0	X
27447	Zn(II)-bound AdcR homodimer	224	529	142	0	X
4481	Collagen alpha 1	224	117	0	0	X
25721	VirA DD	223	157	43	0	X
4211	giant ragweed allergen 5	223	0	0	0	X
5667	First zinc finger of Zinc finger protein 265	223	0	0	0	X
18237	gp41-M-MAT	223	152	64	0	X
18655	Transmembrane Arced Helix (ArcH)	223	0	8	0	X
26611	active domains of the type II topoisomerases	223	648	223	0	X
26814	Protein Tyrosine Phosphatase 1B residues 1-284	223	443	223	0	X
27619	bacterial tRNA-(N1G37) methyltransferase (TrmD)	223	584	223	0	X
26610	active domains of the type II topoisomerases	223	652	223	0	X
19084	mengovirus	223	251	65	0	X
18146	coprisin	223	0	0	0	X
4580	anti-dansyl Fv fragment	223	217	224	0	X
4652	amino terminus of Rhodopsin (residues 1-40)	223	0	0	0	X
16156	Synphilin-1	223	174	46	0	X
18894	d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gamma	223	102	18	0			X
6504	crambin	223	167	45	0	X
25452	Omega-Tbo-IT1 Selective Inhibitor of Insect Calcium Channels	223	114	0	0	X
19215	gp41-M-MAT	223	152	64	0	X
5462	MJ1267	223	683	223	0	X
15788	Ferredoxin-NADP Reductase	223	682	223	0	X
10225	Zinc finger protein 268	223	165	38	0	X
5964	headpiece subdomain	223	0	0	0	X
16589	PthA	223	0	0	0	X
10189	Zinc finger protein 95 homolog	223	164	36	0	X
17792	aurelin	223	107	39	0	X
18	eglin c	223	0	0	0	X
4696	maurocalcin	222	0	0	0	X
6683	deoxy-Hb A	222	694	222	0	X
26744	TrmK	222	660	222	0	X
5161	Nucleotide binding domain of the Sarco(Endo)plasmic Reticulum Ca2+-ATPase	222	447	222	0	X
30317	Beta-theraphotoxin-Ps1a	222	93	34	0	X
34239	Envelope glycoprotein gp150	222	71	48	0	X
5549	[Ala31, Pro32]-NEUROPEPTIDE Y	222	0	31	0	X
17500	papiliocin	222	0	0	0	X
699	ribosomal protein E-L30	222	0	0	0	X
16012	Bcl2/Adenovirus E1B 19 kDa protein-interacting protein 3	222	178	39	0	X
16005	EphA2 TM dimer	222	174	41	0	X
19712	Designed Exendin-4 analogues	222	0	0	0	X
16436	LDTI_-_IIa	222	0	0	0	X
6593	Chromo 3 domain of cpSRP43	222	0	46	0	X
15160	polymerase eta UBZ domain	222	126	36	0	X
25864	rNedd4 WW1 Domain	222	128	36	0	X
4107	CspA	222	124	66	0	X
36103	lectin (PhoSL)	222	0	0	0	X
10184	Zinc finger protein 484	222	164	36	0	X
19810	BmKTX-D19K	222	0	0	0	X
30339	Mu-hexatoxin-Mg2a	222	0	0	0	X
19295	Pin1 WW domain variant 6-1	222	0	0	0	X
19039	domain 5 from Azotobacter vinelandii Intron 5	222	146	31	0			X
25101	tRNApro:MLV Nucleocapsid Protein (1:1) Complex	222	33	0	0	X		X
4714	Formin binding WW domain	221	0	0	0	X
25750	CIN85 CC-domain trimer	221	277	79	0	X
4698	Transforming Growth Factor Beta type II receptor	221	224	108	0	X
10205	Zinc finger protein 28 homolog	221	163	35	0	X
34145	G-quadruplex of Human papillomavirus type 52	221	27	0	0		X
19292	Pin1 WW domain mutant 5-1g	221	0	0	0	X
5610	C terminus of rat striated muscle alpha tropomyosin encoded by exon 9a	221	162	37	0	X
6495	BsCM trimer	221	243	119	0	X
58	ribosomal protein E-L30	221	0	0	0	X
4253	T2 RNA Pseudoknot	221	162	93	0			X
15856	29-MER	221	77	10	0			X
10304	Zinc finger protein 95 homolog	221	152	35	0	X
30160	Mu-theraphotoxin-Hs2a	221	153	41	0	X
10202	Zinc finger protein 484	221	165	35	0	X
1553	troponin C	221	0	0	0	X
7208	GpATM	221	151	38	0	X
10310	Zinc finger protein 347	221	161	35	0	X
26838	Protein Tyrosine Phosphatase 1B (1-301) in complex with TCS401	221	436	221	0	X
6362	NifU-like protein	221	316	144	0	X
19487	PP2WW mutant (KPP2WW) of HYPB	221	174	49	0	X
6485	GluR-B R/G RNA	221	184	0	0			X
18532	RNA Aptamer for B. anthracis Ribosomal Protein S8	220	201	65	0			X
27859	human carbonic anhydrase II S50C C206S	220	682	220	0	X
34178	Podospora anserina S mat+ genomic DNA chromosome 3, supercontig 2	220	179	45	0	X
6496	BsCM trimer	220	0	118	0	X
25346	MG200 EAGRbox	220	317	79	0	X
5522	4th fas-1 domain of beta ig-h3	220	400	131	0	X
27670	HuR GGS	220	0	220	0	X
11528	METALLO-BASE-PAIRED DNA	220	0	0	0		X
16222	5'-D(DCPDTPDAPDTP(FAG)PDAPDTPDTPDCPDA)-3'	220	0	0	0		X
6165	Hepatocyte growth factor receptor	220	0	0	0	X
19741	p75-TM-C257A	220	125	42	0	X
10186	Zinc finger protein 95 homolog	220	157	36	0	X
27890	BlaC in bound to clavulanic acid	220	237	220	0	X
19309	complex between the amyloid beta peptide (1-40) and the polyphenol epsilon-viniferin glucoside	220	0	0	0	X
39	metallothionein-2	220	0	0	0	X
15159	phosphoit30	220	0	0	0	X
12009	UCHL5N240	220	576	220	0	X
5209	Palm-Thumb Domain of DNA Polymerase B in complex with XRCC1-NTD	220	505	164	0	X
25568	VSTx1	220	154	39	0	X
6468	mitogen-activated protein kinase p38 alpha	219	684	219	0	X
17821	Human C30S/C59S-Cox17 mutant	219	244	54	0	X
5528	RNA (25-MER):the complementary RNA promoter of influenza a virus	219	0	0	13			X
7279	HMGA1	219	344	89	0	X
18083	THP type 1 alpha 1 collagen fragment (772-786)	219	165	45	0	X
4427	toxin 7	219	0	0	0	X
5863	FkpA	219	685	219	0	X
25000	WW3 domain of Nedd4L in complex with its HECT domain PY motif	219	59	27	0	X
10201	Zinc finger protein 473	219	160	35	0	X
12016	Sup35NM	219	0	219	0	X
10190	Zinc finger protein 95 homolog	219	157	34	0	X
7232	Pancreatic hormone	219	0	0	0	X
27448	apo AdcR homodimer	219	509	137	0	X
11368	Zinc finger protein 95 homolog	219	170	38	0	X
25100	pf tRNApro:MLV-Nucleocapsid (1:2) Complex	219	33	0	0	X		X
5714	Synthetic DNA duplex with an AG mismatch	219	0	0	0		X
18600	S67	219	166	36	0	X
26006	N-Galactosylated Pin1 WW Domain	218	0	0	0	X
10230	Zinc finger protein 224	218	148	37	0	X
26648	AMA1-RON2 complex	218	403	218	0	X
26598	DNA gyrase B subunit	218	636	218	0	X
19601	CXCL5	218	138	70	0	X
2223	pancreatic polypeptide	218	0	0	0	X
27053	KRAS oncogene promoter region	218	0	0	0		X
18192	SGF73	218	175	44	0	X
27662	human PCNA bound to RecQ5 peptide	218	0	218	0	X
5474	protein tyrosine phosphatase 1B	218	697	218	0	X
15974	b-b'-x	218	190	215	0	X
15065	2-PGA bound WT cTIM homodimer	218	449	218	0	X
19311	Saccharomyces cerevisiae Est3 protein	218	568	151	0	X
18798	HO-1	218	672	218	0	X
34130	GP41,GP41	218	45	0	0	X
10221	Zinc finger protein 224	218	153	36	0	X
25697	hCFTR NBD1 deltaRI I539T	218	581	206	0	X
6455	crambin	218	168	43	0	X
19702	dimerization domain of the human polyoma, JC virus agnoprotein	218	0	0	0	X
19323	FKBP12.6	218	307	98	0	X
27605	Nek2 kinase dimer	218	139	52	0	X
15094	homo-trimer	218	383	119	0	X
26597	DNA gyrase B	218	629	218	0	X
4191	Bmtx2	218	0	0	0	X
30012	DNA (5'-D(APGPGPGPCPGPGPTPGPTPGPGPGPAPAPTPAPGPGPGPAPA)-3')	218	0	0	0		X
10181	Zinc finger protein 224	218	155	35	0	X
25807	B3 domain of protein G	218	132	55	0	X
17494	Zinc knuckle in PRDM4	218	0	36	0	X
17721	CBD12	218	610	218	0	X
25872	TrkA transmembrane domain	217	154	37	0	X
10155	Zinc finger protein 484	217	156	32	0	X
4811	apo bovine alpha-lactalbumin	217	0	115	0	X
17152	EcAMP1	217	0	0	0	X
19232	two-domain RNA-binding fragment of Nrd1	217	71	127	0	X
26007	N-Xylosylated Pin1 WW Domain	217	0	0	0	X
16337	Complex of APH with antibiotic tobramycin	217	631	215	0	X
17193	SEVI precursor peptide PAP	217	0	0	0	X
11385	Zinc finger protein 28 homolog	217	161	31	0	X
28000	Ydj1_SBD	217	0	217	0	X
26008	N-L-idosylated Pin1 WW Domain	217	0	0	0	X
17527	Extracellular domain of mouse Notch-1 EGF12	217	0	0	0	X
26554	K2	217	150	44	0	X
25193	NisI	217	641	217	0	X
18779	FrpD_protein	217	687	217	0	X
25728	HBPd24r	217	360	151	0	X
25283	scoloptoxin SSD609 from Scolopendra mutilans	217	0	0	0	X
19324	FKBP12.6	217	307	98	0	X
4050	Rubredoxin	217	150	41	0	X
16643	CD2AP SH3-C monomer	216	118	61	0	X
19905	phosphorylated 4E-BP2 monomer	216	299	0	0	X
25949	Ex-4[1-27]/pl14a	216	0	0	0	X
10168	Zinc finger protein 28 homolog	216	158	35	0	X
10303	Zinc finger protein 28 homolog	216	160	31	0	X
4190	Bmtx1	216	0	0	0	X
16886	HCV NS2 [27-59]	216	120	0	0	X
7135	2SS(alpha)	216	0	108	0	X
780	SWI5 zinc finger	216	0	0	0	X
17920	tau-filaments	216	237	216	0	X
6785	Fv frangment of 6D9	216	639	214	0	X
1065	thymosin beta-4	216	0	0	0	X
5922	Potassium voltage-gated channel subfamily H member 2	216	0	0	0	X
30479	Acan1	216	76	34	0	X
27730	TMC.BHV	216	0	0	0	X
19813	BmKTX-D19K/K6D	216	0	0	0	X
12000	CJP-4	216	649	215	0	X
10199	Zinc finger protein 347	216	147	34	0	X
10188	Zinc finger protein 347	216	157	33	0	X
11170	Zinc finger protein 484	216	156	34	0	X
5965	headpiece subdomain	216	0	0	0	X
5652	CnErg1	215	0	0	0	X
16892	NS2[60-99]	215	0	0	0	X
26005	N-Allosylated Pin1 WW Domain	215	0	0	0	X
19825	HLA-B*35:01	215	617	213	0	X
18816	CR10	215	164	44	0	X
114	charybdatoxin	215	0	0	0	X
26656	Full-length HIV-1 Transactivator of Transcription	215	326	105	0	X
19979	B24G insulin	215	0	0	0	X
30648	Venom polypeptide	215	108	39	0	X
16182	PatE prepropeptide	215	0	0	0	X
15421	AgTX2, monomer	215	0	37	0	X
17384	Complex SrcKD with Imatinib	215	685	215	0	X
27733	FKBP12 FK506 complex	215	316	103	0	X
15248	Subtilisin bound to prodomainR9	215	673	215	0	X
34132	wtFP-tag,Gp41	215	95	36	0	X
6025	leukocyte cell-derived chemotaxin 2	215	334	115	0	X
17797	Chicken AvBD2 defensin	215	0	0	0	X
25780	CssA4 (bottom stem) of CssA thermometer	215	76	17	0			X
18800	HO-1	214	666	214	0	X
5184	toxin BeKm from the scorpion Buthus eupeus	214	0	0	0	X
10223	Zinc finger protein 347	214	144	30	0	X
10200	Zinc finger protein 473	214	156	32	0	X
5338	IEGF-3	214	0	42	0	X
16504	Human cannabinoid receptor 1 - helix 7/8 peptide	214	0	0	0	X
18110	C-terminal RAGE (ctRAGE)	214	107	40	0	X
34133	scrFP-tag,Gp41	214	97	28	0	X
19377	IL10 dimer	214	457	152	0	X
11346	Tumor necrosis factor receptor superfamily member 12A	214	161	40	0	X
17663	ORF57 56-140	214	229	73	0	X
10156	Zinc finger protein 484	214	148	30	0	X
25683	T456Y	214	0	0	0	X
10191	Zinc finger protein 268	214	158	36	0	X
26788	Whirlin	214	652	214	0	X
11395	Zinc finger protein 224	214	152	34	0	X
10167	Zinc finger protein 28 homolog	214	153	30	0	X
10187	Zinc finger protein 224	214	154	33	0	X
4750	CONSERVED MOTIF IN SRP RNA	214	0	0	0			X
6924	discrepin monomer	214	0	0	0	X
10210	Zinc finger protein 28 homolog	214	155	32	0	X
27289	DIS	214	0	0	0			X
5972	ProP antiparallel coiled-coil	214	0	0	0	X
19375	N2-dG IQ at G3 in NarI sequence	213	0	0	0		X
19629	Cyanobacterial GAF domain	213	357	132	0	X
18775	omp synthase	213	657	213	0	X
27279	N30alphabetaTCR, pTalpha/N30beta	213	610	213	0	X
10206	Zinc finger protein 28 homolog	213	151	31	0	X
4133	Tropomyosin_GCN4_chimera	213	0	0	0	X
16437	LDTI_-_IIb	213	0	0	0	X
11437	Propylene-DNA	213	0	0	0		X
34295	PPaTyr	213	35	30	0	X
5270	YqgF	213	340	111	0	X
30027	General control protein GCN4	213	114	36	0	X
4760	Pandinotoxin K-beta	213	0	0	0	X
17966	PDGFR-TM dimer	213	153	33	0	X
10153	Zinc finger protein 484	213	157	31	0	X
4298	V3 loop peptide of RF HIV-1 gp120 envelope protein	213	0	0	0	X
11378	POZ-, AT hook-, and zinc finger-containing protein 1	213	159	33	0	X
10192	Zinc finger protein 224	213	153	32	0	X
11165	Zinc finger protein 268	213	154	35	0	X
4924	Tityustoxin K-alpha	212	0	0	0	X
10227	Zinc finger protein 268	212	152	34	0	X
19745	DNA (28-MER)	212	0	0	0		X
26767	NSD1	212	612	212	0	X
25375	PTP1B CPT-157633 Complex	212	244	212	0	X
25705	N-NTD	212	637	212	0	X
16704	SPI2 (T7Y)	212	0	0	0	X
18774	omp synthase	212	656	212	0	X
19029	K2A1	212	219	54	0	X
30324	Two inhibitor peptide topologies 2	212	105	40	0	X
26698	rNedd4 WW3 Domain	212	133	38	0	X
15093	preB_ApoAI	212	458	211	0	X
27669	HuR FL	212	0	212	0	X
5057	Alzheimer peptide Ab(1-40) of man	212	0	0	0	X
30377	Beta-theraphotoxin-Cm1a	212	87	33	0	X
19270	Sigma-1 receptor chaperone domain	212	297	105	0	X
19291	Pin1 WW domain mutant 5-1	212	0	0	0	X
10307	Zinc finger protein 473	212	158	29	0	X
10152	Zinc finger protein 268	212	161	36	0	X
19046	Phosphatase domain of PTPN5	212	460	212	0	X
10180	Zinc finger protein 224	212	156	32	0	X
17409	triazole-linked DNA duplex	212	94	0	0		X
5852	A mimic of the VS Ribozyme Hairpin Substrate	212	153	69	0			X
25903	Glucose in a DNA double helix	212	0	0	0		X
25152	MTAbl13, a grafted MCoTI-II	211	0	0	0	X
11438	Protein	211	0	0	0		X
10173	Zinc finger protein 347	211	150	32	0	X
17528	Extracellular domain of mouse Notch-1 EGF12	211	0	0	0	X
10226	Zinc finger protein 268	211	152	34	0	X
19503	WW Domain with Loop 1 Excised	211	0	0	0	X
30318	Kappa-theraphotoxin-Aa1a	211	121	38	0	X
5371	U6 RNA	211	41	14	0			X
10204	Zinc finger protein 28 homolog	211	155	34	0	X
25569	PIN1 WW domain in complex with a phosphorylated CPEB1 derived peptide	211	0	0	0	X
5978	HCV NS5A N-terminal	211	120	0	0	X
1666	parathyroid-hormone-related protein	211	0	0	0	X
25423	NDP52 ubiquitin-binding zinc finger	211	103	34	0	X
19200	LDLa	211	111	42	0	X
10183	Zinc finger protein 484	211	158	30	0	X
6228	yeast TOR1 FATC	211	154	37	0	X
17487	monomer of ICL3 (residues A221 to K345) 5-HT1A	211	351	111	0	X
25992	MPT	211	136	41	0	X
11169	Zinc finger protein 484	211	151	32	0	X
4541	Potassium Channel Scorpion Toxin HsTX1	211	0	0	0	X
10017	ABCB6-C-ADP	211	642	211	0	X
15830	N-Y1	211	0	36	0	X
34134	scrFP-tag,Gp41	211	0	0	0	X
15323	moricin	211	0	0	0	X
36207	CMP-N-acetylneuraminate-poly-alpha-2,8-sialyltransferase (E.C.2.4.99.-)	211	119	32	0	X
10228	Zinc finger protein 95 homolog	210	147	34	0	X
25433	RBM10_ZnF1	210	140	39	0	X
19908	L7Ae RNA complex	210	326	111	0	X		X
17867	Myosin Binding Protein-C Motif	210	298	100	0	X
17764	Abeta	210	0	0	0	X
30045	DNA (5'-D(GPGPGPTPTPTPGPGPGPTPTPTPTPGPGPGPAPGPGPG)-3')	210	0	0	0		X
30319	SER-PRO-GLU-GLU-ARG-ALA-GLN-LEU-CYS-THR-ALA-ALA-GLU-LYS-ALA-ASP-GLU-LEU-GLY	210	87	0	0	X
4859	METALLOTHIONEIN	210	0	0	0	X
17675	NTL9 V3AI4A double mutant	210	317	105	0	X
16356	5'-D(APGPGPGPTPTPAPGPGPGPTPTPAP(INO)PGPGPTPTPAPGPGPGP*T)-3'	210	0	0	0		X
10305	Zinc finger protein 347	210	162	34	0	X
7321	LDLa module of RXFP1	210	100	43	0	X
10220	Zinc finger protein 95 homolog	210	151	33	0	X
7273	Jingzhaotoxin-3	210	0	0	0	X
19209	HDHD4	210	654	210	0	X
27174	bPGM-D10N-bG16P-Mg complex	210	636	210	0	X
27175	bPGM-D10N-bG16P complex	210	637	210	0	X
11050	BARpeptide	210	0	38	0	X
6729	DSP monomer	210	0	0	0	X
15467	beta phosphoglucomutase in complex with glucose-6-phosphate and AlF4-	210	405	210	0	X
4561	Imperatoxin	210	101	0	0	X
27641	Mps1 1-239	210	617	210	0	X
16409	beta-phosphoglucoutase	210	415	210	0	X
7234	beta phosphoglucomutase	210	646	210	0	X
18738	eIF4GI-HEAT1	210	591	210	0	X
17397	RET_oncogene	209	0	0	0		X
25959	nigellin-1.1	209	104	0	0	X
7065	Gaegurin-4	209	0	0	0	X
6264	Cryptdin-4	209	0	0	0	X
17379	5'-D(TPGPAPGPGPGPTPGPGPGPTPAPGPGPGPTPGPGPGPTPAPA)-3', 2-CARBOXYQUINOXALINE	209	0	0	0		X
18336	RNA_(27-MER)	209	69	9	0			X
27281	N15alphabetaTCR, pTalpha/N15beta	209	598	209	0	X
17343	NOXO1b	209	443	135	0	X
10179	Zinc finger protein 28 homolog	209	152	30	0	X
4192	vpr fragment, HIV viral protein	209	0	0	0	X
27696	dmUbp15	209	318	99	0	X
10234	Zinc finger protein 347	209	150	33	0	X
19114	4E-BP2	209	438	113	0	X
11167	Zinc finger protein 347	209	149	33	0	X
25686	G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome	209	0	0	0		X
27267	Jun monomer	208	437	208	0	X
11484	protein	208	145	31	0	X
17083	65-MER	208	0	0	0			X
18827	Gate16	208	333	106	0	X
10308	Zinc finger protein 473	208	152	36	0	X
4233	omega-atracotoxin-Hv1a	208	0	0	0	X
17851	beta phosphoglucomutase inhibited with trifluoroberyllate	208	643	208	0	X
6537	5'-d(CTAACAGAATG)-3'/5'-d(CATTCAGTTAG)-3'/Naphthyridine-Azaquinolone1/Naphthyridine-Azaquinolone2	208	0	0	0		X
16438	LDTI - IIc	208	0	0	0	X
10222	Zinc finger protein 268	208	147	33	0	X
4647	HPRT Gene Mutation Hotspot with a BPDE2(10R) Adduct	208	0	0	0		X
1374	ovomucoid third domain	208	0	0	0	X
10171	Zinc finger protein 224	208	154	34	0	X
19488	WW domain with polyproline stretch (PP2WW) of HYPB	208	150	46	0	X
25682	T456D	208	0	0	0	X
25151	Hs1a	208	111	39	0	X
27144	c-Myc Pu22	207	0	0	0		X
5732	SCR3 peptide (18-54)	207	0	0	0	X
2395	somatotropin	207	0	0	0	X
10178	Zinc finger protein 473	207	153	33	0	X
1968	endothelin	207	0	0	0	X
10166	Zinc finger protein 268	207	154	32	0	X
25680	L453W	207	0	0	0	X
5132	attm+4	207	0	55	0	X
18815	his-eiav-ca	207	650	207	0	X
30512	7SK RNA	207	49	27	0			X
25419	TRTX-Tp1a from the tarantula Thrixopelma pruriens	207	0	0	0	X
16146	SEH	207	396	207	0	X
25866	rNedd4 WW2 Domain	207	118	35	0	X
26601	N30alphabetaTCR, pTalpha/N30beta	207	606	207	0	X
19763	MS1	207	0	207	0	X
7299	cfc	207	0	0	0	X
27070	FKBP25	207	632	207	0	X
30376	Beta-theraphotoxin-Cm1a	207	85	28	0	X
4216	CRE-BP1	207	66	34	0	X
6034	ear-domain of alpha-adaptin C	207	655	207	0	X
19264	W184AM185A mutant of the HIV-1 capsid protein	206	648	206	0	X
17798	chicken AvBD2-K31A mutant	206	0	0	0	X
19993	LysRS1-72	206	166	61	0	X
17889	NvVg	206	0	37	0	X
321	parathyroid-hormone-related protein	206	0	0	0	X
10217	Zinc finger protein 268	206	155	31	0	X
30165	Microcin J25	206	0	0	0	X
4542	5'-D(APGPGPAPTPCPCPTPTPTPUPGPGPAPTPCPCPT)-3'	206	0	0	0		X
4322	consensus V3 loop peptide	206	0	0	0	X
27280	N15alphabetaTCR, pTalpha/N15beta	206	593	206	0	X
16705	SPI2 (T7A)	206	82	41	0	X
25050	membrane-active toxin from crab spider Heriaeus melloteei	206	88	0	0	X
15728	EphA1 TM dimer	206	152	35	0	X
6194	Omega-atracotoxin-Hv1a	206	130	40	0	X
19286	BeF3 Activated Sma0114	206	71	103	0	X
30149	Chlorotoxin	206	136	37	0	X
10197	Zinc finger protein 224	206	154	32	0	X
26847	Protein Tyrosine Phosphatase 1B N193A variant in complex with TCS401	206	407	206	0	X
30597	Wasabi Receptor Toxin	206	107	0	0	X
15318	Pelovaterin	206	0	0	0	X
16935	PECAM-1	206	186	47	0	X
7117	Hybrid atracotoxin	206	148	43	0	X
6402	CsrA dimer	206	165	0	0	X
10170	Zinc finger protein 28 homolog	206	152	33	0	X
27738	FKBP12	206	304	99	0	X
26768	NSD2	206	629	206	0	X
4509	crambin	206	0	0	0	X
10224	Zinc finger protein 268	205	152	36	0	X
17194	Oxki4a	205	0	0	0	X
25526	RNA 27-MER, RIBOSTAMYCIN	205	180	27	8			X
27031	DANCER-1	205	162	56	0	X
18652	alpha sub-domain	205	214	101	0	X
25472	mu-SLPTX-Ssm6a	205	0	0	0	X
11393	Zinc finger protein 347	205	0	30	0	X
10207	Zinc finger protein 347	205	146	32	0	X
11476	protein	205	146	31	0	X
16609	rna-ligand complex	205	180	27	9			X
15238	Ab_C_alpha	205	0	0	0		X
27210	PhoBNF20D	205	218	109	0	X
5098	leginsulin	205	0	0	0	X
11168	Zinc finger protein 347	205	145	28	0	X
27726	Arf1_L8K_GTPgS	205	308	130	0	X
17328	CIB1	205	515	131	0	X
34268	Potassium channel toxin alpha-KTx 15.3	205	0	34	0	X
25048	Transient Collagen Triple Helix Binding to a Key Metalloproteinase	205	502	167	0	X
19085	SPI-2 inhibitor	205	96	42	0	X
30522	Toxin GTx1-15	205	96	36	0	X
26848	COMT monomer, SAM, DNC, Mg	205	641	205	0	X
11601	hESRP1-RRM3	205	289	97	0	X
17011	E2[296-331] segment of Hepaptitis C Virus	205	125	0	0	X
18449	SBM	205	101	34	0	X
11470	homodimer	205	602	205	0	X
15992	Vm24	205	0	0	0	X
10216	Zinc finger protein 268	204	147	37	0	X
26873	NS2B-NS3 Protease from Zika Virus	204	614	204	0	X
10016	ABCB6-C	204	627	204	0	X
7132	CheA P1 domain	204	276	122	0	X
16703	SPI2	204	111	38	0	X
25678	L453D	204	0	0	0	X
27468	gp17.1 phage tail	204	503	152	0	X
30256	O-acyltransferase	204	0	31	0	X
5703	U6 snRNA intramolecular stem loop	204	66	0	1			X
26851	COMT monomer, Sinefungin, DNC, Mg	204	639	204	0	X
19998	sodium channel toxin Hd1a	204	138	38	0	X
4934	p53 dimer	204	95	37	0	X
27082	Apo FGFR3	204	426	205	0	X
6758	EcCdtB-II	204	614	200	0	X
15026	Nar1IQ3 Duplex	204	0	0	0		X
18191	SGF11	204	144	45	0	X
25748	ddFLN5+110	204	271	122	0	X
15239	Ab_C_beta	204	0	0	0		X
1918	carboxypeptidase inhibitor	204	0	0	0	X
16838	soluble tissue factor	204	543	204	0	X
15140	mytilin	204	0	0	0	X
26609	active domains of the type II topoisomerases	204	612	204	0	X
15111	Cbl-b	204	113	42	0	X
26608	active domains of the type II topoisomerases	204	607	204	0	X
25785	CssA5 (middle region) of CssA thermometer	204	32	18	0			X
4187	Sigma-K RNA Polymerase Promoter Consensus Sequence	204	0	0	0		X
30244	Heterogeneous-backbone Foldamer Mimic of the Sp1-3 Zinc Finger	203	0	0	0	X
5739	5'-D(APCPAPTPCPXPAPTPCPT)-3'	203	0	0	0		X
25629	Kinase	203	410	203	0	X
19138	ED Complex	203	329	101	0	X
34199	RNA (27-MER)	203	0	0	0			X
15027	Nar1 Duplex	203	0	0	0		X
26644	N-terminal 24-kDa fragment of Escherichia coli topoisomerase IV ParE subunit	203	610	203	0	X
5655	U80G U6 ISL RNA	203	138	15	0			X
4820	Pheromone Er-22	203	37	0	0	X
10208	Zinc finger protein 473	203	147	32	0	X
19582	peptide derived from the membrane proximal external region of HIV-1 gp41	203	87	0	0	X
34114	rSP-C33Leu -RECOMBINANT PULMONARY SURFACTANT-ASSOCIATED POLYPEPTIDE C ANALOGUE-	203	41	31	0	X
27173	KRAS promoter region	203	136	12	0		X
4733	bulge DNA 12/14mer	203	0	0	0		X
6192	Omega-atracotoxin-Hv1a	203	123	39	0	X
30190	Mu-theraphotoxin-Hs2a	203	89	31	0	X
17540	human Yap in complex with a human Smad1 derived peptide	203	62	28	0	X
30660	Putative Late nodulin	203	160	36	0	X
7252	p53 tetramerization domain	203	0	0	0	X
19583	peptide derived from the membrane proximal external region of HIV-1 gp41	203	20	0	0	X
30647	Venom polypeptide	203	99	33	0	X
3456	defensin A	203	0	0	0	X
26934	first stem-loop of DsrA RNA	203	140	27	0			X
5674	HAINANTOXIN-IV	203	0	0	0	X
25670	Enterocin HF	203	0	0	0	X
16943	PatE1-34	202	0	0	0	X
27496	PLCg1 tandem	202	466	202	0	X
11382	Zinc finger protein 32	202	149	33	0	X
11522	the monomeric human M-ficolin fibrinogen-like domain	202	626	202	0	X
25847	cyclic PVIIA	202	93	41	0	X
27395	Hsc70	202	460	122	0	X
1917	carboxypeptidase inhibitor	202	0	0	0	X
30028	General control protein GCN4	202	135	35	0	X
10219	Zinc finger protein 268	202	156	36	0	X
15731	Tick Carboxypeptidase Inhibitor	202	0	0	0	X
27739	FKBP12 FK506 complex	202	301	99	0	X
18902	major G-quadruplex	202	0	0	0		X
5911	PNC27	202	112	0	0	X
15937	p9 (22-51)	202	0	0	0	X
5746	Adenylate Kinase from Escherichia coli	202	0	202	0	X
30236	Bacteriocin	202	104	37	0	X
18040	DNA_1	202	0	0	20		X
27278	N15alphabetaTCR, pTalpha/N15beta	202	588	202	0	X
5553	C4 promoter of influneza A virus	202	29	11	18			X
25817	transmembrane domain of human nicastrin in SDS micelles	202	128	44	0	X
25421	G7W/N24S Hhn2b	202	145	35	0	X
27661	PCNA-p12 complex	202	0	202	0	X
18300	Solution NMR structure of asteropusin A from marine sponge Asteropus sp.	202	118	0	0	X
6558	Formin-binding protein 3	202	129	44	0	X
19089	adenylate kinase with ADP	201	0	201	0	X
27895	NF-kappaB p50 dimerization domain	201	297	98	0	X
25696	hCFTR NBD1 deltaRI	201	585	201	0	X
27176	Coronavirus nsp1 truncated proteins; nsp1(13-25)	201	247	86	0	X
16279	Hsp90 middle domain	201	671	201	0	X
11392	Zinc finger protein 28 homolog	201	148	34	0	X
26044	D1 CDTa	201	642	201	0	X
30107	Phenol-soluble modulin Beta2	201	0	0	0	X
19207	HDHD4	201	610	201	0	X
126	iron-uptake regulation protein (Fur)	201	0	0	0	X
1209	sapecin	201	0	0	0	X
30655	DnaJ homolog subfamily B member 6	201	535	159	0	X
19659	RHB Modified duplex	201	0	0	0		X
18347	micasin	201	0	0	0	X
26763	STARD6-testosterone complex	201	608	201	0	X
17539	first WW domain of human YAP in complex with a human Smad1 doubly-phosphorilated derived peptide	201	0	0	0	X
30656	DnaJ homolog subfamily B member 6	201	535	159	0	X
10209	Zinc finger protein 473	201	152	35	0	X
17970	RBM5-ZF1	200	0	0	0	X
18625	Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'	200	0	0	0		X
25302	Monomer of Mo3964	200	144	37	0	X
16359	NS2B_NS3pro	200	0	200	0	X
5716	CK14 DNA 14-MER DUPLEX	200	0	0	0		X
17852	beta phosphoglucomutase in a ternary complex with glucose-6-phosphate and trifluoroberyllate	200	634	200	0	X
17969	RBM5-ZF1	200	0	0	0	X
34378	Kiteplatinated DNA oligomer	200	0	0	0		X
6370	Toxin APETx1	200	0	0	0	X
26569	TCR 3c8m t55a, TCR alpha	200	624	200	0	X
11474	protein	200	148	32	0	X
17836	IscU	200	344	99	0	X
30067	W35	200	76	41	0	X
4074	reduced human ferredoxin	200	285	95	0	X
4514	Third complement-like repeat (CR3) from lipoprotein receptor related protein	200	69	40	0	X
25357	Adenylate Kinase Y171W	200	0	200	0	X
30521	Beta/omega-theraphotoxin-Tp2a	199	86	28	0	X
27522	shp2_shnc_e76k	199	375	199	0	X
34033	PPa-CH3	199	38	32	0	X
11384	Zinc finger protein 268	199	154	34	0	X
7253	p53 tetramerization domain	199	0	0	0	X
19037	h-prune C-terminal domain	199	247	86	0	X
5702	Omega-atracotoxin-Hv1a	199	126	40	0	X
1336	enhancer-binding protein	199	0	0	0	X
6975	Bcl2MidG4Pu23-G15T/G16T	199	0	0	0		X
4715	YQJ8 WW domain	199	0	0	0	X
6589	Chromo domain 1 of cpSRP43	199	107	44	0	X
18783	ASTEROPSIN B FROM MARINE SPONGE ASTEROPUS	199	118	0	0	X
5832	hainantoxin-III	199	0	0	0	X
10229	Zinc finger protein 268	199	148	34	0	X
25060	dCDS1-RNA	199	179	70	0	X		X
7251	p53 tetramerization domain	199	0	0	0	X
11396	Zinc finger protein 484	199	153	32	0	X
34032	PPaOMe	199	39	32	0	X
27564	B. cereus 5/B/6 metallo-beta-lactamse	199	566	199	0	X
18178	AGR2 residues 41-175	199	480	135	0	X
30538	Potassium channel toxin alpha-KTx 6.21	199	140	40	0	X
10182	Zinc finger protein 473	199	145	32	0	X
18897	NMR structure of the glycosylated conotoxin CcTx from Conus consors	199	126	0	0	X
5666	truncated GFPuv	199	588	199	0	X
16627	Protein GB1	198	161	55	0	X
25353	Kinase	198	0	198	0	X
6062	NRS23	198	153	15	17			X
26600	N15alphabetaTCR, pTalpha/N15beta	198	580	198	0	X
5718	XBY2 DNA 14-MER DUPLEX	198	0	0	0		X
11049	BARpeptide	198	0	38	0	X
6554	Alzheimer's disease amyloid	198	30	0	0	X
25248	RING Finger monomer	198	165	64	0	X
27778	RL2 monomer	198	354	99	0	X
15879	FSD_mod	198	23	0	0	X
17781	hexamer	198	620	198	0	X
19661	SHB modified duplex	198	0	0	0		X
34267	cyriotoxin-1a	198	0	0	0	X
10306	B-cell lymphoma 6 protein	198	148	35	0	X
4844	methionine sulfoxide reductase	198	612	198	0	X
10218	Zinc finger protein 268	198	146	36	0	X
18307	A2POBEC2 1-224	198	387	198	0	X
16932	F2F3	198	207	198	0	X
26882	MCoAA-02	198	0	0	0	X
30520	Human beta-defensin	198	94	33	0	X
18626	Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin	198	0	0	0		X
5410	obtustatin	198	0	0	0	X
30180	Dihydroorotate dehydrogenase (quinone), mitochondrial (E.C.1.3.5.2)	198	51	32	0	X
16604	rna-ligand complex	198	174	26	0			X
16284	y1fatc	198	123	36	0	X
25224	human IgG-Fc	197	542	198	0	X
5927	5'-D(CPGPCPTPAPAPCPAPGPGP*C)-3'	197	0	0	0		X
18683	E coli adenylate kinase: wild type	197	0	197	0	X
10174	Zinc finger protein 347	197	146	31	0	X
16295	y1fatc	197	119	36	0	X
6892	lung surfactant protein C	197	0	0	0	X
4536	5'-D(APGPGPAPTPCPCPTPUPTPTPGPGPAPTPCPCPT)-3'	197	0	0	0		X
11171	Zinc finger protein 484	197	143	30	0	X
19263	MPERp	197	7	0	0	X
27553	Hck	197	165	49	0	X
17773	MS1	197	590	197	0	X
5359	Bovine Pancreatic Trypsin Inhibitor	197	196	53	0	X
17538	second WW domain from human YAP in complex with a human Smad1 derived peptide	197	64	30	0	X
26962	bmAANAT3	197	601	197	0	X
5525	Tristetraproline	197	72	0	0	X
34062	G-quadruplex formed by a human telomeric sequence modified with 2'-fluoro-2'-deoxyriboguanosine	197	46	0	0		X
26855	phosducin	197	402	155	0	X
16405	Ataxin-3/Ubiquitin complex	197	133	41	0	X
25031	spider-venom peptides against the analgesics target NaV1	197	140	35	0	X
10196	Zinc finger protein 95 homolog	197	145	31	0	X
16367	CFTR NBD1-RE monomer	197	593	197	0	X
6067	K27A Hainantoxin-IV	197	0	0	0	X
10177	Zinc finger protein 484	197	148	30	0	X
25775	spider-venom peptide Hm1a	197	107	38	0	X
18236	cruzain	197	631	182	0	X
10157	B-cell lymphoma 6 protein	197	149	31	0	X
27208	Fc fragment of mouse immunoglobulin G	197	425	197	0	X
5712	eIF4E	197	606	197	0	X
9	carboxypeptidase inhibitor	197	0	0	0	X
36052	Exoglucanase 1 (E.C.3.2.1.91)	196	115	38	0	X
19878	Int-DLP	196	0	0	0	X
131	cytochrome c	196	0	0	0	X
36053	Exoglucanase 1 (E.C.3.2.1.91)	196	115	38	0	X
27285	H-2Kb heavy subunit within VSV8/H-2Kb/b2m heterotrimeric complex	196	296	196	0	X
36051	Exoglucanase 1 (E.C.3.2.1.91)	196	147	38	0	X
17162	Dronpa	196	392	196	0	X
6066	K27A Hainantoxin-IV	196	0	0	0	X
18784	ABU8-3	196	114	0	0	X
34249	Gelation factor	196	266	94	0	X
27664	UbcH7-Ub	196	0	208	0	X
30224	phage GA operator RNA hairpin	196	158	49	21			X
4148	cellulose-binding domain	196	0	0	0	X
25310	FBP28 WW2 mutant Y446L	196	0	0	0	X
25917	ProTx-II	196	84	33	0	X
18043	Insect Defensin Lucifensin from Lucilia sericata	196	92	0	0	X
19833	antimicrobial peptide LsbB	196	92	31	0	X
19859	GK cecropin-like peptide	196	53	27	0	X
6719	FBP11 WW1 COMPLEXED WITH A PL MOTIF PEPTIDE	196	104	31	0	X
30238	Bacteriocin pediocin PA-1	196	0	0	0	X
6349	LH1 alfa polypeptide	196	147	50	0	X
34069	Islet amyloid polypeptide	196	56	42	0	X
4411	transforming growth factor beta3	196	0	90	0	X
25063	[ZnZn]-IMP-1	196	555	196	0	X
36054	Exoglucanase 1 (E.C.3.2.1.91)	196	115	38	0	X
19435	Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligand	196	0	0	0		X
11415	Zinc finger protein 32	196	138	32	0	X
25332	Family 1 Carbohydrate-Binding Module from Trichoderma reesei Cel7A with O-mannose residues at Thr1, Ser3, and Ser14	196	0	0	0	X
19450	ShK-like immunomodulatory peptide from Brugia malayi	196	118	40	0	X
19448	dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequence	196	0	0	0		X
10158	Zinc finger protein 473	196	148	36	0	X
36040	Morintide mO1	196	0	0	0	X
18217	HIGD1A	195	204	71	0	X
30419	OspTx2a-p1	195	0	38	0	X
18414	AdcR	195	475	139	0	X
6467	APETx2	195	0	0	0	X
25719	Regnase-1 Zinc finger domain	195	111	26	0	X
15514	human IgG1 Fc	195	573	195	0	X
5149	D130I mutant T3-I2(D130I) peptide	195	0	0	0	X
27521	shp2-cd5	195	591	195	0	X
6809	rabbitpox vCCI	195	583	195	0	X
27002	HuR RRM1-RRM2	195	582	193	0	X
18287	PAP248-286	195	0	0	0	X
10175	Zinc finger protein 28 homolog	195	145	30	0	X
16739	plectasin	195	148	42	0	X
19076	CcP	195	515	195	0	X
10172	Zinc finger protein 224	195	138	31	0	X
27413	Alkbh5 66-292	195	609	195	0	X
27589	ANSII homotetramer	195	676	198	0	X
19070	GLUCAGON AIB2,16 LYS13-GAMMAGLU-GAMMAGLU-C16 AMIDE	195	0	0	0	X
16541	Nurr1 monomer	195	566	196	0	X
15745	HBV stem-loop alpha;	195	145	50	0			X
11383	Zinc finger protein 268	194	144	34	0	X
96	lac repressor headpiece	194	0	0	0	X
11391	Zinc finger protein 268	194	141	35	0	X
25309	FBP28 WW2 , mutation Y438R	194	0	0	0	X
25331	Family 1 Carbohydrate-Binding Module from Trichoderma reesei Cel7A with O-mannose residues at Thr1 and Ser3	194	0	0	0	X
4713	Prototype WW domain	194	0	0	0	X
5752	human Integrin alpha2 I-domain	194	580	194	0	X
17008	SR10	194	456	140	0	X
27920	bPGM-P146A-Mg complex	194	612	194	0	X
30420	OspTx2a-p2	194	0	38	0	X
30378	OspTx2b	194	0	39	0	X
17997	Cd(II) form of Desulforedoxin	194	0	0	0	X
15878	SycE-YopE complex	194	216	194	0	X
19875	Pyrin	194	297	93	0	X
19594	G-quadruplex bound to the bisquinolinium compound Phen-DC3	194	0	0	0		X
17189	Rpp30	194	570	195	0	X
25361	Y171W mutant of Adenylate Kinase in complex with Ap5a for state a	194	0	194	0	X
19832	antimicrobial peptide LsbB	194	98	28	0	X
34312	RNA (5'-R(APUPAPCP(PSU)P(PSU)PAPCPCPUPG)-3'), RNA (5'-R(GPGPAPGPUPAPAPGPUPCPU)-3')	194	147	0	0			X
11467	Family GH19 chitinase from Rye seeds	194	530	194	0	X
17043	TMS2 domain of Dengue virus NS4A protein	193	96	0	0	X
15250	Subtilisin	193	594	193	0	X
11166	Zinc finger protein 268	193	143	33	0	X
17542	human Smurf1 in complex with a doubly phosphorylated human Smad1 derived peptide	193	49	19	0	X
17247	xeFn14	193	0	36	0	X
2261	Tissue-type Plasminogen Activator Kringle 2	193	0	0	0	X
15000	F5-Phe-cVHP	193	77	40	0	X
30055	DNA (5'-D(GPGPTPTPTPGPGPTPTPTPTPGPGPTPTPTPGPG)-3')	193	0	0	0		X
19515	MPER-PB7	193	145	31	0	X
17888	Polyserine Tract of Apis mellifera Vitellogenin, residues 358-392	193	0	0	0	X
15747	PROTEIN	193	97	0	0	X
25699	N-terminal membrane-anchoring region of the glycosyltransferase WaaG	193	84	0	0	X
10176	Zinc finger protein 28 homolog	193	139	32	0	X
26996	NS2B/NS3	193	332	193	0	X
4416	Cis-syn thymine cyclobutane dimer	193	0	0	22		X
4415	DNA dodecamer duplex	193	0	0	22		X
7426	SycE-YopE complex	193	84	193	0	X
25249	RING Finger monomer	193	165	63	0	X
26562	major mite allergen Der p 23	193	139	41	0	X
34269	DNA (5'-D(GPGPCPGPAPGPGPAPGPGPGPGPCPGPTPGPGPCPCPGPGPC)-3')	193	0	0	0		X
15945	MDM2 N-terminal domain, residues 17-125	193	203	101	0	X
34109	Toll-like receptor 4	192	158	34	0	X
11477	protein	192	144	31	0	X
27052	TIM9/10	192	453	163	0	X
18324	TAR RNA binding protein 2 (19-228)	192	589	192	0	X
16736	P62 PB1 Dimer	192	0	192	0	X
6429	RXRalpha ligand-binding domain dimer	192	612	192	0	X
32	lac repressor headpiece	192	0	0	0	X
36066	pB1	192	0	0	0	X
17024	Znf_A20:ubiquitin complex	192	178	65	0	X
25311	FBP28 WW2 mutant W457F	192	0	0	0	X
11481	protein	192	145	30	0	X
36068	Vaccatide, vH1	192	0	0	0	X
25218	amyloid beta	192	78	42	0	X
19092	adenylate kinase with ADP	192	0	191	0	X
19514	MPER-Du151	192	112	34	0	X
5464	Monocytic leukemia zinc finger protein	192	0	0	0	X
5592	human GMEB1 extended SAND domain	192	270	92	0	X
18463	Eurocin	192	91	6	0	X
11441	Bryum coronatum chitinase	192	578	192	0	X
4125	RNAse P RNA_1	192	0	0	0			X
25818	transmembrane domain of human nicastrin in DPC micelles	192	120	45	0	X
26927	NS2B-NS3 Protease from Zika Virus in complex with acetyl-lysine-arginine	192	580	192	0	X
26602	D10alphabetaTCR, pTalpha/D10beta	192	554	192	0	X
18344	assembly	192	487	177	0	X
6183	cAMP-dependent protein kinase	191	579	191	0	X
5720	Adenylate Kinase from Escherichia coli	191	0	191	0	X
36056	Exoglucanase 1 (E.C.3.2.1.91)	191	111	38	0	X
25889	F1F2 free	191	0	191	0	X
18946	As1a	191	136	40	0	X
36055	Exoglucanase 1 (E.C.3.2.1.91)	191	114	37	0	X
26541	FimH-CRD	191	510	173	0	X
11379	POZ-, AT hook-, and zinc finger-containing protein 1	191	157	29	0	X
26933	NS2B-NS3 Protease from Zika Virus in complex with acetyl-lysine-arginine aldehyde	191	592	191	0	X
11466	Bryum coronatum chitinase E61A mutant	191	576	191	0	X
4650	SHEEP PRION PEPTIDE	191	0	0	0	X
6636	PcFK1 monomer	191	0	0	0	X
15264	ahpfn	191	390	191	0	X
5066	metallothionein-3	191	0	35	0	X
4388	Cyclic AMP Receptor Protein dimer	191	579	191	0	X
34031	PPaTyr	191	41	32	0	X
6263	Rubredoxin	191	0	0	0	X
17681	short chain LaIT 1	191	100	35	0	X
15070	heme oxygenase	191	571	190	0	X
50121	RPA70AB-DNA	191	0	191	0	X
15066	apo PGG/GGG	191	404	191	0	X
27431	BamA C-terminal extended barrel	191	293	191	0	X
5405	peptide n3	191	0	0	0	X
19300	protoxin-1	190	81	32	0	X
196	cellobiohydrolase	190	0	0	0	X
30164	Mu-theraphotoxin-Pn3a	190	79	33	0	X
16140	Monomer	190	0	0	0	X
15730	intermediate IIIa of Tick Carboxypeptidase Inhibitor	190	0	0	0	X
5693	Ligand loaded growth factor receptor-bound protein 2	190	608	190	0	X
19545	cGCUUAg RNA Pentaloop from Bovine Enterovirus Vir404/03	190	132	17	0			X
30136	Flagellar protein FliT	190	194	103	0	X
34277	tc-DNA/tc-DNA duplex	190	0	0	0		X
1497	transcriptional activator ADR1	190	0	0	0	X
6473	acid-unfolded state of hUBF HMG Box 1	190	297	91	0	X
26999	AdKw	190	0	190	0	X
5062	HIV-1 protease tethered dimer	190	569	191	0	X
27282	NS2B-NS3 Protease from Zika Virus	190	561	190	0	X
5857	GSH-SIP7-50	190	175	43	0	X
5795	Eucommia antifungal peptide 2	190	0	0	0	X
19262	MPERp	190	18	0	0	X
7255	p53 tetramerization domain	190	0	0	0	X
11416	Zinc finger protein 32	190	137	31	0	X
30015	DNA (5'-D(CPGPCPTPCP(RIB)PCPAPCPGPC)-3'), DNA (5'-D(GPCPGPTPGPGPGPAP(8OG)PCPG)-3')	190	0	0	0		X
1496	transcriptional activator ADR1	190	0	0	0	X
19483	WW domain of HYPB	190	147	44	0	X
25928	vitamin B12 conjugate of PYY3-36	190	0	0	0	X
18316	C-terminal domain of the MgtC protein	190	264	89	0	X
25231	14-3-3 Zeta	190	377	189	0	X
17541	human Smurf1 in complex with a phosphorylated human Smad1 derived peptide	190	0	0	0	X
18686	E coli adenylate kinase: E170A	189	0	189	0	X
30354	Defensin-1	189	0	0	0	X
10151	Zinc finger protein 268	189	136	31	0	X
11177	RecO	189	0	189	0	X
16187	FP1	189	0	0	0	X
30143	Designed peptide NC_cHH_D1	189	57	24	0	X
27958	spin labled DNA duplex	189	0	0	0		X
25645	HSPB1_ACD	189	176	81	0	X
26759	NSD2 C16	189	584	189	0	X
19035	G-rich VEGF aptamer with LNA modifications	189	0	0	0		X
4476	Potassium channel	189	0	0	0	X
17655	Human Telomeric DNA	189	0	0	0		X
17979	Zn(II) form of Desulforedoxin	189	0	0	0	X
27914	AIMP2 121-320 double-mutant (C205S,C291S)	189	540	189	0	X
4477	Potassium channel	189	0	0	0	X
18799	HO-1	189	597	189	0	X
15299	AgTx2-MTX toxin	189	0	0	0	X
4842	PORCINE PEPTIDE YY	189	0	0	0	X
18730	West_nile_protease	189	557	187	0	X
25982	Peptide model of 4-stranded beta-arch	189	0	0	0	X
7136	2SS(beta)	189	76	96	0	X
6352	Epilancin 15X	189	140	0	0	X
27590	ANSII homotetramer	189	973	243	0	X
36050	Exoglucanase 1 (E.C.3.2.1.91)	189	109	38	0	X
19255	FimH Y48A mutant	189	0	171	0	X
19513	MPER-Con089	189	112	32	0	X
26004	U5-scytotoxin-Sth1a	189	146	38	0	X
6610	apg8a	188	282	95	0	X
2012	calcitonin C	188	0	0	0	X
27728	N.BHV	188	0	0	0	X
17940	p38alpha	188	591	188	0	X
19239	2c TCR	188	543	188	0	X
19951	apoE(195-299)	188	306	94	0	X
249	calcitonin C	188	0	0	0	X
19490	cdN dimer	188	565	188	0	X
11479	protein	188	143	30	0	X
6311	Spry domain-containing SOCS box protein 2	188	570	187	0	X
16265	N-terminal domain monomer	188	389	188	0	X
18019	U1-TRTX-Sp1a	188	56	26	0	X
26688	Mg2+ -bound myrGCAP1 (V77E) mutant	188	283	113	0	X
25999	St domain of EMCV IRES	188	164	0	0			X
16960	Solution structure of GxTX-1E	188	0	0	0	X
19254	FimH Y48A mutant - Heptyl-mannose complex	188	0	170	0	X
34271	AapA1	188	0	31	0	X
17394	amidated IAPP	188	0	0	0	X
4203	Cn2(1-15)NH2-S-S-AcetylCn2(52-66)NH2	188	0	0	0	X
30069	W37	188	84	39	0	X
34105	Dehydroascorbate reductase family protein	188	0	188	0	X
15559	NS4B	188	106	0	0	X
18690	MOMERIC PIL-E G-QUADRUPLEX DNA	188	0	0	0		X
34339	Envelope glycoprotein N	188	0	0	0	X
18760	YLTA IkappaBalpha	188	201	188	0	X
7404	Human U64 H/ACA snoRNA	188	127	31	0			X
27471	AapA1	188	0	31	0	X
1500	male-associated protein	188	0	0	0	X
18421	eiavCA monomer	188	588	185	0	X
15963	HasAp Full-Length polypeptide	188	578	188	0	X
192	cellobiohydrolase	188	0	0	0	X
19725	Ig-alpha YE variant Ig-beta construct	188	0	95	0	X
7254	p53 tetramerization domain	188	0	0	0	X
27188	CheA	187	350	187	0	X
17788	gamma-hydroxy-1,N2-propano-2'-deoxyguanosine adduct	187	0	0	0	X	X
30016	DNA (5'-D(CPGPCPTPCP(RIB)PCPAPCPGPC)-3'), DNA (5'-D(GPCP(8OG)PTPGPGPGPAPGPCPG)-3')	187	0	0	0		X
11067	GIRK1 tetramer	187	578	187	0	X
5851	Kruppel-like factor 3	187	0	33	0	X
16149	PlnK	187	113	31	0	X
26782	USP7 - ICP0 complex	187	563	187	0	X
19512	MPER-HxB2-AA	187	142	32	0	X
25804	muO-conotoxin MfVIA	187	98	22	0	X
15245	villin_G34L monomer	187	0	0	0	X
19723	Ig-alpha Ig-beta construct	187	236	95	0	X
34093	Dehydroascorbate reductase family protein	187	0	187	0	X
4685	J-atracotoxin-Hv1c	187	0	0	0	X
19218	Grx8	186	89	32	0	X
17748	ERK2	186	569	186	0	X
555	insulin B chain	186	0	0	0	X
15121	UCH-L3	186	591	186	0	X
27209	LIG3DBD	186	589	186	0	X
1403	calcitonin C	186	0	0	0	X
27747	ARC4 domain of human Tankyrase	186	0	174	0	X
17976	PPARgamma LBD + MRL24	186	512	186	0	X
5028	TRYPSIN INHIBITOR II	186	0	0	0	X
18721	D5	186	557	186	0	X
30286	Cytochrome c-type biogenesis protein CcdA	186	509	185	0	X
5176	Momordica Cochinchinensis Trypsin inhibitor II	186	95	0	0	X
26968	Skp1	186	482	136	0	X
4939	ninth zinc-finger domain of the u-shaped transcription factor	186	0	34	0	X
325	calbindin	186	0	0	0	X
19570	cactus-derived antimicrobial peptide Ep-AMP1	186	62	0	0	X
30459	Potassium channel toxin alpha-KTx 5.4	186	0	0	0	X
1545	calcitonin C	186	0	0	0	X
19381	DNA/RNA (5'-D(TPTPG)-R(P(LG))-D(PGPTPTPAPGPGPGPTPTPAPGPGPGPTPTPAPGPGPGPA)-3')	186	0	0	0		X
17617	S4-3 voltage sensor peptide	186	0	0	0	X
5901	neural zinc finger transcription factor 1	186	0	40	0	X
6260	IAAL-E3/K3 heterodimer	186	0	42	0	X
6909	Human Metallothionein-3	186	0	33	0	X
18633	small molecule-influenza RNA complex	186	0	0	0			X
18965	Marine Sponge-Derived Asteropsin E	186	109	0	0	X
11480	protein	185	139	28	0	X
18981	DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion	185	0	0	21		X
16959	F1F2	185	558	185	0	X
18549	Helix-35 Stem-loop from E. coli 23S rRNA	185	181	42	0			X
27627	Ubl45	185	573	185	0	X
25603	murine tumour necrosis factor alpha CDE RNA	185	148	33	21			X
18358	dimeric Acanthaporin	185	0	43	0	X
19425	mouse RyR2 domain A	185	541	185	0	X
4221	Moloney Murine Leukemia Virus Capsid Protein	185	0	0	0	X
10231	B-cell lymphoma 6 protein	185	146	32	0	X
27001	R119K	185	0	185	0	X
18052	MS2	185	0	0	0	X
26967	GlcNAc-Skp1	185	476	136	0	X
11386	Zinc finger protein 347	185	140	29	0	X
11387	Zinc finger protein 347	185	105	28	0	X
16869	catalytic core of Dpo4	185	513	185	0	X
19093	adenylate kinase with ADP	185	0	192	0	X
15071	cdHO	185	505	180	0	X
25049	RNA (68-MER)	185	148	27	0			X
4073	oxidized human ferredoxin	185	264	89	0	X
10169	Zinc finger protein 224	185	139	32	0	X
25698	hCFTR NBD1 deltaRI F508del	185	375	186	0	X
810	Vpq polypeptide	185	0	0	0	X
30651	Pandonodin	185	0	0	0	X
36172	Tumor necrosis factor receptor superfamily member 16	184	117	35	0	X
25672	N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adduct	184	0	0	0		X
25315	FBP28 WW2 mutant Y438R DN	184	0	0	0	X
34137	DNA (5'-D(TPAPGPGPGPAPCPGPGPGPCPGPGPGPCPAPGPGPGPT)-3')	184	0	0	0		X
34136	DNA (5'-D(TPAPGPGPGPAPCPGPGPGPCPGPGPGPCPAPGPGPGPT)-3')	184	0	0	0		X
11381	Zinc finger protein 32	184	135	30	0	X
27526	Catenin alpha-2	184	566	184	0	X
19683	S-linked glycopeptide sublancin 168	184	65	42	0	X
4897	Pilus Associated with Pyelonephritis subunit G	184	569	184	0	X
5150	T3-I2-T4 peptide	184	0	0	0	X
18892	helix II template boundary element from Tetrahymena telomerase RNA	184	151	34	0			X
5186	vascular endothelial growth factor receptor-binding domain dimer	184	260	85	0	X
19494	HUR RRM3	184	204	109	0	X
25598	ASTEROPSIN F FROM MARINE SPONGE ASTEROPUS	184	96	0	0	X
16070	Pin1_WW	184	0	0	0	X
25777	Tetrahymena telomerase RNA pseudoknot	184	80	0	0			X
30461	Potassium channel toxin alpha-KTx 5.4	184	0	0	0	X
16088	Pin1_WW	184	0	0	0	X
26024	RNA (28-MER)	184	78	11	0			X
26642	Envoplakin PRD	184	562	184	0	X
17671	RNA (27-MER)	184	141	16	0			X
18865	OvDpl(1-30)	184	0	0	0	X
4057	Y5A_CBD_Cellobiohydrolase_I	184	0	0	0	X
17955	(C9S, C14S)-leucocin A	184	135	43	0	X
27424	PrgK	183	454	137	0	X
6239	VSVI RNA	183	139	1	0			X
27848	N-CoR NID monomer	183	617	183	0	X
26958	Prion monomer	183	532	183	0	X
26003	U3-scytotoxin-Sth1h	183	143	32	0	X
25396	mouse EpoR	183	136	45	0	X
17834	shPrP, Thiamine	183	0	101	0	X
5456	von Willebrand factor-A3 domain	183	366	183	0	X
25267	TRIM25 (PRYSPRY) domain	183	544	183	0	X
17731	(E15G)-Crp4	183	0	0	0	X
26741	PHD2-Zn(II)-2OG	183	564	183	0	X
34313	Nicomacin	183	64	0	0	X
408	leiurotoxin I	183	0	0	0	X
26878	VcPth-N118D mutant	183	550	183	0	X
25877	cecropin P1 with LPS	183	100	29	0	X
26877	VcPth-N72D mutant	183	560	183	0	X
34094	Protein (chimeric oligourea-peptide zinc finger)	183	60	30	0	X
5143	alpha2A adrenergic receptor	183	0	0	0	X
4020	Bovine Syncytial Respiratory Virus-G	183	73	0	0	X
19017	Bulges in G-quadruplexes	183	0	0	0		X
18724	G-quadruplex_DNA	183	0	0	0		X
19075	CcP-PPIX	183	609	183	0	X
15153	WW3-PPPPYP	183	118	42	0	X
6757	membrane anchor domain of BVDV NS5A	183	105	0	0	X
19524	GS-TAMAPIN MUTATION R7A	183	0	0	0	X
15859	29-MER	183	58	11	0			X
11475	protein	183	132	27	0	X
16819	culbertcidin	182	0	43	0	X
30138	Designed peptide NC_HEE_D1	182	73	23	0	X
27490	rS1-D345	182	0	182	0	X
15219	RXRalpha LBD ternary complex	182	578	182	0	X
11482	protein	182	134	27	0	X
17601	MLV readthrough pseudoknot	182	92	0	0			X
5096	U-SHAPED TRANSCRIPTIONAL COFACTOR	182	0	0	0	X
3437	annexin I	182	0	0	0	X
18160	SB2Jalpha	182	0	0	0	X
18984	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer	182	0	0	20		X
34034	DNA (5'-D(TPAPGPGPGPTPTPAPGPGPGPTPTPAPGPGPGPTPTPAPGPG)-3')	182	0	0	0		X
27043	NDM-1	182	383	182	0	X
34135	DNA (5'-D(TPAPGPGPGPAPCPGPGPGPCPGPGPGPCPAPGPGPGPT)-3')	182	0	0	0		X
15316	GCN4	182	142	31	0	X
15571	RNA DUPLEX	182	124	0	17			X
16322	CD147	182	356	182	0	X
19	beta-endorphin	182	0	0	0	X
11486	protein	182	148	28	0	X
7158	2nd RAN binding zinc finger from hNUP153	182	136	30	0	X
26875	VcPth-H24N mutant	182	550	182	0	X
6835	Fowlicidin 1	182	0	0	0	X
18985	DNA_1	182	0	0	20		X
19505	WW Domain Strand-Swapped Dimer	182	0	0	0	X
19298	RBPMS2-Nter	182	256	85	0	X
16745	Sm-AMP-1.1a monomer	182	90	0	0	X
7325	yDcp2(100-245)	181	459	135	0	X
16229	1H, 13C, and 15N Chemical Shift Assignments for ring1B C terminal domain/ cbx7 CBOX complex	181	157	39	0	X
27463	Reductase complex	181	373	180	0	X
7413	HMGB1, delta25	181	0	175	0	X
4644	FIRST ZINC FINGER FROM THE DROSOPHILA U-SHAPED TRANSCRIPTION FACTOR	181	0	32	0	X
5409	PTB1-12	181	571	181	0	X
12022	sublancin 168 peptide moiety	181	100	40	0	X
30497	Designed peptide NC_HEE_D1: Orn turn mutant	181	0	0	0	X
5619	methionine sulfoxide reductase B	181	447	136	0	X
6441	human-orexin-A	181	54	31	0	X
18513	recombinant tamapin	181	0	0	0	X
4059	Y32A_CBD_Cellobiohydrolase_I	181	0	0	0	X
27242	Trigger factor	181	201	182	0	X
15519	opn	181	436	183	0	X
4615	antifungal peptide	181	0	0	0	X
18769	NS2(32-57) GBVB protein	181	108	0	0	X
18891	Tetrahymena telomerase RNA stem IV terminal loop	181	141	19	0			X
6987	Heme-heme oxygenase-cyanide complex	181	521	181	0	X
25768	Outer Membrane Protein G from Pseudomonas aeruginosa	181	558	181	0	X
25360	P177A mutant of Adenylate Kinase in complex with Ap5a	181	0	181	0	X
7098	RNA (35-MER)	181	137	11	0			X
4591	syndecan-4 whole cytoplasmic domain	181	0	0	0	X
19672	Dok1 PTB domain monomer	181	95	86	0	X
1444	insulin B chain	181	0	0	0	X
6654	Jingzhaotoxin-VII	181	0	0	0	X
1633	insulin B chain	181	0	0	0	X
15199	pdz23 tandemdomain	181	505	181	0	X
1414	transcription factor LFB1	181	0	0	0	X
19301	CPR	181	523	181	0	X
19158	DNA (5'-D(GPGPGPTPTPGPGPGPTPTPTPTPGPGPGPTPGPGP*G)-3')	181	0	0	18		X
25939	K2 lobe of double-knot toxin	180	0	0	0	X
4645	ORYZAIN BETA CHAIN	180	0	0	0	X
11478	protein	180	137	28	0	X
17190	Complex Rpp30	180	465	180	0	X
15786	edhbv	180	100	32	0			X
30257	pre-miR-21	180	129	0	0			X
6389	BuTX-MTX	180	0	0	0	X
18648	APPTM V44M dimer	180	144	30	0	X
19572	quadruplex d(TGGGTTTGGGTTGGGTTTGGG)	180	0	0	0		X
7216	Triosephosphate isomerase	180	599	180	0	X
6983	heme-heme oxygenase-azide complex	180	511	181	0	X
5248	Pin1 N-terminal WW domain	180	0	0	0	X
26876	VcPth-N14D mutant	180	552	180	0	X
26674	GVIIJ[C24S]	180	63	31	0	X
5219	Escherichia coli formamidopyrimidine-DNA glycosylase	180	533	180	0	X
6216	Zinc finger protein ZFPM1	180	0	0	0	X
3436	annexin I	180	0	0	0	X
19396	Lasiocepsin	180	90	25	0	X
19519	GS-TAMAPIN MUTATION R6A	180	0	0	0	X
26922	First RRM domain of MEC-8	180	214	100	0	X
27180	Cohesin Domain 5	180	480	150	0	X
25604	double base-pair inversion mutant of murine tumour necrosis factor alpha CDE-23 RNA	180	151	0	22			X
25341	CypC	180	351	180	0	X
17410	C6	180	550	180	0	X
7235	beta phosphoglucomutase	180	568	180	0	X
30460	Potassium channel toxin alpha-KTx 5.4	180	0	0	0	X
4058	Y31A_CBD_Cellobiohydrolase_I	180	0	0	0	X
25161	CrnA1'	180	0	0	0	X
17692	Dynein Light Chain 8	180	260	88	0	X
15340	CFTR Regulatory Region	180	755	180	0	X
34212	purotoxin-6	179	78	0	0	X
25701	EcoRV dimer with cognate DNA	179	371	121	0	X	X
18973	DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion	179	0	0	20		X
18050	DNA_1	179	0	0	9		X
25756	Src catalytic domain	179	540	179	0	X
11403	Zinc finger protein 32	179	130	35	0	X
30613	Astrocytic phosphoprotein PEA-15	179	178	87	0	X
30323	Two inhibitor peptide topologies 2	179	88	37	0	X
27344	GA Seq5 monomer	179	115	57	0	X
34270	Uncharacterized protein	179	0	30	0	X
18979	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer	179	0	0	20		X
17296	GLP-2	179	0	0	0	X
6057	tandem SH3 domain in autoinhibited form of p47phox	179	551	179	0	X
15502	HMGB1	179	0	173	0	X
6418	aequorin/Mg2+-bound state	179	540	179	0	X
27122	Hematopoietic Protein Tyrosine Phosphatase (PTPN7, HePTP)	179	315	179	0	X
25758	de-novo toxin Hui1	179	49	31	0	X
1539	calcitonin C	179	0	0	0	X
17297	GLP-2	179	0	0	0	X
1544	calcitonin C	179	0	0	0	X
30465	Potassium channel toxin alpha-KTx 5.4	179	0	0	0	X
18021	Mg2+ bound alpha1 I-domain	179	544	179	0	X
19581	peptide derived from the trans-membrane region of HIV-1 gp41	179	94	0	0	X
1543	calcitonin C	179	0	0	0	X
19275	Bovicin HJ50	179	106	0	0	X
15697	IRES domain IIId	179	0	0	0			X
5760	Z1Z2	179	374	179	0	X
1538	calcitonin C	179	0	0	0	X
7410	HMGB1, delta10	179	0	173	0	X
1546	calcitonin C	179	0	0	0	X
19081	P4_CPEB3	179	0	0	0			X
6628	Set7/9	179	418	179	0	X
27090	Elongation factor P	178	516	178	0	X
6459	Itch WW3 domain	178	118	42	0	X
6721	huntingtin-interacting protein HYPA/FBP11	178	97	30	0	X
7005	Peptide YY	178	0	0	0	X
36112	30S ribosomal protein S1	178	177	89	0	X
18593	RNA Duplex Containing a 2'-O-Pivaloyloxymethyl Modification	178	0	0	0			X
26002	U3-scytotoxin-Sth1a	178	135	32	0	X
11394	Zinc finger protein 347	178	154	31	0	X
17987	Ts16	178	0	0	0	X
26664	UBXD1-N	178	196	91	0	X
2048	calcitonin C	178	0	0	0	X
19261	HIV capsid dimer	178	563	178	0	X
34353	TINA-conjugated antiparallel DNA triplex	178	0	0	0		X
18649	APPTM dimer	178	144	30	0	X
30351	Defensin-1	178	0	0	0	X
17924	SEVI	178	38	0	0	X
19850	GrxS14-BolA2 apo-heterodimer from Arabidopsis thaliana	178	0	178	0	X
2047	calcitonin C	178	0	0	0	X
6056	Yeast oligosaccharyltransferase subunit Ost4p	178	0	0	0	X
7409	HMGB1, delta5	178	0	172	0	X
7412	HMGB1, delta20	178	0	172	0	X
10018	RNA hairpin of eel LINE	178	0	0	0			X
30688	DNA (5'-D((3D1)PAPGPGPGPAPGPGPGPCPGPGPCPGPGPGPAPCP*A)-3')	178	0	0	0		X
26857	Lipoprotein signal peptide with globomycin	178	485	178	0	X
17536	Complex of SUMO1 with RanBP2 M-IR2 SIM peptide	178	224	92	0	X
4219	eel calcitonin	178	0	0	0	X
16148	PlnK	178	50	31	0	X
5340	proapoptotic bid	178	524	178	0	X
5458	Ribosome Recycling Factor	178	541	178	0	X
7403	telomerase_RNA_CR7	178	191	54	0			X
25648	p75-TMDCD/LPN	177	121	32	0	X
5007	VS RIBOZYME SUBSTRATE STEM-LOOP	177	107	16	0			X
19941	TM domain of LAMP-2A	177	159	37	0	X
17887	alpha anomeric lesion	177	56	0	18		X
17227	GS-alfa-Ktx5.4 SCORPION TOXIN	177	0	0	0	X
17408	HIV TAR RNA	177	0	0	0			X
17065	STAM1 VHS-UIM	177	523	177	0	X
27501	SPINK1	177	0	45	0	X
15067	2-PGA bound PGG/GGG	177	394	177	0	X
19637	Outer Membrane Protein X from E. coli	177	470	177	0	X
15080	Yeast U2 stem I	177	133	0	0			X
17756	human prion protein (residues 121-230)	177	254	0	0	X
34011	Small toxic polypeptide LdrD	177	118	0	0	X
30467	Potassium channel toxin alpha-KTx 5.4	177	0	0	0	X
19026	HWTX-IV	177	0	0	0	X
19838	EcDsbA	177	360	177	0	X
16540	nasonin-1M	177	0	0	0	X
7411	HMGB1, delta15	177	0	171	0	X
5793	RecR dimer	177	549	177	0	X
19527	GS-TAMAPIN MUTATION R13A	177	0	0	0	X
18706	influenza A virus S31N mutant (19-49) in presence of drug M2WJ332	177	114	30	0	X
7262	1-45IGFBP-6	177	37	35	0	X
3435	annexin I	177	0	0	0	X
25684	LIPID DROPLET ANCHORING PEPTIDE OF CGI-58	177	125	37	0	X
4704	xylanase	177	341	177	0	X
18729	MS2	177	126	32	0	X
27563	14-3-3 Sigma dimer	177	563	177	0	X
25806	prolactin receptor transmembrane domain	176	161	37	0	X
18768	NS2(2-32) GBVB protein	176	102	0	0	X
27599	p53(DBD)	176	375	176	0	X
27947	DJ-1 dimer oxidized	176	540	176	0	X
34168	DNA (5'-D(GPGPGPGPCPCPGPGPGPGPCPCPGPGPGPGPCPCPGPGP(BGM)PG)-3')	176	0	0	0		X
25282	MJ0366	176	269	92	0	X
25998	K domain of EMCV IRES	176	167	0	0			X
6182	FluA(R95K)	176	510	176	0	X
25742	TBK1 recruitment to cytosol-invading Salmonella induces anti-bacterial autophagy	176	104	25	0	X
30463	Potassium channel toxin alpha-KTx 5.4	176	0	0	0	X
24	growth hormone releasing factor	176	0	0	0	X
4654	SECOND INTRADISKAL LOOP OF RHODOPSIN (RESIDUES 172-205)	176	0	0	0	X
15336	single polypeptide chain	176	532	176	0	X
17916	Tfg2	176	270	89	0	X
17417	LZ5	176	88	46	0	X
18020	Apo alpha1 I-domain	176	538	176	0	X
30462	Potassium channel toxin alpha-KTx 5.4	176	0	0	0	X
18413	AdcR	176	434	131	0	X
19571	d(GGGTTTTGGGTGGGTTTTGGG) quadruplex	176	0	0	0		X
27968	p150Glued(1-191)/microtubule complex	176	191	176	0	X
16707	LchA	176	99	0	0	X
25653	ASTEROPSIN G	176	107	0	0	X
5190	ribosome recycling factor	175	366	175	0	X
19839	EcDsbA	175	362	175	0	X
19342	Transmembrane-cytosolic part of Trop2	175	79	25	0	X
27943	DJ-1 dimer reduced	175	540	175	0	X
19124	antimicrobial peptide Tk-Amp-X2	175	76	31	0	X
27381	TRIM25 PRYSPRY	175	335	175	0	X
15505	CypB	175	516	175	0	X
16268	cannabinoid receptor-2 helix 6	175	0	0	0	X
25826	microRNA 20b pre-element	175	153	0	0			X
25736	TBK1 recruitment to cytosol-invading Salmonella induces anti-bacterial autophagy	175	114	24	0	X
25752	EcoRV dimer with cognate DNA and Lu3+	175	371	117	0	X	X
15192	alphaC-Domain Fragment	175	148	74	0	X
4747	Ac-GGXGG-NH2 pentapeptides	175	114	20	0	X
6524	apoE N-terminal domain	175	348	175	0	X
30464	Potassium channel toxin alpha-KTx 5.4	175	0	0	0	X
5781	Propynyl_DNA.RNA_hybrid	175	0	0	0		X	X
5736	ICln	175	553	171	0	X
36116	DNA (5'-D(GPGPGPTPTPAPGPGPGPTPTPAPGPGPGPTPTPTPGPGP*G)-3')	175	0	0	0		X
4175	SL3 RNA hairpin	175	0	0	19			X
7006	Peptide YY	175	0	0	0	X
30466	Potassium channel toxin alpha-KTx 5.4	175	0	0	0	X
7128	1F3-2F3	175	322	175	0	X
26551	p73 DNA binding domain	175	573	175	0	X
11537	actinomycin	175	0	0	0	X
19137	ERGi	175	280	88	0	X
25339	CypC+peptide	175	0	175	0	X
25585	contryphan-Vc1	175	110	32	0	X
30496	Designed peptide NC_HEE_D1: Aib turn mutant	175	0	0	0	X
30454	Potassium channel toxin alpha-KTx 5.4	175	0	0	0	X
7149	RBP	174	0	174	0	X
34213	Ephrin type-A receptor 2 (E.C.2.7.10.1)	174	0	0	0	X
34027	L-2	174	10	34	0	X
11436	E73A mutant of Ostrich egg white lysozyme	174	339	174	0	X
11485	protein	174	136	29	0	X
15946	pGolemi	174	0	0	0	X
25208	S100A4dC-MPT complex	174	526	178	0	X
1481	calcitonin C	174	0	0	0	X
19184	calmodulin-binding domain of plant calcium-ATPase ACA2	174	0	0	0	X
19926	Pyrin	174	185	88	0	X
19170	calmodulin-binding domain of plant calcium-ATPase ACA8	174	0	0	0	X
27004	AdKwAp5A	174	0	174	0	X
15148	HMGB1 AB boxes + basic tail	174	336	174	0	X
2197	pituitary growth factor	174	0	0	0	X
5675	HAINANTOXIN-I	174	0	0	0	X
17757	human prion protein (residues 121-230)	174	257	0	0	X
1551	P450 reductase	174	0	0	0	X
15124	Complex of VIR165 and FP1-23	174	0	0	0	X
19528	DOUBLE GS-TAMAPIN MUTATION R6A R7A	174	0	0	0	X
30242	EHEE_rd1_0284	174	127	24	0	X
18950	3',5'-LINKED 2'-O-(2-METHOXYETHYL)-RNA DUPLEX	173	0	0	0			X
15792	talin-F2F3	173	0	173	0	X
2371	phosphocarrier protein HPr	173	85	82	0	X
1482	calcitonin C	173	0	0	0	X
15177	CzrA	173	339	109	0	X
1643	calcitonin C	173	0	0	0	X
15474	Unfolded apoflavodoxin	173	516	173	0	X
4410	SHL-I	173	0	0	0	X
34311	RNA (5'-R(APUPAPCP(PSU)P(PSU)PAPCPCPUPG)-3'), RNA (5'-R(GPGPAPGPUPAPAPGPUPCPU)-3')	173	147	0	0			X
7392	CTC[IQ]GGCGCCATC	173	0	0	0		X
11434	Ostrich egg white lysozyme	173	484	173	0	X
7408	HMGB1, ABprime	173	0	167	0	X
7377	CzrA	173	360	114	0	X	X
27905	clr4191	173	0	173	0	X
27903	clr4191	173	0	173	0	X
25946	KYE28 and lipopolysachharide	173	0	0	0	X
5278	Pea Enation Mosaic Virus P1-P2 frameshifting pseudoknot	173	36	66	0			X
11483	protein	173	128	24	0	X
26615	SUR2A NBD1-MgATP complex	173	490	173	0	X
5341	N-terminal DNA-binding domain of Rep protein from a geminivirus	172	290	156	0	X
10051	RasY32W	172	0	172	0	X
11420	Vasoactive intestinal peptide	172	127	31	0	X
30468	Potassium channel toxin alpha-KTx 5.4	172	0	0	0	X
4705	xylanase	172	332	172	0	X
11494	E22A mutant of Streptomyces sp. N174 chitosanase	172	506	172	0	X
17733	(R7G)-Crp4	172	0	0	0	X
2939	growth hormone releasing factor	172	0	0	0	X
25671	HIV ISS element	172	0	0	0			X
18409	second transmembrane domain from human copper transport 1	172	0	0	0	X
2940	growth hormone releasing factor	172	0	0	0	X
34035	DNA (5'-D(TPAPGPGPGPTPTPAPGPGPGPTPTPAPGPGPGPTPTPAPGPG)-3')	172	0	0	0		X
16314	IAPP	172	0	0	0	X
18266	Dengue Virus NS2B/NS3 in complex with Aprotinin	172	530	172	0	X
19071	GLUCAGON AIB2,16 LYS13-GAMMAGLU-GAMMAGLU-C16 AMIDE	172	0	0	0	X
26607	NmFic	172	524	172	0	X
6596	vhl-1	172	0	0	0	X
6144	nisin	172	67	32	0	X
5	anthopleurin-A	171	0	0	0	X
11419	vasoactive intestinal peptide	171	126	29	0	X
17789	(5'S)-8,5'-cyclo-2'-deoxyadenosine	171	0	0	0		X
1586	insulin B chain	171	0	0	0	X
26635	human K-Ras4B-GDP	171	0	171	0	X
27260	CaM NaV1.7 IQ motif	171	518	171	0	X
17163	Dronpa	171	340	171	0	X
30140	Designed peptide NC_EHE_D1	171	85	22	0	X
25034	cChimera Ca2+ bound	171	0	95	0	X
19680	ASD-1	171	277	86	0	X
25774	spider toxin, U4-agatoxin-Ao1a	171	124	31	0	X
17507	DJ-1 protein	171	533	171	0	X
19091	adenylate kinase with ADP	171	0	171	0	X
17362	E2-25K	171	558	171	0	X
26982	RYBP NZF domain	171	144	35	0	X
25681	E454Y	171	25	4	0	X
4260	GlcNAc eel calcitonin	171	0	0	0	X
27343	GB1 Seq2 monomer	171	160	54	0	X
15241	[Nle15] gastrin-17	171	0	0	0	X
4261	M6 eel calcitonin	171	0	0	0	X
30498	Designed peptide NC_HEE_D1: Aib turn, beta3 helix, N-methyl hairpin mutant	171	0	0	0	X
17977	PPARgamma LBD + MRL20	170	499	169	0	X
16393	CFTR NBD1-RE monomer	170	166	170	0	X
26646	mini H2-Ld	170	506	170	0	X
4040	Anti-sigma-A	170	251	85	0	X
26809	Npm Tail Monomer	170	174	52	0	X
15966	DsbB	170	499	170	0	X
10015	integrase Zn finger domain mutant	170	130	48	0	X
7376	CzrA	170	350	112	0	X
5272	Schistocerca gregaria chymotrypsin inhibitor	170	0	31	0	X
3548	natriuretic peptide	170	0	0	0	X
5495	psalmotoxin1	170	0	0	0	X
15751	ROAD-1	170	0	0	0	X
28017	QBP1+TDP-43	170	64	37	0	X
7013	Bcl-xL dimer	170	432	151	0	X
26742	PHD2-Zn(II)-2OG-CODD	170	543	170	0	X
25570	ns5bc	170	102	24	0	X
15376	modified DNA duplex	170	0	0	15		X
17040	TM VI	170	0	0	0	X
17740	Hck	170	482	170	0	X
25679	L453E	170	30	0	0	X
6808	N-terminal peptide	170	30	0	0	X
17998	FKBP42	170	682	170	0	X
15221	tc32 polypeptide	169	0	0	0	X
2282	bacteriorhodopsin	169	0	0	0	X
30470	Rivi3	169	69	23	0	X
4412	DNA (5'-D(CPGPCPAPTP+TPAPCPGPC)- 3')	169	0	0	0		X
16112	HsapBK(233-260)	169	0	0	0	X
11535	Navitoxin	169	0	0	0	X
27332	CaM NaV1.4 IQ motif	169	513	169	0	X
15665	ranatuerin-2CSa	169	0	0	0	X
7361	lin_MCoTI	169	87	0	0	X
5865	K+ toxin-like peptide	169	0	0	0	X
1911	ZFY-switch	169	0	0	0	X
27215	free prothymosin alpha	169	279	105	0	X
17876	Novel Toxin from De Venom of the Scorpion Tityus	169	0	0	0	X
7245	TM VII of Na+/H+ exchanger	169	69	6	0	X
16477	e1 peptide	169	0	0	0	X
15860	5'-D(DTPDTPDAPDAPDTPDTPDTP(D33)(D33)(D33)DAPDAPDAPDTPDTPDAP*DA)-3'	169	0	0	0		X
25410	Sigma-1 receptor delta 35 construct	168	429	169	0	X
7342	NUCLEOCAPSID_PROTEIN	168	0	0	0	X
7003	hsp90	168	558	168	0	X
17503	fusb	168	501	169	0	X
420	transcription factor IIIA	168	0	0	0	X
11013	dynein heavy chain	168	374	122	0	X
27811	EFP monomer	168	299	168	0	X
30548	RNA (5'-R(CPGPCPAPUPUPCPGPAPCPGPC)-3'), RNA (5'-R(GPCPGPUPUPUPCPGPUPGPCPG)-3')	168	0	0	0			X
5816	YLR109w dimer	168	513	162	0	X
25330	HUAB	168	501	168	0	X
11435	Amyloid-beta-(1-40)	168	107	39	0	X
17424	Integrin 1	168	176	38	0	X
16512	syb60-116	168	151	55	0	X
4323	outer surface protein C	168	495	168	0	X
15962	HasAp truncated polypeptide	168	517	168	0	X
34138	Ephrin type-A receptor 2 (E.C.2.7.10.1)	168	0	0	0	X
18257	DmsD	168	534	167	0	X
16056	TMXI	168	46	0	0	X
245	melittin	168	0	0	0	X
15951	p7	168	86	0	0	X
25274	cytosolic part of Trop2	168	74	21	0	X
19563	DHFR	168	180	168	0	X
4547	DNA/RNA	168	0	0	16		X	X
6979	5'-R(GPGPUPGPAPAPGPGPCPU)-3'/5'-R(GPCPCPGPAPAPGPCPCP(PR5))-3'	168	0	0	18			X
27529	USP7 UBL45	167	472	169	0	X
5191	ribosome recycling factor	167	341	167	0	X
25199	myrGCAP2	167	356	167	0	X
19030	Huwentoxin-IV	167	0	0	0	X
27964	Delta-KE	167	259	87	0	X
30144	Designed peptide NC_cHh_DL_D1	167	46	21	0	X
30525	Engineered Cystine Knot Protein 2.5F	167	116	30	0	X
27352	Fc receptor IIIb	167	501	167	0	X
19410	tOmpA within the tirmeric chaperone Skp	167	424	167	0	X
17786	(5'S)-8,5'-cyclo-2'-deoxyguanosine	167	0	0	0		X
7049	M5 monomer	167	0	4	0	X
15489	paenibacillin	167	114	30	0	X
18204	hPEBP1	167	531	167	0	X
27492	SGPI-2 variant	167	0	0	0	X
16539	nasonin-1	167	0	0	0	X
19847	alpha amylase inhibitor peptide aS1 from Allatide scholaris	167	0	0	0	X
27611	Nicomacin	167	79	0	0	X
25990	E1A-13S	167	572	167	0	X
19846	alpha-amylase inhibitor peptide aS4 from Allatide scholaris	167	0	0	0	X
30320	38-mer peptide	166	58	0	0	X
19374	alpha-amylase inhibitor wrightide R1 (wR1) peptide from Wrightia religiosa	166	0	0	0	X
27950	Vaccinia H1-Related PTP (VHR)	166	473	166	0	X
25596	G-quadruplex	166	0	0	0		X
34171	RNA (5'-R(PAPUPAPCP(PSU)P(PSU)PAPCPCPUPG)-3'), RNA (5'-R(PGPGPAPGPUPAPAPGPUPCPU)-3')	166	147	0	0			X
4246	CMTI-I(M8L)	166	0	0	0	X
30151	DNA (5'-D(CPGP(5CM)PGPAPAPTPTPCPGPCPG)-3')	166	0	0	0		X
306	cytochrome c oxidase	166	0	0	0	X
17252	BCMA	166	0	0	0	X
41	neutrophil NP-5	166	0	0	0	X
25416	RNA (39-MER), 3' splice site in influenza A: 39-nt hairpin	166	0	0	0			X
30029	General control protein GCN4	166	122	34	0	X
4157	lactoferricin	166	0	0	0	X
30148	DNA (5'-D(CPGP(5CM)PGPAPAPTPTPCPGPCPG)-3')	166	0	0	0		X
4656	GRANULIN A	166	0	0	0	X
19996	ROQ-Tnf	166	444	166	0	X		X
26822	a1I_E317A monomer	166	475	166	0	X
34381	Chromogranin-A	166	133	30	0	X
1580	flavodoxin	166	108	3	0	X
17478	cIAP1 CARD	165	156	149	0	X
6715	Stannin	165	170	83	0	X
11536	MarkTX-7	165	0	0	0	X
5765	fifth transmembrane segment (residue L758 to E785) of sarcoplasmic reticulum Ca2+-ATPase	165	0	0	0	X
30022	Lactoferrin	165	0	0	0	X
5200	DnaA domain IV	165	274	89	0	X
5817	Neurogenic locus notch homolog protein 1	165	82	40	0	X
26675	GVIIJ_SSEA	165	0	0	0	X
5860	Subtilosin A	165	93	35	0	X
6123	Truncated hevein of 32 aa	165	0	0	0	X
30013	Lactoferrin	165	0	0	0	X
6445	Metal-response element-binding transcription factor-1 complex with MRE DNA (22bp)	165	490	165	0	X	X
16690	C. albicans Ess1 prolyl isomerase	165	498	165	0	X
34331	hTel-oxoG10	165	0	0	0		X
17956	MCoTI-V	165	0	0	0	X
18185	VHS-UIM monomer	165	0	165	0	X
4488	DNA decamer	165	0	0	0		X
7064	Cycloviolacin O14	165	0	0	0	X
25025	NOX	165	464	165	0	X
19139	R7	165	504	165	0	X
6535	Tag-OBD (131-259) - RPA32C complex	165	0	165	0	X
5368	human ADP Ribosylation Factor 1	164	474	164	0	X
30191	DNA Dodecamer with 5-methylcytosine	164	0	0	0		X
5273	Schistocerca gregaria chymotrypsin inhibitor variant L30R,K31M	164	0	0	0	X
27720	KRas-wt(1-169)-GDP	164	0	164	0	X
19136	ERGu	164	250	84	0	X
4054	Cartilage Matrix Protein	164	0	40	0	X
5321	helix 6 of signal recognition particle RNA	164	0	0	0			X
17787	(5'S)-8,5'-cyclo-2'-deoxyguanosine	164	0	0	0		X
16257	Nogo66 in pH 4.0	164	73	54	0	X
19386	parallel-stranded G-quadruplex in DNA poly-G stretches	164	0	0	0		X
16925	FKBP12	164	258	97	0	X
26620	Barnase-dCGAC	164	55	109	0	X	X
25338	CypB+peptide	164	310	164	0	X
27718	KRas-G12V(1-169)-GDP	164	0	164	0	X
23	glucagon	164	0	0	0	X
27378	HIV-1 Protease Homodimer	164	167	164	0	X
27190	Apo CaM NaV1.1 IQ motif	164	503	164	0	X
4745	Bulged RNA	164	0	0	0			X
6232	TM1442-PO4	164	199	103	0	X
30405	conotoxin MoVIB	164	0	0	0	X
19720	WT apo HasAp	164	173	164	0	X
16028	CD3OH	164	0	0	0	X
34174	artificial quadruplex with propeller, diagonal, and lateral loop	164	27	0	0		X
30473	Sp1 transcription factor duplex 5'-d(GGGGCGGGG)	164	70	0	10		X
199	trypsin inhibitor CMTI-I	164	0	0	0	X
27387	K-Ras4B	164	646	164	0	X
4051	Rubredoxin-ox	163	118	31	0	X
15073	cdHO	163	472	163	0	X
5408	DFF40/DFF45 heterodimer	163	157	80	0	X
27719	KRas-G12D(1-169)-GDP	163	0	163	0	X
26068	DNA-binding HU protein	163	251	94	0	X
5144	rhodopsin	163	0	0	0	X
6623	C-peptide	163	0	0	0	X
4506	type IIA bacteriocin carnobacteriocin B2	163	0	0	0	X
4409	DNA (5'-D(CPGPCPAP(HYD)TP+TPAPCPGPC)- 3')	163	0	0	0		X
7088	IF2 domain III-IV	163	332	163	0	X
5935	fructose-2,6-bisphosphatase	163	558	163	0	X
11069	1-28 GBP	163	0	0	0	X
17237	hFn14	163	0	33	0	X
18520	S72-S107 peptide of 18.5kDa murine MBP	163	141	36	0	X
27377	HIV-1 Protease Homodimer	163	178	163	0	X
16699	HSV-1 gH protein, gH617-644 fusion peptide	163	0	0	0	X
18461	H-Ras-GppNHp	162	163	162	0	X
2279	nisin	162	0	0	0	X
26743	EeCentrocin 1	162	114	31	0	X
17958	C9L,C14L-LeuA	162	126	36	0	X
754	motilin	162	0	0	0	X
6009	Thrombin-binding DNA aptamer	162	0	0	14		X
16241	Plantaricin J	162	88	27	0	X
30044	DNA Dodecamer with 8-oxoguanine at 10th Position	162	0	0	14		X
27020	human betaB2-crystallin dimer	162	322	162	0	X
10078	LolA monomer	162	515	162	0	X
18378	Liraglutide	162	0	0	0	X
30038	DNA	162	0	0	14		X
17422	Cidofovir DNA duplex	162	4	0	0		X
16090	foldon_E5R	162	0	26	0	X
25528	DNA Dodecamer with 8-oxoguanine at 4th Position	162	0	0	0		X
30311	Frizzled 7 binding peptide	162	0	0	0	X
372	galanin	162	0	0	0	X
27441	A6TCR	162	536	162	0	X
27000	R119A	162	0	162	0	X
16239	Plantaricin J	162	80	24	0	X
17555	vbs1	162	324	163	0	X
11493	Streptomyce sp. N174 chitosanase	162	403	162	0	X
5157	Antifreeze protein type 1 mutant	161	0	0	0	X
30254	DNA (5'-D(CPGPAPTPTPTPTPTPTPGPGPC)-3'), DNA (5'-D(GPCPCPAPAPAPAPAPAPTPCPG)-3')	161	115	10	22		X
27139	HypF-N	161	244	81	0	X
17580	Myc G-quadruplex	161	0	0	0		X
19853	AGA modified	161	0	0	0		X
4404	alpha-amylase inhibitor	161	0	0	0	X
26619	Barnase monomer	161	264	106	0	X
34279	Plantaricin S beta protein	161	82	27	0	X
27351	CBS40	161	178	42	0	X
16918	CKI1RD	161	325	161	0	X
7313	Pactolus I-domain	161	482	161	0	X
19032	Huwentoxin-IV	161	0	0	0	X
2227	trypsin inhibitor CMTI-III	161	0	0	0	X
6618	peptide P6	161	0	0	0	X
7430	ERp18	161	287	153	0	X
5362	CAT-PRD1 domain of the transcriptional antiterminator LicT protein from Bacillus subtilis	161	481	161	0	X
15422	KChIP4a monomer	161	477	161	0	X
27345	SH3 Seq3 monomer	161	158	53	0	X
476	fibrinogen	161	0	0	0	X
30056	DNA (5'-D(GPGPTPTPTPGPGPTPTPTPTPGPGPTPTPGP*G)-3')	161	0	0	0		X
30315	ShK homolog AsK132958	161	0	33	0	X
4643	MYELOID ANTIMICROBIAL PEPTIDE	161	0	0	0	X
25730	H-Ras G12V	160	482	160	0	X
19855	Mengovirus Leader Protein Bound to Ran GTPase	160	159	70	0	X
30255	DNA (5'-D(CPGPAPTPTPTPTPTPTPGPGPC)-3'), DNA (5'-D(GPCPCP(M1A)PAPAPAPAPAPTPCPG)-3')	160	115	10	20		X
25369	DNA Dodecamer with 8-oxoguanine at 10th Position	160	0	0	0		X
18959	Rsa1p238-259	160	90	26	0	X
4362	chromomycin-DNA complex	160	96	0	7		X
12014	TvCyP1 homodimer	160	289	160	0	X
19858	Phosphorylated Mengovirus Leader Protein	160	161	69	0	X
16105	Amylin	160	0	44	0	X
19205	Engineered Cystine Knot Protein 2.5D	160	114	33	0	X
34183	Nemertide alpha-1	160	71	32	0	X
17086	ASIP(93-126, P103A, P105A, P111A, Q115Y, S124Y)	160	0	0	0	X
1588	kininogen	160	0	0	0	X
17746	(5'S)-8,5'-Cyclo-2'-deoxyguanosine in DNA	160	0	0	0		X
16104	AMYLIN	160	0	44	0	X
18975	Unmodified Helix 69	160	128	0	0			X
25367	YMRRA	160	445	160	0	X
17468	NS5A fragment (191-369) monomer	160	511	160	0	X
26639	CBP-ID4	160	604	205	0	X
26916	G-CSFC3	160	481	160	0	X
7186	Spider toxin Magi 5	160	0	0	0	X
30694	GTPase KRas	160	0	160	0	X
16178	MeVamp-4	160	0	0	0	X
26616	CBP-ID4	160	607	205	0	X
5996	Major Urinary Protein-I	159	0	159	0	X
27218	cyclophilin A S99T/C115S/I97V	159	304	159	0	X
10096	LolB monomer	159	476	159	0	X
27642	Mps1 62-239	159	487	159	0	X
15101	monomer	159	246	80	0	X
19857	Phosphorylated Mengovirus Leader Protein	159	159	69	0	X
7283	MHB4A	159	0	0	0	X
16931	FKBP12-rapamycin	159	253	99	0	X
17980	G-quadruplexes	159	0	0	0		X
27217	cyclophilin A S99T/C115S	159	305	159	0	X
16797	mTZD finger2	159	106	26	0	X
27815	IMP3 KH1-2 wildtype	159	0	159	0	X
18285	HLA-DR1/CLIP102-120canonical	159	0	159	0	X
6271	LasR-LBD dimer	159	499	159	0	X
5995	Major Urinary Protein-I	159	0	159	0	X
18294	Granulocyte colony-stimulating factor A30G	159	475	155	0	X
16657	Sic1_T90X	159	263	90	0	X
15875	Nudix hydrolase	159	503	159	0	X
18268	EF-hand_domain_of_polycystin-2	159	145	72	0	X
6037	potassium channel toxin KX	159	0	0	0	X
15500	ZF-C417F:ZN	159	0	0	0	X
6699	Calbindin D9k monomer	159	256	77	0	X
18479	HRas166	159	469	158	0	X
26906	P-CTD	159	238	81	0	X
27954	Adenylare kinase R119K	158	0	158	0	X
16243	Prp24-RRM23	158	0	158	0	X
4754	metallothionein	158	0	0	0	X
30625	Ubonodin	158	0	0	0	X
5735	rat amyloid beta-peptide 1-28	158	0	0	0	X
34278	Plantaricin S alpha protein	158	67	24	0	X
27189	P1 domain of CheA	158	254	128	0	X
25383	human TRAP1-NTD	158	472	158	0	X
27620	CYPA	158	472	157	0	X
6276	Metal-response element-binding transcription factor-1 complex with MRE DNA	158	453	158	0	X	X
30481	Melittin	158	93	26	0	X
15672	p12CAN monomer	158	156	158	0	X
16003	BASP1	158	442	158	0	X
16330	DsbA monomer	158	498	158	0	X
34186	cmbr-481317	158	0	0	0		X
34063	Artificial quadruplex with propeller, diagonal and lateral loop	158	26	0	0		X
25685	Transmembrane Electron Transporter CcdA	158	451	156	0	X
4765	E.Coli peptidyl-prolyl cis-trans isomerase b	158	469	157	0	X
18306	A2POBEC2 41-224	158	466	158	0	X
18838	ID3 stem loop of domain 1 in the ai5gamma group II intron	158	132	0	0			X
25966	C-terminal extramembrane domain of SH protein	158	112	29	0	X
16917	CKI1RD	158	315	158	0	X
36019	Defensin alpha-related sequence 1	158	0	0	0	X
17423	Control DNA duplex	157	0	0	0		X
25356	TPMT *1 16-245	157	488	157	0	X
25337	CypA+peptide	157	298	157	0	X
30499	Designed peptide NC_HEE_D1: Aib turn, Aib helix, N-methyl hairpin mutant	157	0	0	0	X
5777	PODN:RNA	157	0	0	0		X	X
18291	Granulocyte colony-stimulating factor	157	475	155	0	X
27491	SGPI-2 variant	157	0	0	0	X
17682	RNA (31-MER)	157	39	8	0			X
16837	HAV 3C C24S	157	494	157	0	X
7284	MHB8A	157	0	0	0	X
27446	Ct of UGT1A4 monomer	157	469	157	0	X
25313	FBP28 WW2 mutant Y438R DNDC	157	0	0	0	X
34332	hTel-oxoG21	157	0	0	0		X
18293	Granulocyte colony-stimulating factor A29G	157	476	156	0	X
10052	PCP homo tetramer	157	513	157	0	X
26658	SczA homodimer	157	461	157	0	X
30235	Bacteriocin	157	90	30	0	X
18308	HLA-DR1/CLIP106-120flipped	157	0	157	0	X
36025	Tilapia Piscidin 4	157	0	0	0	X
6151	Transportan in bicellar solution with [DMPC]/[DHPC]=0.33	157	0	0	0	X
15911	MalF-P2	157	329	157	0	X
36157	Lantibiotic nukacin	156	0	0	0	X
30142	Designed peptide NC_EEH_D1	156	73	21	0	X
19611	Enzymatic cyclisation of kalata B1 using sortase A	156	74	0	0	X
18114	human LL-23	156	59	22	0	X
2941	growth hormone releasing factor	156	0	0	0	X
6048	Hb3361a peptide	156	0	0	0	X
7126	barnase-barstar complex	156	250	102	0	X
4592	Syndecan_4	156	0	0	0	X
34297	DNA (5'-D(GPGPGPTPAPGPGPGPAPGPCPGPGPGPAPGPAPGPGPG)-3')	156	0	0	0		X
17537	Human minimembrane protein OST4	156	0	0	0	X
25531	N2-dG IQ at G1 in NarI sequence	156	0	0	0		X
25080	[FeZn]IMP-1	156	162	156	0	X
1230	dihydrofolate reductase	156	0	0	0	X
17406	5'-R(GPUPGPAPAPGPCPCPCPGP*U)-3'	156	24	8	20			X
1589	kininogen	156	0	0	0	X
18852	HIV-1 Rev ARM peptide (residues T34-R50)	156	100	28	0	X
5090	alfa-L-fucosidase	156	505	156	0	X
15499	ZF:ZN	156	0	0	0	X
17842	OprH	156	475	156	0	X
17458	Thymosin-Alpha1	156	0	0	0	X
36041	jasmintide js3	156	0	0	0	X
30053	DNA (5'-D(CPGPGPCPCPGPCPCPGPA)-3'), DNA (5'-D(TPCPGPGPCPGPGPCPCPG)-3')	156	0	0	16		X
7405	Human U85 C/D-H/ACA scaRNA	156	117	16	0			X
27185	ProXp-ala	156	182	156	0	X
17143	HYL1_dsRBD_1	156	264	80	0	X
27816	IMP3 KH1-2 delta2	156	0	156	0	X
6109	Scorpion toxin BmKK4	156	0	0	0	X
26038	WWWKYE21 in LPS	155	0	0	0	X
15653	Vinculin Tail	155	486	155	0	X
16073	cycloviolacin O2	155	0	0	0	X
15626	yeast ARF1 monomer	155	299	155	0	X
18031	Fap7	155	319	155	0	X
30253	DNA (5'-D(GPCPAPTPCPGPAPTPTPGPGPC)-3'), DNA (5'-D(GPCPCPAPAPTPCPGPAPTPGPC)-3')	155	113	10	22		X
6561	plantaricin A	155	0	0	0	X
34088	Outer membrane protein G	155	617	154	0	X
34323	RNA duplex containing pseudouridine residue	155	90	0	16			X
25948	Ex-4[1-16]/pl14a	155	0	0	0	X
19088	Rv2140c	155	308	155	0	X
4500	w-conotoxin MVIIC	155	0	0	0	X
18295	Granulocyte colony-stimulating factor A37G	155	471	153	0	X
6379	SdiA	155	468	155	0	X
18974	HELIX_69	155	46	0	0			X
25776	Outer Membrane Protein G P92A mutant	155	488	155	0	X
30626	Conopeptide phi-MiXXVIIA	155	2	15	0	X
25595	TDP-43 prion-like hydrophobic helix in DPC	155	84	40	0	X
5834	HIV-1 frameshift inducing stem-loop RNA	155	59	31	0			X
6562	D-loop from cloverleaf 1 of bovine enterovirus 1 RNA	155	120	47	16			X
17859	DNA duplex Containing an Unnatural, Hydrophobic Base Pair	155	0	0	0		X
11070	1-28 GBP	155	0	24	0	X
2200	vasoactive intestinal peptide	155	0	0	0	X
4684	alpha MT	155	0	0	0	X
34324	RNA duplex containing pseudouridine residue	155	83	0	16			X
18687	E coli adenylate kinase	155	0	155	0	X
2199	vasoactive intestinal peptide	155	0	0	0	X
17383	Crimean Congo Hemorrhagic Fever Virus Cytoplasmic Gn Tail	155	148	70	0	X
36158	Lantibiotic nukacin	155	0	0	0	X
16323	SLBP30mer	155	0	0	0	X
18762	N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene	154	0	0	0		X
18933	ASFV Pol X	154	430	154	0	X
4220	HIV-1 capsid	154	0	0	0	X
19010	Titin_C1	154	475	154	0	X
5869	Alpha-A-conotoxin EIVA	154	0	0	0	X
19934	p38_2P_apo	154	154	0	0	X
27861	Type 1 Pili	154	314	156	0	X
26928	NS2B-NS3 Protease from Zika Virus	154	476	154	0	X
25179	wtNS4A	154	137	46	0	X
26758	p38 gamma	154	491	154	0	X
19696	N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA	154	0	0	0		X
25628	Kinase	154	334	154	0	X
19304	kalata B7	154	0	0	0	X
6306	RanGAP1 C-domain	154	0	154	0	X
27886	Shaker-VSD	154	473	149	0	X
3485	toxin ATX III	154	0	0	0	X
25314	FBP28 WW2 mutant Y438R L453A DNDC	154	0	0	0	X
19722	H83A apo HasAp	154	163	154	0	X
27636	huntingtin exon 1 mutant	154	288	154	0	X
19930	p38-0P apo	154	154	0	0	X
25997	J domain of EMCV IRES	154	143	0	0			X
25896	Apo F2 TnC	154	441	154	0	X
18542	Cytosolic Tails of aXb2 Integrin	153	28	0	0	X
18766	PI-AnmTX Ugr 9a-1	153	77	0	0	X
1886	gp120	153	0	0	0	X
11489	RNA aptamer against prion protein	153	0	0	0	X		X
17922	Nef	153	509	150	0	X
26948	SART3 RRM2	153	151	74	0	X
26628	HuR RRM1-2	153	0	153	0	X
1393	acylphosphatase	153	0	0	0	X
18209	DNA_molecule_G3ATG3ACACAG4ACG3	153	0	0	0		X
30141	Designed peptide NC_EEH_D2	153	80	22	0	X
7188	Im7	153	250	81	0	X
26983	HBP(D24R)-histamine-serotonin	153	69	153	0	X
18159	SB1Jalpha	153	0	0	0	X
25722	KIAA0323 binding preference for NEDD8	153	0	50	0	X
4921	PONERATOXIN	153	0	0	0	X
27934	IGF2BP2 KH Domains 3 and 4	153	334	153	0	X
25882	dsDNA-lomaiviticin A complex	153	0	0	0		X
16470	ShcA PTB domain-NPLH peptide	153	264	153	0	X
27770	Branchpoint duplex with U2 snRNA site	153	35	0	19			X
27607	CeSAS-6N	153	320	153	0	X
16769	par toxin Fst in DPC micelles	153	0	0	0	X
26820	Lunasin monomer 16-43	153	81	29	0	X
18807	ceN SAS-6	153	472	153	0	X
27275	SGTA_TRP-NNP	152	462	152	0	X
4361	chromomycin-DNA complex	152	80	0	7		X
25370	Crotalicidin-Ct	152	82	0	0	X
7196	DHFR-MTX complex	152	0	151	0	X
15268	ApoCIII	152	231	76	0	X
25293	Kalata B7 Ser mutant	152	70	22	0	X
50077	BRCA2 48-218(C4A)	152	496	152	0	X
16716	NI3C_Mut5 monomer	152	290	152	0	X
18999	allatide_conf1	152	0	0	0	X
6305	RanGAP1 C-domain	152	459	152	0	X
16814	mTZD_finger1	152	110	26	0	X
18998	Allatide O4 conformation 2	152	0	0	0	X
17690	carnitine palmitoyltransferase 1A	152	112	40	0	X
27191	ProXp-ala bound to microhelixPro	152	451	152	0	X
6647	AcAMP2F18Wb mutant	152	0	0	0	X
15149	HMGB1 Full Length	152	0	152	0	X
27502	Nsas	152	256	83	0	X
17133	EWS	152	120	38	0	X
25072	SXL-UNR-msl2-mRNA	152	130	152	0	X		X
16551	ARNO-p	152	0	0	0	X
5896	VU-1 calmodulin/F-stop complex	152	153	152	0	X
397	EETI-II	152	81	0	0	X
18988	apo_paHO	152	478	149	0	X
5776	sPrODN1:RNA	152	0	0	0		X	X
25574	Antimicrobial Peptide SmAMP2-2c	152	81	0	0	X
6940	pantothenate synthetase dimer	152	470	152	0	X
5893	VU-1 calmodulin	152	301	152	0	X
17790	(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct	152	0	0	0		X
5197	mouse prion protein	151	16	0	0	X
7197	DHFR-Bdm6 complex	151	0	151	0	X
15196	NCp8-f2	151	0	0	0	X
4351	granulin N-terminal peptide	151	53	0	0	X
26546	SpaO-OrgB	151	432	151	0	X
6281	Complexin/SNARE complex	151	153	151	0	X
17647	6B	151	427	151	0	X
27099	gp17.1 phage tail	151	460	151	0	X
6141	CypD	151	394	152	0	X
140	glucagon	151	0	0	0	X
4144	subunit H, RPB5	151	219	68	0	X
4557	herpes simplex virus protein ICP47	151	0	0	0	X
25725	cystein-rich peptide jS1	151	0	0	0	X
25557	PrxQ	151	504	151	0	X
7199	DHFR-Bdm-4,6 complex	151	0	150	0	X
7200	DHFR-TMP complex	151	0	151	0	X
19874	kalata B1[W23WW]	151	0	0	0	X
27558	PCNA	151	0	151	0	X
27125	FUS 12E LC	151	423	151	0	X
18223	TMEM14C	151	257	101	0	X
19695	N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNA	151	0	0	0		X
18477	A.fAglB_S2	151	0	151	0	X
18705	Antimicrobial Peptide Human Defensin 5	151	96	27	0	X
7198	DHFR-Bdm4 complex	151	0	151	0	X
30328	DNA (5'-D(CPGPCPGPAPAPTPTPCP(8OG)PCPG)-3')	150	0	0	0		X
26880	R3-IVVI domain	150	393	138	0	X
17531	circular proteins in legumes	150	0	0	0	X
15711	SOD1	150	442	150	0	X
30251	DNA (5'-D(CPGP(DMC)PGPAPAPTPTP(DMC)P(8OG)PCPG)-3')	150	0	0	0		X
6637	AcAMP2F18Nalb mutant	150	0	0	0	X
19182	Aprataxin	150	334	150	0	X
15395	MMP3 complex	150	0	150	0	X
15396	MMP3 complex	150	0	150	0	X
18453	11_mer_oligonucleotide-B	150	0	0	0		X
18454	11_mer_oligonucleotide-B	150	0	0	0		X
34322	Maximins 3/H11 type 2	150	44	0	0	X
27769	Branchpoint duplex with pseudoU U2 snRNA site	150	36	0	19			X
25466	BCL-XL	150	295	150	0	X
27138	HypF-N	150	239	79	0	X
17562	N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal	150	0	0	0		X
26543	SpaO	150	446	150	0	X
16695	Integrase Core Domain Dimer	150	462	150	0	X
34245	DNA (5'-D(CPGPTPCPTPCPAPTPGPAPTPAPCPG)-3')_minor	150	0	0	0		X
25122	SCORPION VENOM TOXIN Ts11 (TsPep1) FROM Tity	150	72	0	0	X
1566	dihydrofolate reductase	150	0	0	0	X
18640	Duplex DNA Containing a b-Carba-Fapy-dG Lesion	150	0	0	0		X
26980	Wild type fused Npu DnaE from Nostoc punctiforme with Gly +2 Extein	150	417	143	0	X
19808	Ginsentide	150	0	0	0	X
34100	RNA (19-MER)	150	67	4	0			X
15366	Human eRF1 C-domain	150	302	150	0	X
1567	dihydrofolate reductase	150	0	0	0	X
30181	Beta/omega-theraphotoxin-Tp2a analog	150	0	32	0	X
15278	sLbpro	150	474	150	0	X
18639	Duplex DNA Containing a b-Carba-Fapy-dG Lesion	150	0	0	0		X
25340	CypD+peptide	150	291	150	0	X
27761	Sec7	150	483	150	0	X
17513	Immunity protein 7	150	244	81	0	X
26981	Fused Npu DnaE GEP loop mutant from Nostoc punctiforme with Phe +2 Extein	149	417	142	0	X
19721	Y75A apo HasAp	149	164	149	0	X
5039	Peirates turpis toxin 1	149	0	0	0	X
27092	Sod2_TMXI	149	88	0	0	X
19408	trimeric Skp with bound OmpX	149	283	149	0	X
19765	gbvb5	149	0	0	0	X
5918	Thermus thermophilus Ribonuclease HI	149	439	149	0	X
16717	NI3C monomer	149	280	149	0	X
4250	3' hairpin of TYMV pseudoknot	149	0	0	0			X
27571	c-MYC/MAX	149	466	149	0	X
27287	APTX	149	312	149	0	X
4741	Glucogen-like Peptide-1(7-36)-amide	149	0	0	0	X
25710	high-density lipoprotein particles	149	391	149	0	X
27211	TET	149	1080	289	0	X
1767	natriuretic peptide	149	0	0	0	X
7090	18 mer hairpin hexaloop	149	90	21	17			X
18851	HIV-1 Rev ARM single polypeptide chain	149	103	27	0	X
18430	Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine	149	0	0	0		X
27334	Ataxin7N10QT3N9(1-62)	149	158	43	0	X
25673	3-stranded parallel beta-sheet	148	0	0	0	X
5669	Npl4 Zinc Finger domain	148	109	30	0	X
25425	transforming growth factor beta induced protein (TGFBIp)	148	540	148	0	X
5557	CrcA protein	148	449	148	0	X
30032	Zinc finger and BTB domain-containing protein 17	148	65	22	0	X
27010	R119K_Ap5A	148	0	148	0	X
18350	cathelicidin-PY	148	0	0	0	X
6430	HIV-1 integrase inhibitor, 93del	148	0	0	15		X
25021	ROQ domain	148	439	148	0	X
6451	CesT dimer	148	452	148	0	X
6974	human p23(1-160)	148	300	148	0	X
5500	parkin ubiquitin-like domain	148	216	72	0	X
25029	hGH	148	455	148	0	X
34250	Brevinin-1BYa	148	0	0	0	X
27998	DnaJB1_SBD	148	0	148	0	X
6347	MTx-HsTx1	148	0	0	0	X
356	adrenocorticotropin	148	0	0	0	X
1129	desulfatohirudin	148	0	0	0	X
26984	Fused Npu DnaE GEP loop mutant from Nostoc punctiforme with Phe +2 Extein	148	412	141	0	X
30546	RNA (5'-R(CPGPCPAPGPCPUPUPAPCPGPC)-3'), RNA (5'-R(GPCPGPUPGPCPUPUPUPGPCPG)-3')	148	24	0	7			X
15949	PRL-1 C170-171S monomer	148	632	148	0	X
30329	DNA (5'-D(CPGPCPGPAPAPTPTPCP(8OG)PCPG)-3')	148	0	0	0		X
15781	5'-R(GPUPCPGPUPGPCPUP*G)-3'	148	110	0	15			X
6639	AcAMP2F18W mutant	148	0	0	0	X
27137	HypF-N	148	236	77	0	X
26626	CaM+Fas	148	276	146	0	X
27592	BM13851 strain of P[8] VP8* rotavirus	148	453	148	0	X
5274	Schistocerca gregaria trypsin inhibitor	148	0	0	0	X
937	insulin B chain	148	0	0	0	X
4554	Dihydrofolate reductase complex with NADPH cofactor	147	449	147	0	X
5775	5'-R(APAPAPGPGPAPGPGPA)-3'/5'-D(CPCPUPCPCPUPU)-3'	147	0	0	0		X	X
30555	Aca Toxin 1	147	82	25	0	X
15738	HP1442	147	227	75	0	X
10010	bovine beta-lactoglobulin A34C; disulfide linked dimer	147	463	147	0	X
6872	kalata B8	147	0	0	0	X
6566	Measles virus N protein (amino acids 477-505)	147	88	29	0	X
1201	natriuretic peptide	147	0	0	0	X
7292	internal interaction site of ALP	147	484	147	0	X
27981	Ca2+ loaded monomer	147	465	147	0	X
19142	vertebrate toxin from the badge huntsman spider	147	64	19	0	X
5457	complex of hMad1-Sin Interacting Domain (SID) and PAH2 domain of mSin3B	147	0	0	0	X
15579	NS2	147	83	0	0	X
19409	Trimeric Skp with bound tOmpA	147	0	147	0	X
25947	KYE28A in lipopolysachharide	147	0	0	0	X
4695	myoglobin H64F mutant	147	282	147	0	X
6722	Low-Molecular-Weight Protein Tyrosine Phosphatase	147	444	147	0	X
6157	tandem repeat 2 of fibroin-modulator-binding-protein-1(residues 122-144)	147	0	0	0	X
17229	ZNF_DNA	147	0	0	0	X	X
26702	NS5A-D1D2D3	147	469	147	0	X
6135	Mu-O-conotoxin MrVIB	146	0	0	0	X
15714	SOD1	146	154	146	0	X
25281	YERSINIA PESTIS AIL (ATTACHMENT INVASION LOCUS)	146	280	146	0	X
6293	tandem repeat 2 of fibroin-modulator-binding-protein-1(residues 122-144)	146	0	0	0	X
34059	Arenicin-1	146	79	29	0	X
50031	CDC25B-R482A	146	0	146	0	X
34071	DNA (5'-D(GPGP(FT)PTPGPGPTPGPTPGPGPTPTPGP*G)-3')	146	0	0	0		X
50030	CDC25B-WT	146	0	146	0	X
26761	XlnB2	146	446	147	0	X
28036	Shaker-VSD(S2bot_mutant) monomer	146	477	146	0	X
27659	RNase 6	146	257	137	0	X
50025	MtRpiB dimer	146	416	146	0	X
25912	IscA	146	270	91	0	X
17661	srtx-i3	146	0	0	0	X
4597	Cystic fibrosis transmembrane conductance regulator (CFTR)	146	0	0	0	X
17177	visual arrestin	146	0	146	0	X
26852	VirB8 homodimer	146	416	146	0	X
18968	Denatured SOD1	146	299	148	0	X
7390	CcV28C_AdxL80C	146	0	146	0	X
4387	thanatin	146	0	0	0	X
26823	WT TDP-43_267-414 Monomer	146	403	144	0	X
30568	Cn29	146	0	0	0	X
26583	dihydrofolate reductase mutation (L28F)	146	239	146	0	X
18855	YibK	146	444	146	0	X
15301	CcV28C_AdxL80C	146	0	146	0	X
17819	Hck32L/Nef	146	259	146	0	X
19561	Taf-RRM-RanBP	146	414	146	0	X
15222	PV-3C	146	384	146	0	X
34400	ARG-ARG-TRP-ARG-ARG-TRP-TRP-ARG-ARG-TRP-TRP-ARG-ARG-TRP-ARG-ARG	146	30	0	0	X
25128	P-superfamily conotoxin Gm9a cycled with a Gly-Leu-Pro linker	146	0	0	0	X
2328	Xfin-31B	145	0	0	0	X
18009	lambda_5_22-45_peptide	145	0	0	0	X
11002	antimicrobial peptide RP-1	145	0	5	0	X
15650	Calmodulin	145	419	145	0	X
26728	C-terminal domain of TDP-43	145	390	145	0	X
11056	peptide from V-ATPase	145	0	0	0	X
19901	Thymosin alpha 1	145	81	29	0	X
27827	IMP3 KH1-2 delta1	145	0	145	0	X
4247	8mer chimeric hybrid RNA/RNA-DNA duplex with tRNA-DNA junction	145	0	0	0		X	X
25610	pheromone Ep-1 from Euplotes petzi	145	0	0	0	X
26672	FUS LC monomer	145	408	145	0	X
19936	Dual-phosphorylated human p38 alpha MK2 334/D peptide bound	145	145	0	0	X
2329	Xfin-31C	145	0	0	0	X
26585	dihydrofolate reductase mutation (L28F)	145	238	145	0	X
7176	monomeric antimicrobial peptide	145	0	0	0	X
26588	ROQ-SELEX consensus hexa-loop RNA	145	0	130	0	X		X
5626	Droshophila GCM	145	318	145	0	X
7001	P-beta-Cat 19-44	145	0	0	0	X
26816	TDP-43-C	145	391	145	0	X
17829	C2 Domain	145	440	145	0	X
20075	MeuTXKbeta1	145	0	0	0	X
27591	BM11596 strain of P[6] VP8* rotavirus	145	460	144	0	X
26979	Wild type fused Npu DnaE from Nostoc punctiforme with Phe +2 Extein	145	417	142	0	X
26932	MTTTm monomer	145	438	145	0	X
5894	drosophila SLBP N-terminus	145	280	82	0	X
6063	E6apc2 peptide	145	0	0	0	X
19424	RyR2A delta exon 3	145	276	145	0	X
25180	mutNS4A	145	137	46	0	X
27813	IMP3 RRM1-2	145	0	145	0	X
27668	BLG A dimer	145	0	145	0	X
19929	HP24stab derived from the villin headpiece subdomain	145	79	24	0	X
16709	LchB	144	84	0	0	X
26700	Sam68 STAR	144	0	144	0	X
27299	hnRNPA2 LC P298L disordered monomer	144	360	144	0	X
15852	calmodulin	144	416	144	0	X
36273	Roseltide rT7	144	0	0	0	X
5369	CREB Binding Protein	144	0	0	0	X
6707	paramecium calmodulin	144	424	144	0	X
27124	hnRNPA2 LC D290V disordered monomer	144	359	144	0	X
30250	DNA (5'-D(CPGP(DMC)PGPAPAPTPTPCP(8OG)PCPG)-3')	144	0	0	0		X
7277	dG85 ttRNH	144	0	144	0	X
50033	CDC25B - W550A	144	0	144	0	X
17695	Extracellular domain of GLIC	144	354	144	0	X
27123	hnRNPA2 LC disordered monomer	144	359	144	0	X
7015	paramecium calmodulin	144	402	144	0	X
18363	Scylla Serrata anti lipopolysaccharide Factor-24 (SsALF-24) peptide	144	48	22	0	X
26685	CaM12	144	0	144	0	X
30406	G117	144	66	29	0	X
18022	Cx43 C-terminal domain bound to tubulin	144	0	0	0	X
50032	CDC25B - R544A	144	0	144	0	X
5673	Glucagon analogue	144	0	0	0	X
5286	CaM:CaMKIp complex	144	430	144	0	X
30198	DNA (5'-D(CPGPCP(8OG)PAPAPTPTP(DMC)PGPCPG)-3')	144	0	0	0		X
18556	complex between Ca-Calmodulin and skeletal muscle myosin light chain kinase	144	0	144	0	X
15075	1-25MSP2	144	0	30	0	X
19658	maximin-4	144	0	0	0	X
25272	major birch pollen allergen	144	406	144	0	X
27566	N domain of bacterial tRNA-(N1G37) methyltransferase (TrmD)	144	446	144	0	X
26587	ROQ-Ox40hexa-loop RNA	144	296	144	0	X		X
18926	MCh-1	144	0	0	0	X
15612	Inner-linker peptide from PDH	144	72	0	0	X
4646	DNA	144	0	0	17		X
1635	viral coat protein	144	0	0	0	X
18676	MMP23_pro-domain_polypeptide	144	161	67	0	X
30271	M protein	144	133	37	0	X
30052	DNA (5'-D(CPGP(RSG)PCPCPGPCPCPGPA)-3'), DNA (5'-D(TPCPGPGPCPGP(RSG)PCPCPG)-3')	144	0	0	18		X
5903	CD44 hyaluronan-binding domain	144	284	144	0	X
5287	CaM:CaMKI(320) complex	144	0	144	0	X
30204	HH2	144	117	29	0	X
25860	DHFR	144	435	144	0	X
4755	heteropoda toxin 2	144	0	0	0	X
4971	Truncated amino-terminal Carp Granulin-1	144	54	0	0	X
7402	Latarcin-1	144	0	0	0	X
17662	srtx-m	144	0	0	0	X
27922	Atg3	143	233	143	0	X
27420	gHH_44	143	72	28	0	X
4061	myoglobin carbon monoxide complex	143	267	143	0	X
5290	third helix[W6F,W14F] of Antennapedia homeodomain	143	0	0	0	X
6200	MCRD_1	143	83	20	0	X
6710	PB1 domain of p67phox	143	220	69	0	X
11454	QB domain of Sp1	143	304	143	0	X
5114	KALATA B1	143	0	0	0	X
19940	ompa	143	463	143	0	X
16122	HCV NS4B(227-254)	143	82	0	0	X
5759	cytochrome P450cam	143	404	143	0	X
26779	Cdc25B monomer	143	467	143	0	X
26682	CaM12	143	0	143	0	X
17572	i6A37 tyrASL	143	101	24	0			X
19285	Calcium Sensor	143	199	69	0	X
34210	DNA (5'-D(GPGPGPAPTPGPGPGPAPCPAPCPAPGP(GFL)PGPGPAPCPGPGPG)-3')	143	24	0	0		X
27394	Rv1747 FHA-1	143	407	136	0	X
19216	sod2 TM IV	143	0	35	0	X
17919	ubiquitin	143	212	71	0	X
19699	m04/gp34 mouse Cytomegalovirus Immunoevasin core domain	143	411	143	0	X
25254	toxin, RhTx	143	0	0	0	X
17360	calcium-calmodulin complexes	143	9	0	0	X
6627	Kalata B1	143	111	0	0	X
27799	UBE2S-Ubiquitin-conjugate	143	162	144	0	X
4799	HIV-1 Vpr (13-33)	142	0	0	0	X
6427	Antifreeze peptide SS-3	142	102	33	0	X
34228	DNA/RNA (5'-R(G)-D(PGPGPAPTPGPGPGPAPCPAPCPAPGPGPGPGPAPC)-R(PG)-D(PGPG)-3')	142	21	0	0
25441	VP8	142	466	142	0	X
27655	Zn(II)-bound AdcR homodimer	142	0	142	0	X
27531	TcMIP	142	433	142	0	X
2013	prothrombin	142	0	0	0	X
27777	Insulin-like growth factor 2 mRNA-binding protein 1 domain KH1-2	142	0	142	0	X
4596	cystic fibrosis transmembrane conductance regulator (CFTR)	142	0	0	0	X
6650	St II fragments	142	0	0	0	X
25071	Rad18-UBZ	142	102	27	0	X
27622	SCR monomer	142	280	85	0	X
27613	TDP43	142	435	142	0	X
18377	MTIP(61-204)	142	423	142	0	X
5353	yeast Saccharomyces cerevisiae calmodulin	142	0	141	0	X
27751	G335N TDP-43_267-414 Monomer	142	257	142	0	X
6879	aKv1.1N	142	142	142	0	X
50090	G335D TDP-43_267-414 Monomer	142	257	142	0	X
19912	DNA duplex	142	0	0	0		X
4651	Rhodopsin	142	0	0	0	X
6656	AcAMP2F18Pff/F20Pfff mutant	142	0	0	0	X
4585	BMP02 NEUROTOXIN	142	0	0	0	X
27790	G338A TDP-43_267-414 Monomer	142	257	142	0	X
26636	ERD14	142	0	142	0	X
5882	C1q trimer	142	438	137	0	X
27788	G335N TDP-43_267-414 Monomer	142	257	142	0	X
18638	11_mer_oligonucleotide-B	142	0	0	0		X
5484	BpUreE dimer	142	433	142	0	X
25270	SpoVM P9A mutant	142	97	24	0	X
27750	G335A TDP-43_267-414 Monomer	142	257	142	0	X
27789	G335S TDP-43_267-414 Monomer	142	257	142	0	X
26694	S1-DHFR-NT	142	440	142	0	X
6064	E6apc1 peptide	142	0	0	0	X
10140	RimM complexed to S19	141	156	141	0	X
18206	Conotoxin analogue [D-Ala2]BuIIIB	141	71	25	0	X
11072	big-N	141	0	0	0	X
18203	Mu-contoxin BuIIIB	141	70	30	0	X
27542	Macaca fascicularis ECP	141	257	131	0	X
19441	spermine modified DNA duplex	141	0	0	14		X
12018	YAP-binding domain of transcription factor TEAD4	141	277	141	0	X
25257	Y99E CAM-eNOS	141	0	141	0	X
30424	Peptide LyeTxI-b	141	75	29	0	X
6970	Rac1.GMPPNP GTPase	141	576	141	0	X
18195	optn 550	141	98	32	0	X
25285	HbI homodimer	141	419	141	0	X
18759	CPAP IkappaBalpha	141	113	141	0	X
18481	ASTEXIN1	141	0	0	0	X
16074	kalata B2	141	0	0	0	X
16501	(1-153)Apomyoglobin pH 2.40 (ref. DSS)	141	404	141	0	X
17791	(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct	141	0	0	0		X
19385	conotoxin muPIIIA-2	141	0	0	0	X
15853	KcsA	140	288	140	0	X
18202	hNaa50p	140	544	140	0	X
30602	Branched K11/K48-Linked Tri-Ubiquitin	140	0	140	0	X
25207	1585 Malarial Peptide	140	0	0	0	X
11442	Hd3a (K31A/E57A)	140	441	140	0	X
19534	non-coding RNA RsmZ acting as protein sponge: Conformer L of RsmZ(1-72)/RsmE(dimer) 1to3 complex	140	120	20	0	X		X
6657	AcAMP2F18Nal mutant	140	0	0	0	X
25162	CrnA2'	140	0	0	0	X
19861	AGT FAPY Modified duplex	140	0	0	0		X
27286	VSV8 peptide bound to a truncated MHC H-2Kb (VSV8/Kb-t)	140	385	140	0	X
20110	VPgpU	140	0	1	0	X
17473	Chimera monomer	140	0	146	0	X
6154	tandem repeat 3 of fibroin-modulator-binding-protein-1(residues 145-167)	140	0	0	0	X
25019	DHFR-folate	140	295	140	0	X
25555	PvHCt	140	0	0	0	X
16235	linear kalata B1	140	0	0	0	X
6187	hypothetical protein PF1061	140	68	68	0	X
26834	PARP3 NTD	140	556	141	0	X
25268	SpoVM	140	89	22	0	X
19406	K11-linked Diubiquitin	140	0	140	0	X
30336	DNA (5'-D(CPCPAPAPGPAPTPAPG)-3'), DNA (5'-D(CPTPAPTPCPTPTPGPG)-3')	140	0	0	0		X
25415	3' splice site influenza A: 19-nt duplex	140	0	0	14			X
4936	Outer membrane protein X in DHPC micelles	140	407	140	0	X
18396	nanocrystalline DsbA	140	427	138	0	X
1652	vasoactive intestinal peptide	140	0	0	0	X
6296	tandem repeat 3 of fibroin-modulator-binding-protein-1(residues 145-167)	140	0	0	0	X
30234	Ubiquitin	140	0	140	0	X
17395	CCR5	140	0	0	0	X
26680	pEAbeta(3-42)	140	112	41	0	X
4778	Cell Division Control Protein 42 from Candida albicans	140	253	140	0	X
36228	Heparin cofactor 2	140	0	0	0	X
6591	Phe18Pff and Tyr20Pff AcAMP2 double mutant	140	0	0	0	X
5289	third helix of Antennapedia homeodomain	140	0	0	0	X
5705	UUCG tetraloop	140	132	47	14			X
26969	PilA	139	434	139	0	X
18440	Analog of the fragment 197-221 of 1- adrenoreceptor	139	63	0	0	X
16815	mTZD_finger3	139	103	25	0	X
30506	Sp1 transcription factor duplex 5'-d(TGGGCGGGA)	139	0	0	0		X
28011	Mdm2	139	427	139	0	X
7428	KcsA	139	284	139	0	X
5082	Tc1 monomer	139	0	0	0	X
25667	G335D Mutant of TDP-43 Amyloidogenic Core Region	139	118	46	0	X
19243	Domain 1 from E. coli HisJ	139	425	139	0	X
34390	DNA (25-MER)	139	25	0	0		X
2202	amphiphilic alpha-helix peptide Baa17	139	0	0	0	X
15901	D+PHS	139	276	139	0	X
18756	WT IkappaBalpha	139	163	139	0	X
5740	Dihydrofolate reductase	139	428	139	0	X
19276	d[CGCGAAGCATTCGCG] hairpin	139	0	0	0		X
6294	tandem repeat 4 of fibroin-modulator-binding-protein-1(residues 168-190)	139	0	0	0	X
26584	dihydrofolate reductase mutation (L28F)	139	229	139	0	X
11003	antimicrobial peptide RP-1	139	0	5	0	X
5170	Histone mRNA	139	128	14	0			X
15656	Duck HBV apical loop	139	135	38	0			X
30484	Sp1 transcription factor duplex 5'-d(GGGGCGGGA)	138	0	0	0		X
5994	Orexin-A	138	0	0	0	X
27399	USR+YTH domain with RNA	138	440	138	0	X		X
34387	Brevinin-1BYa	138	0	0	0	X
26683	CaM34	138	0	138	0	X
20082	Apelin-17	138	64	13	0	X
17511	LZ-GCN4 dimer	138	69	69	0	X
19412	K11-linked Diubiquitin	138	0	138	0	X
27999	Sis1_SBD	138	0	138	0	X
5534	Apolipoprotein CII in complex with SDS-micelles	138	134	68	0	X
15463	Ltc1	138	0	0	0	X
4770	Cell Division Control Protein 42 from Candida albicans	138	258	138	0	X
15613	5'-D((DA)P(DA)P(DT)P(DC)P(DT)P(DT)P(DT)P(DA)P(DA)P(DA)P(DG)P(DA)P(DT)P(DT))-3'	138	0	0	0		X
27724	Aedes aegypti OBP22	138	241	128	0	X
4773	OspA N-terminal fragment	138	406	138	0	X
5112	PSI-CONOTOXIN PIIIF	138	0	0	0	X
34025	DNA (5'-D(TPAPGPGPGPAPGPGPGPTPAPGPGPGPAPGPGPGP*T)-3')	138	0	0	0		X
5511	p21 Rac1 GTPase	138	261	138	0	X
25424	DEFA1, a highly potent antimicrobial peptide from the horse	138	0	0	0	X
5180	GAL4 dimerization domain	138	34	39	0	X
18536	KB1[GHRW; 23-28]	138	0	0	0	X
34253	Brevinin-1BYa	138	0	0	0	X
25286	HbI homodymer	138	383	138	0	X
17088	P6.1 hairpin	138	91	16	0			X
18506	Tg Micronemal Protein 5	138	0	0	0	X
34388	Brevinin-1BYa	138	0	0	0	X
6584	E2	138	268	140	0	X
11556	DHFR (G67V)-Folate	137	292	137	0	X
19958	N-terminal Domain of Enzyme I	137	0	279	0	X
20031	Apelin 17	137	60	0	0	X
27131	XPA98-239 monomer	137	415	137	0	X
25204	Malarial Peptide 6673	137	0	0	0	X
28051	Rad50-Mre11	137	138	0	0	X
16834	5'-D(DGPDCPDGPDAPDGP(6MT)PDTPDCPDTPDGPDCPDG)-3'	137	0	0	0		X
6155	tandem repeat 4 of fibroin-modulator-binding-protein-1(residues 168-190)	137	0	0	0	X
6617	C-terminal haemopexin-like domain of matrix metalloproteinase MMP-13 (collagenase-3)	137	440	159	0	X
27957	MR complex	137	138	0	0	X
27798	UBE2S monomer	137	423	137	0	X
7156	HELIX H	137	0	0	0	X
11524	AF.2A1	137	0	0	0	X
28049	Rad50-Mre11	137	138	0	0	X
4655	First intradiskal loop of RHODOPSIN (residues 93-123)	137	0	0	0	X
19708	VSD-Q1	137	278	137	0	X
21059	trans-PapMA-k	137	0	0	0	X
34051	DNA (5'-D(GPCPGPAPGPGPGPAPGPCPGPAPGPGP*G)-3')	137	0	0	0		X
6449	RXRalpha ligand-binding domain dimer	137	366	137	0	X
18376	MTIP(61-204)	137	422	137	0	X
26730	Paired domain of Pax5	137	431	137	0	X
25659	TDP-43 Amyloidogenic Core Region	137	144	46	0	X
5158	apomyoglobin N132G,E136G mutant	137	287	137	0	X
50206	KIX:MLLMyb complex	137	408	135	0	X
20030	Apelin 17	137	61	0	0	X
6750	MYB-KIX-MLL COMPLEX	137	90	23	0	X
27653	ING5 Nterminal	137	209	94	0	X
4556	SRY-8mer duplex	137	0	0	14		X
27955	MR complex	137	138	0	0	X
27956	MR complex	137	138	0	0	X
27656	apo AdcR homodimer	137	0	137	0	X
21058	Papiliocin(1-8)-MAGAININ 2(4-12) HYBRID PEPTIDE ANALOGUE	137	0	0	0	X
16550	ARNO(375-400)	136	0	0	0	X
18708	Structure of Co-substituted microcrystalline SOD using PCS and PRE restraints by solid-state NMR	136	245	136	0	X
25754	LASSO peptide Astexin1	136	73	0	0	X
30021	Mitochondrial Calcium Uniporter	136	385	136	0	X
25723	Universal Base oligonucleotide with UB at point 5	136	0	0	16		X
5932	DKC mutant P2b telomerase RNA	136	100	31	0			X
25462	NS1B ED mutant monomer	136	408	136	0	X
25211	peptide 6762	136	0	0	0	X
26528	UBCH10 in complex with WHB	136	367	136	0	X
26643	GBD-Nck	136	264	88	0	X
17724	KSR1 CA1-CA1a domain	136	281	136	0	X
25463	NS1B ED dimer	136	376	135	0	X
17520	Unmodified ASL_Tyr	136	116	41	16			X
27415	TRAP	136	162	42	0	X
18509	Cu(I),Zn(II) superoxide dismutase	136	245	136	0	X
5888	nuclear transport factor 2 W7A mutant	136	237	129	0	X
26829	Q331K TDP-43_267-414 Monomer	136	256	136	0	X
4507	Type IIa bacteriocin leucocin A	136	0	0	0	X
18147	RbfA	136	393	136	0	X
34389	DNA (25-MER)	136	0	0	0		X
18740	KSR1 CC-SAM	136	280	136	0	X
26826	A321G TDP-43_267-414 Monomer	136	255	136	0	X
5113	PSI-CONOTOXIN PIIIE	136	0	0	0	X
16167	FXYD4 monomer in micelles	136	123	60	0	X
17437	Ube2S	136	262	136	0	X
26827	A321V TDP-43_267-414 Monomer	136	256	136	0	X
19440	N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA	136	0	0	14		X
19593	Truncated EGF-A	136	62	0	0	X
25300	bee venom toxin melittin with [(C5H5)Ru]+ fragment attached to the tryptophan residue	136	22	0	0	X
26830	M337V TDP-43_267-414 Monomer	136	256	136	0	X
10139	RimM	136	413	136	0	X
30145	Designed peptide NC_cHHH_D1	136	60	22	0	X
15425	KChIP4a(Delta1-42)	135	393	135	0	X
6446	Sodium/hydrogen exchanger 1	135	52	25	0	X
16341	inMIA14-PR	135	416	135	0	X
6251	V66W121	135	141	74	0	X
7315	L11 in complex with rRNA	135	263	135	0	X		X
26686	CaM34	135	0	135	0	X
26526	UBCH10	135	367	135	0	X
2527	trypsin inhibitor CMTI-III	135	0	0	0	X
27044	Sgt2_TPR monomer	135	407	135	0	X
19090	adenylate kinase with ADP	135	0	135	0	X
26831	M337P TDP-43_267-414 Monomer	135	256	135	0	X
1581	micrococcal nuclease	135	0	135	0	X
26828	A326P TDP-43_267-414 Monomer	135	256	135	0	X
4443	butantoxin	135	0	0	0	X
15779	ginkbilobin2 monomer	135	390	120	0	X
25601	closed state of Lys63-linked diubiquitin	135	0	135	0	X
26731	Paired domain of Pax5 in complex with DNA	135	424	135	0	X	X
15025	sMTM7	135	0	0	0	X
4753	D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND ZINC	135	96	0	7		X
6116	N-terminal domain of human eRF1	135	273	135	0	X
6556	Programmed cell death protein 5	135	43	24	0	X
19134	YbeA	135	422	135	0	X
17891	kkgf	134	75	0	0	X
4780	SL2 stem loop RNA from HIV-1	134	106	0	0			X
17236	Sco proteins	134	281	92	0	X
17947	GlbN holoprotein	134	0	115	0	X
25631	ace-pvhct-nh2	134	0	0	0	X
18699	DIMERIC PIL-E G-QUADRUPLEX DNA	134	0	0	0		X
26040	pseudin-2 analog (Ps-P)	134	0	0	0	X
16601	HCV Core-E1 signal peptide	134	75	0	0	X
4916	PITUITARY ADENYLATE CYCLASE ACTIVATING POLYPEPTIDE WITH N-TERMINAL 21 RESIDUES WITH AN AMIDATED C-TERMINUS	134	0	0	0	X
18618	BAD-1 repeat loop	134	76	24	0	X
27193	Y39E EVH1	134	0	123	0	X
18684	Chimeric Peptide of HBD2 and HBD3	134	0	0	0	X
19389	stacked dimeric G-quadruplex	134	0	0	0		X
15605	mper	134	118	28	0	X
27130	RbmA FnIII-2 domain	134	219	121	0	X
27845	Hepatitis B Virus capsid	134	276	131	0	X
16904	alpha-synuclein	134	383	135	0	X
28054	Mre11 nuclease and capping domains	134	134	0	0	X
26629	MATH	134	270	127	0	X
20044	Interleukin-8 C-terminal domain	134	0	4	0	X
30507	Stress-response Peptide-1	133	0	0	0	X
4653	Third intradiskal loop of RHODOPSIN (Residues 268-293)	133	0	0	0	X
34251	Brevinin-1BYa	133	0	0	0	X
18822	trans-membrane domain of the NS2A	133	26	26	0	X
19350	acetylated aSyn monomer	133	398	133	0	X
25724	Control DNA oligonucleotide for the universal base	133	0	0	16		X
16547	monomer E46K alpha-synuclein	133	0	133	0	X
6020	Polyphemusin I	133	0	0	0	X
19351	acetylated aSyn A53T monomer	133	400	133	0	X
1584	micrococcal nuclease	133	0	133	0	X
34303	Appetite-regulating hormone	133	0	9	0	X
30485	Sp1 transcription factor duplex 5'-d(TGGGCGGGG)	133	0	0	0		X
6088	E6apn1 peptide	133	0	0	0	X
18737	complex of ubiquitin and CD2-associated protein	133	0	133	0	X
34335	Conotoxin Vc7.2	133	63	22	0	X
18809	SP-B C-terminal residues 59-80	133	0	0	0	X
36080	Spike protein S2	133	56	56	0	X
16511	hDpl(122-139)D124N	133	0	0	0	X
1583	micrococcal nuclease	133	0	133	0	X
16302	monomer	133	378	133	0	X
25325	Protein Hybrid Beta-Synuclien HC	133	260	133	0	X
19862	AGC FAPY modified duplex Major isomer	133	0	0	0		X
17782	lsm57	133	274	133	0	X
28020	pMdm2	133	415	133	0	X
17492	Thuricin CD	133	105	30	0	X
16543	monomer alpha-synuclein	133	0	133	0	X
19407	trimeric Skp	133	257	133	0	X
16303	monomer	133	380	133	0	X
6083	SheepPrP(135-155)	133	0	0	0	X
27007	R119A_Ap5A	133	0	133	0	X
25861	DHFR-N	133	382	133	0	X
27005	AdKwATP	133	0	133	0	X
16548	monomer A53T alpha-synuclein	133	0	133	0	X
30213	Ocellatin-F1	132	78	24	0	X
50141	Fowlpox virus resolvase monomer	132	334	132	0	X
19986	Xenopus RecQ4 zinc knuckle	132	43	21	0	X
19447	Ubiquitin Binding with SH3 domains	132	0	132	0	X
16634	ddIhh-V67CM	132	0	132	0	X
1997	cell adhesion promoting peptide	132	0	0	0	X
18689	tpr2a	132	252	132	0	X
27339	human ubiquilin-2 (UBQLN2) residues 450-624	132	435	147	0	X
4454	alpha-actinin/titin complex	132	0	31	0	X
28031	HVEM(14-39) peptide	132	25	11	0	X
6567	Measles virus N protein (amino acids 477-505) bound to the measles virus P protein (amino acids 457-507)	132	79	29	0	X
36016	roseltide rT1	132	0	0	0	X
27315	MSPdH5 Nanodisc	132	140	132	0	X
11054	insect chemokine	132	0	32	0	X
30441	PaDBS1R7	132	69	17	0	X
26721	RXFP1(1-72)	132	198	66	0	X
1046	endothelin-3	132	0	0	0	X
30259	arenicin-3	132	50	24	0	X
16546	monomer A30P alpha-synuclein	132	0	132	0	X
27049	Tryparedoxin	132	413	132	0	X
36109	22AA-PSTD peptide (E.C.2.4.99.-)	132	79	19	0	X
34396	Amyloid beta A4 protein	132	368	132	0	X
5889	nucleoporin Nsp1 528-557	132	0	0	0	X
25336	GeoCyp+peptide	132	265	132	0	X
17583	thurincin H	132	111	29	0	X
15379	Sup35 NM domain	132	0	132	0	X
26709	linear diubiquitin	132	255	132	0	X
30163	Lipocalin-1	132	0	132	0	X
17908	Acidic Scorpion Potassium Channel Toxins	132	0	0	0	X
30439	PaDBS1R2	132	73	18	0	X
26874	rT1	132	0	0	0	X
5699	N-terminal extension of hDRS	132	0	0	0	X
15712	SOD1	132	401	132	0	X
314	trypsin inhibitor CMTI-I	132	0	0	0	X
25863	ACT RTX domain	132	380	132	0	X
27404	hFEN1-336-K93A-DNA	132	280	132	0	X	X
25292	RT216	131	284	131	0	X
16787	Thermus thermophilus Rieske protein (cofactor bound)	131	335	131	0	X
17449	tRNALys3UUU	131	0	0	0			X
18026	guanylyl cyclase activating protein-1, GCAP1	131	324	131	0	X
27106	BRM AT-BRD	131	190	131	0	X
25079	human EpoR	131	90	42	0	X
4456	aIIb cytoplasmic domain	131	0	0	0	X
16693	BTK2	131	114	31	0	X
30335	DNA (5'-D(CPCPAPAPGPAPTPAPG)-3'), DNA (5'-D(CPTPAPTPCPTPTPGPG)-3')	131	0	0	0		X
1140	synthesized signal peptide	131	0	0	0	X
76	lysozyme	131	0	0	0	X
18879	SP-B C-terminal (residues 59-80) peptide	131	0	24	0	X
15162	CTA1-T2	131	390	131	0	X
26036	KYE21 in LPS	131	0	0	0	X
6698	MSP2 peptide	131	0	0	0	X
18796	OmpX in phopspholipid nanodiscs	131	377	131	0	X
4170	DNA-duplex-6GP	131	0	0	0		X
17350	vbs2a	131	396	131	0	X
19250	LASSO PEPTIDE ASTEXIN3	131	0	0	0	X
26695	S1-DHFR-N	131	407	131	0	X
18408	first transmembrane domain from human copper transport 1	131	0	0	0	X
15277	Leader Protease	131	286	131	0	X
15522	pUL89(580-600)	131	0	0	0	X
16804	Thermus thermophilus Rieske protein (cofactor bound)	131	336	131	0	X
30261	RNA (41-MER)	131	0	0	0			X
4718	replication terminator protein	131	333	123	0	X
25783	Astexin3	131	73	0	0	X
25215	SERA protein peptide analogue 6737	131	0	0	0	X
18354	conotoxin_TIA	131	0	0	0	X
19059	ns5a308	131	81	14	0	X
25273	phosphorylated cytosolic part of Trop2	131	0	0	0	X
26908	FliGn-FliFc	131	267	131	0	X
16522	hDpl(122-139)	131	0	0	0	X
15998	b'-x	131	123	129	0	X
16244	U6 snRNP (fragment)	131	0	131	0	X		X
2410	N-terminal domain of the human oncoprotein MDM2	131	150	83	0	X
34254	Brevinin-1BYa	131	0	0	0	X
19716	Zn-binding domain of eukaryotic translation initiation factor 3, subunit G	130	78	24	0	X
16300	alpha-synuclein	130	366	130	0	X
25333	hL-FABP:TCH	130	250	130	0	X
15082	Rat intestinal fatty acid binding protein	130	248	129	0	X
6404	Pcf11 CID	130	258	130	0	X
30306	Stress Response Peptide-2	130	0	0	0	X
36110	PSTD-22AA-PolySia (E.C.2.4.99.-)	130	69	19	0	X
16123	D+PHS/V66K	130	243	130	0	X
26862	Stress Response Peptide-2	130	0	0	0	X
4135	RNA duplex including the C-U mismatch	130	0	1	16			X
16342	a-synuclein	130	375	130	0	X
17972	U2/U6snRNA	130	80	0	0			X
1338	tubulin binding peptide	130	0	0	0	X
16654	5'-R((PSU)PCPGPGPGPCPCP(N)PAPUPAPCPCPCPCPGP*A)-3'	130	0	0	0			X
19271	CRABP1 apo	130	401	130	0	X
17535	DNA/RNA hybrid	130	36	0	16		X	X
6714	CSP1	130	0	0	0	X
7050	MbGBP	130	0	0	0	X
27493	bsCopL	130	0	122	0	X
26631	MATH-PUC	130	375	128	0	X
17708	N-myc	130	0	0	0		X
27782	Calmodulin bound to CaMBP2 peptide	130	219	131	0	X
30519	mu-Conotoxin GIIIC	130	59	16	0	X
26	glycoprotein D-1	129	0	0	0	X
36177	Omega-conotoxin	129	0	0	0	X
27050	Tryparedoxin	129	407	129	0	X
11492	monomer	129	289	129	0	X
26886	ferrous THB1	129	389	129	0	X
27358	Id2	129	382	124	0	X
25209	synthetic peptide 36075	129	0	0	0	X
6733	derCD23	129	0	122	0	X
25129	P-superfamily conotoxin Bru9a cyclised with a Gly-Leu-Pro linker	129	0	0	0	X
7356	Rat intestinal fatty acid binding protein	129	247	128	0	X
19411	OmpX within the trimeric chaperone Skp	129	236	129	0	X
27300	UBC9_P123L monomer	129	295	129	0	X
27390	conotoxin_muPIIIA-15	129	0	0	0	X
4072	RNA-1_Modulator_Protein	129	113	61	0	X
1582	micrococcal nuclease	129	0	129	0	X
30112	DNA (5'-D(TPTPAPGPGPCPCPTPG)-3'), DNA (5'-D(CPAPGPGPCPCPTPAPA)-3')	129	0	0	16		X
6863	Zinc finger domain of Mengovirus Leader polypeptide	129	101	29	0	X
4292	plasmatocyte-spreading peptide	129	0	0	0	X
7357	Rat intestinal fatty acid binding protein	129	239	128	0	X
5837	Sodium Channel	129	0	0	0	X
30111	DNA (5'-D(APTPCPCPGPGPTPAPG)-3'), DNA (5'-D(CPTPAPCPCPGPGPAPT)-3')	129	0	0	16		X
28019	Mdm2	129	408	129	0	X
34445	F1415	129	25	0	0		X
5881	SmIIIA	129	0	0	0	X
7423	calmodulin	129	365	129	0	X
2804	endothelin-3	129	0	0	0	X
7427	SycE-YopE complex	129	0	129	0	X
25200	STARP peptide 20570	129	0	0	0	X
27847	eNP-CTD	129	405	129	0	X
30440	PaDBS1R3	128	71	17	0	X
25203	Peptide of acidic-basic repeat antigen (ABRA) from Plasmodium falciparum	128	0	0	0	X
16275	Apelin-17	128	69	13	0	X
19348	aSyn mouse_N87S monomer	128	389	128	0	X
30292	ASN-VAL-HIS-THR-PHE-ARG-GLY-ASP-ASN-VAL-HIS-ASN-SER-SER-SER-SER-LEU	128	0	0	0	X
2113	trp repressor	128	0	0	0	X
30411	Beta/kappa-theraphotoxin-Cg2a	128	0	0	0	X
5609	kalata B1	128	0	0	0	X
19337	aSyn	128	395	128	0	X
16301	monomer	128	236	128	0	X
30105	DNA/RNA (5'-D(APTPGPGPA)-R(PG)-D(PCPTPC)-3'), DNA (5'-D(GPAPGPCPTPCPCPAPT)-3')	128	0	0	16		X
7406	ccc2	128	247	128	0	X
16749	Noxo1b PX domain	128	406	128	0	X
34252	Brevinin-1BYa	128	0	0	0	X
27742	hSmad2 MH1 domain	128	276	128	0	X
19346	aSyn_mouse	128	388	128	0	X
27013	n-NmDsbD monomer	128	261	128	0	X
18797	OmpX in DPC micelles	128	383	128	0	X
16080	mPrP90_3AV	128	270	128	0	X
16401	DHPCN	128	388	128	0	X
4866	UBC4	128	244	128	0	X
11068	1-23 GBP	128	0	0	0	X
15050	piscidin	128	0	0	0	X
26787	RIT1-assembly	128	418	128	0	X
30117	DNA/RNA (5'-D(TPTPAPG)-R(PG)-D(PCPCPTPG)-3'), DNA (5'-D(CPAPGPGPCPCPTPAPA)-3')	128	0	0	16		X
30113	DNA/RNA (5'-D(APTPCPC)-R(PG)-D(PGPTPAPG)-3'), DNA (5'-D(CPTPAPCPCPGPGPAPT)-3')	128	0	0	16		X
528	nisin	128	0	0	0	X
15539	DUF683 tetramer	128	248	75	0	X
19863	AG(7-deaza)G FAPY modified duplex	128	0	0	0		X
5941	cycloCP-11in DPC micelles	128	0	0	0	X
27012	n-NmDsbD monomer	128	261	128	0	X
6557	preS2 surface antigen	128	0	0	0	X
19344	aSyn_S87N	128	397	128	0	X
30116	DNA/RNA (5'-D(APTPCPC)-R(PG)-D(PGPTPAPG)-3'), DNA (5'-D(CPTPAPCPCPGPGPAPT)-3')	128	0	0	16		X
30114	DNA/RNA (5'-D(TPTPAPG)-R(PG)-D(PCPCPTPG)-3'), DNA (5'-D(CPAPGPGPCPCPTPAPA)-3')	128	0	0	16		X
30115	DNA/RNA (5'-D(APTPGPGPA)-R(PG)-D(PCPTPC)-3'), DNA (5'-D(GPAPGPCPTPCPCPAPT)-3')	128	0	0	16		X
17856	CesAB	128	191	94	0	X
30442	EcDBS1R5	128	65	17	0	X
7307	L11-RNA complex	127	256	127	0	X		X
7308	L11-RNA-thiostrepton complex	127	354	127	0	X		X
19911	HP24wt derived from the villin headpiece subdomain	127	73	18	0	X
17697	G-quadruplex	127	0	0	0		X
4595	cystic fibrosis transmembrane conductance regulator (CFTR)	127	0	0	0	X
1710	antimicrobial peptide	127	0	0	0	X
26037	RWS21 in LPS micelles	127	0	0	0	X
18817	KCNE2	127	340	104	0	X
16077	mPrP90_P105L	127	268	127	0	X
4598	CYSTIC FIBROSIS TRANSMEMBRANE CONDUNTANCE REGULATOR (CFTR)	127	0	0	0	X
17678	HRas166	127	389	128	0	X
4746	D(TTGGCCAA)2 BOUND TO CHROMOMYCIN-A3 AND COBALT	127	80	0	7		X
20094	trans Pis-1[NkG]	127	0	0	0	X
16078	mPrP90_A117V	127	270	127	0	X
16076	mPrP90	127	268	127	0	X
30248	20-mer Peptide 38146	127	0	0	0	X
30426	Matrix metalloproteinase-14 (E.C.3.4.24.80), Apolipoprotein A-I	127	35	92	0	X
5124	Human Lysozyme I56T	127	0	127	0	X
6859	P2	127	0	0	0	X
16079	mPrP90_3AV	127	385	127	0	X
19481	RDTH dimer	127	223	127	0	X
25030	OMPA C-terminal domain	127	0	127	0	X
20034	4F	127	0	0	0	X
19981	CnA-VIVIT	127	0	127	0	X
28001	CbpA_SBD	127	0	127	0	X
30408	peptide PaAMP1R3	127	76	19	0	X
20095	cis Pis-1[NkG]	127	0	0	0	X
27199	S100B dimer	127	0	87	0	X
16071	mPrP90	127	389	127	0	X
15713	SOD1	127	392	127	0	X
19384	conotoxin muPIIIA-1	127	0	0	0	X
27379	conotoxin_muPIIIA-3	127	33	0	0	X
30425	Matrix metalloproteinase-14 (E.C.3.4.24.80), Apolipoprotein A-I	127	35	92	0	X
15461	ccc2	127	366	127	0	X
15764	CBD1	127	356	127	0	X
26885	Ferric THB1	127	388	127	0	X
27008	R119A_ATP	127	0	127	0	X
17815	IMP1 KH34	127	428	127	0	X
34338	Outer membrane protein AlkL	127	360	127	0	X
25191	STARP peptide 20546	126	0	0	0	X
18993	Alt_a_1	126	379	126	0	X
36017	Uncharacterized protein	126	89	0	0	X
30216	Ocellatin-K1	126	77	24	0	X
26056	HELATX1	126	0	0	0	X
27946	RA-bound CRABP2 monomer	126	343	126	0	X
4883	canine milk lysozyme	126	0	126	0	X
448	maltoporin	126	0	0	0	X
4887	canine milk lysozyme	126	0	126	0	X
15957	HIV-1_p6_C-terminal	126	0	0	0	X
30508	Kappa-conotoxin vil14a	126	0	0	0	X
4194	D-Pro melittin	126	0	0	0	X
18348	EB1 CH domain	126	367	126	0	X
6616	peptide P5	126	0	0	0	X
27136	hL-FABP:GCA	126	233	126	0	X
36107	arenicin-3 derivative N2	126	60	24	0	X
16332	lah4	126	0	0	0	X
19937	Dual-phosphorylated human p38 alpha ADP and MK2 334/D peptide bound	126	126	0	0	X
36009	Humanin	126	0	22	0	X
19347	aSyn_mouse_T53A	126	389	126	0	X
27129	hL-FABP apo	126	239	126	0	X
15915	5'-R(GPCPGPGPUPGPUPAPAPAPAPG)-3'	126	0	0	0			X
30413	Beta/kappa-theraphotoxin-Cg2a	126	0	0	0	X
27075	pS129 alpha-synuclein	126	0	126	0	X
27035	Ube2T (1-154)	126	399	126	0	X
16655	5'-R((PSU)PCPGPGPGPCPCPCPAPUPAPCPCPCPCPGP*A)-3'	126	0	0	0			X
5256	Anticodon Stem-loop of tRNA(Phe)	126	110	16	17			X
17135	Drosophila Frataxin monomer	126	249	127	0	X
529	nisin	126	0	0	0	X
27837	RepA dimer	126	390	126	0	X
19559	MS1	126	237	126	0	X
16577	Homeodomain DNA complex	126	211	70	0	X	X
17990	MYRISTOYLATED ALPHA M	126	22	0	0	X
34309	V-type proton ATPase subunit a, vacuolar isoform	126	4	2	0	X
26915	Spy	126	366	126	0	X
6735	derCD23	126	0	122	0	X
6734	derCD23	126	0	122	0	X
19935	Dual-phosphorylated human p38 alpha ADP-bound	126	126	0	0	X
19338	aSyn A53T monomer	126	385	126	0	X
15799	HIV-1_Gag_p6ct	126	0	0	0	X
20098	Pis-1 [PG]	126	0	0	0	X
4461	Cycloviolacin O1	126	0	0	0	X
6547	polyhistidine peptide	126	0	0	0	X
169	plastocyanin	126	0	0	0	X
301	glucagon	125	0	0	0	X
17925	SEVI	125	39	0	0	X
16907	HAfp	125	76	23	0	X
5037	OVISPIRIN-1	125	0	0	0	X
5840	Frenatin 3	125	44	0	0	X
17669	Trp-Cage mini-protein with D-amino acid	125	0	1	0	X
7244	gamma-synuclein monomer	125	364	125	0	X
34403	F1415	125	22	0	0		X
27248	pMHC	125	219	90	0	X
193	endothelin	125	0	0	0	X
5266	FAT domain of Focal adhesion kinase (914-1053)	125	270	125	0	X
20029	Apelin 17	125	70	0	0	X
27601	RXFP2ext	125	249	125	0	X
6839	PV5	125	0	0	0	X
5292	Trp-cage Construct 5b	125	0	0	0	X
30281	Annexin A1	125	13	18	0	X
6619	peptide P7	125	0	0	0	X
1728	endothelin	125	0	0	0	X
18366	W28G	125	0	125	0	X
27793	T102R Spred1-EVH1	125	343	120	0	X
5826	BpUreE	125	378	125	0	X
19750	gp41 ectodomain monomer on a DPC micelle	125	195	68	0	X
18370	W123G	125	0	125	0	X
27074	wild-type alpha-synuclein	125	0	125	0	X
6373	catalytic domain of LexA L89P/Q92W/D150H/E152A/K156A mutant dimer	125	377	125	0	X
5125	Human Lysozyme D67H	125	0	125	0	X
19339	R8	125	392	125	0	X
30260	AA139	125	61	23	0	X
16075	mPrP90	125	268	125	0	X
36105	arenicin-3 derivative N6	125	51	23	0	X
27388	conotoxin_muPIIIA-8	124	0	0	0	X
50196	E2A residues 1-100	124	295	93	0	X
27077	pY125 alpha-synuclein	124	0	124	0	X
18519	Retro Trp-cage peptide	124	65	0	0	X
25202	PEPTIDE BELONGING THE N-TERMINAL REGION DERIVED OF MEROZOITE SURFACE PROTEIN-2 OF PLASMODIUM FALCIPARUM	124	0	0	0	X
20078	HEDISTIN	124	0	0	0	X
26806	Tom1-VHS	124	380	124	0	X
357	adrenocorticotropin	124	0	0	0	X
15749	D,L-Peptide Foldamers	124	0	0	0	X
5743	extracellular domain of beta subunit of dystroglycan	124	142	76	0	X
19980	CnA free	124	0	124	0	X
16696	ICP27	124	61	33	0	X
15342	(cmo5U34)-ASL Val3	124	0	0	0			X
1867	endothelin	124	0	0	0	X
18014	Myristoylated Polyproline Type II Helix	124	0	0	0	X
26028	Protein kinase G (PknG) 1-147 natively disordered region + rubredoxin domain reduced, metal bound form	124	394	115	0	X
27015	c-NmDsbD monomer	124	255	124	0	X
11461	1SS[64-80]	124	0	124	0	X
27831	Mtr4-KOW	124	277	124	0	X
5530	5'-R(CPCPAPGPAP(OMC)PUP(OMG)PAPAPGPAPUP(5MC)PUPGP*G)-3'	124	0	0	0			X
15081	Human U2 Stem I	124	68	0	0			X
2262	endothelin	124	0	0	0	X
3036	actin	124	0	0	0	X
21075	BLACA	124	0	0	0	X
27014	c-NmDsbD monomer	124	255	124	0	X
17917	Tfg1 C-terminal domain	124	179	61	0	X
17253	AMA1 inhibitor peptide	124	0	18	0	X
15171	enzyme alMGS	123	0	0	0	X
27587	UBE2E1 core domain	123	368	123	0	X
194	endothelin	123	0	0	0	X
27509	Apo hFABP1 mutant (K57A, E77A, K96A)	123	241	123	0	X
19480	RDTH dimer	123	217	123	0	X
17309	coronavirus stem-loop 2	123	35	0	4			X
27398	USR+YTH domain (APO)	123	393	123	0	X
17489	FF domain L24A mutant	123	120	66	0	X
30536	PCA-CYS-ARG-ARG-LEU-CYS-TYR-LYS-GLN-ARG-CYS-VAL-THR-TYR-CYS-ARG-GLY-ARG-NH2	123	57	24	0	X
30621	Tachyplesin-3	123	51	18	0	X
19345	aSyn_A53T&S87N	123	386	123	0	X
4802	N-terminal domain of H-NS	123	168	62	0	X
5454	motilin	123	0	0	0	X
1203	myoglobin	123	0	0	0	X
30619	Tachyplesin-1	123	52	16	0	X
27266	TNF alpha homotrimer	123	348	123	0	X
15565	Neuroglobin HelixF	123	0	0	0	X
17785	KRas171GNP	123	368	123	0	X
34163	DNA-binding protein	123	119	78	0	X
6939	USP7 N-terminal domain in complex with an EBNA1 peptide	123	252	123	0	X
4176	DNA dodecamer	123	0	0	0		X
30233	Granulin	123	45	22	0	X
27076	Y133F Y136F alpha-synuclein	123	0	123	0	X
7162	b' domain of ERp57	123	0	123	0	X
5123	Human Lysozyme	123	0	123	0	X
1343	alcohol dehydrogenase	123	0	0	0	X
5523	Melanin-Concentrating Hormone	123	0	0	0	X
19330	DUSP16 Monomer	123	379	123	0	X
371	transcriptional regulator GCN4	123	0	0	0	X
1811	sarafotoxin-S6b	123	0	0	0	X
30219	Ocellatin-F1	123	77	24	0	X
15326	chemerin	122	498	122	0	X
19931	DC-SIGN	122	364	122	0	X
27510	hFABP1 K57A, E77A, K96A mutant in complex with GW7647	122	241	122	0	X
27238	NO-mGal-2 dimer	122	244	122	0	X
182	leghemoglobin	122	0	0	0	X
5656	staphylococcal protein A Z domain	122	235	83	0	X
18369	W111G	122	0	122	0	X
30124	O2_contryphan_Vc1 prepropeptide	122	73	24	0	X
36146	mBjAMP1 peptide	122	0	0	0	X
25297	lasso peptide streptomonomicin	122	21	0	0	X
16304	monomer	122	344	122	0	X
26718	Domain Swapped HIV RNase H	122	239	122	0	X
5034	NOVISPIRIN-2	122	0	0	0	X
6156	tandem repeat 1 of fibroin-modulator-binding-protein-1(residues 99-121)	122	0	0	0	X
18937	[Aba3,5,7,12,14,16]BTD-2	122	54	0	0	X
7051	SlGBP	122	0	0	0	X
27389	conotoxin_muPIIIA-10	122	29	0	0	X
16588	Aha1 monomer	122	385	122	0	X
26920	TPR2B	122	247	122	0	X
25846	In silico designed antimicrobial peptide Lavracin	122	0	0	0	X
27544	Pongo pygmaeus ECP	122	259	122	0	X
27391	conotoxin_muPIIIA-14	122	28	0	0	X
18828	holocytochrome c	122	0	112	0	X
18123	avidin	122	212	118	0	X
5283	HIV-1 Vpr (34-51)	122	0	0	0	X
20076	TC6b	122	0	0	0	X
19349	aSyn mouse_T53A&N87S monomer	122	382	122	0	X
19982	NPM-N (Nucleophosmin) pentamer	122	300	122	0	X
15748	D,L-Peptide Foldamers	122	0	0	0	X
15331	(cmo5U34 M6A37)-ASL Val3	122	0	0	0			X
7355	Rat intestinal fatty acid binding protein	121	226	120	0	X
18368	W108G	121	0	121	0	X
4937	'Hairpinless' omega-ACTX-Hv1a monomer	121	0	0	0	X
5531	5'-R(CPCPAPGPAP(OMC)PUP(OMG)PAPAP(1MG)PAPUP(5MC)PUPGP*G)-3'	121	0	0	0			X
6951	Conotoxin pl14a	121	0	0	0	X
27237	mGal-2 dimer	121	244	121	0	X
5509	Transthyretin	121	128	121	0	X
1503	endothelin	121	0	0	0	X
27113	apo-form dFABP	121	286	121	0	X
19972	MBP S72-S107 peptide in the presence of Fyn-SH3	121	130	35	0	X
30535	PCA-CYS-ARG-ARG-LEU-CYS-TYR-LYS-GLN-ARG-CYS-VAL-THR-TYR-CYS-ARG-GLY-ARG-NH2	121	58	25	0	X
5508	Transthyretin	121	128	121	0	X
4167	C2A domain of synaptotagmin I	121	128	121	0	X
5607	Human Neuronal Glycine Receptor alpha-1 Chain TM2	121	0	25	0	X
20088	nociceptin analogue	121	0	0	0	X
20087	nociceptin analogue	121	0	0	0	X
298	anthopleurin-A	121	0	0	0	X
15359	arenicin monomer	121	0	0	0	X
5507	Transthyretin Tetramer	121	128	121	0	X
15533	wt1-zf14-14mer	121	0	115	0	X	X
26819	CHIP-TPR/Hsp70p1	121	362	121	0	X
6608	PV5 solution structure	121	0	0	0	X
18448	NIPP1 1-143	121	258	121	0	X
20119	thromboxane A2 receptor	121	0	0	0	X
20089	nociceptin analogue	121	0	0	0	X
1515	adenylate cyclase	121	0	0	0	X
18830	ALPS-23 peptide in SDS micelles	121	0	0	0	X
15641	monomer	121	0	0	0	X
18410	third transmembrane domain from the human copper transport 1	121	0	0	0	X
27298	C8 Glycine cleavage complex H protein	120	356	120	0	X
15899	C-terminal CH domain of alpha-parvin monomer	120	231	120	0	X
16333	LAH4	120	0	0	0	X
30037	NS5A-D2(JFH1)peptide 304-323 (E.C.3.4.22.-,3.4.21.98,3.6.1.15,3.6.4.13,2.7.7.48)	120	66	20	0	X
20093	REV analogue	120	0	0	0	X
6325	CREB Binding Protein (E.C.2.3.1.48)	120	0	0	0	X
15115	arenicin-2	120	0	0	0	X
25456	Cullin3 - BTB interface	120	0	0	0	X
18867	CD79a	120	351	120	0	X
19024	single G-bulge in a conserved regulatory region of the HEV genome	120	137	0	0			X
17846	yCc	120	312	111	0	X
17845	yCc	120	310	111	0	X
27743	hSmad2-beta MH1 domain	120	250	120	0	X
21077	BLACC	120	0	0	0	X
7418	Calmodulin	120	345	120	0	X
16641	CD2AP SH3-A monomer	120	114	60	0	X
25185	FG-N-6His	120	352	120	0	X
27241	glycine cleavage complex H protein	120	369	120	0	X
20080	hCGA(G364S)	120	0	0	0	X
18418	pleurocidin	120	0	0	0	X
27545	Pongo abelii RNase 3	120	248	118	0	X
18665	dUTPase homotrimer	120	347	120	0	X
15362	(M6A37)-ASL Val3	120	0	0	0			X
27383	conotoxin_muPIIIA-5	120	32	0	0	X
494	micrococcal nuclease	120	0	0	0	X
25296	Hha-H-NS46 charge zipper complex	120	0	115	0	X
15294	N-Me-Val1/N-Me-Leu8/N-Me-Ser14	120	0	0	0	X
5997	STAT4 N-terminal domain, dimer	119	304	119	0	X
16479	G-riboswitch terminator hairpin	119	90	0	0			X
27546	Aotus trivirgatus EDN	119	254	119	0	X
554	insulin A chain	119	0	0	0	X
200	dynorphin analogue	119	0	0	0	X
30513	T-cell receptor alpha chain C region	119	151	45	0	X
6886	lah4	119	0	0	0	X
18538	GPVI peptide mimetic	119	57	0	0	X
1632	insulin A chain	119	0	0	0	X
27514	wild-type transthyretin	119	235	119	0	X
30188	Benenodin-1	119	0	0	0	X
1139	synthesized signal peptide	119	0	0	0	X
17042	nNOS fragment	119	315	119	0	X
19784	G-triplex truncated-TBA	119	66	0	9		X
27500	SPINK1	119	166	54	0	X
1344	insulin A chain	119	0	0	0	X
30534	PCA-CYS-ARG-ARG-LEU-CYS-TYR-LYS-GLN-ARG-CYS-VAL-THR-TYR-CYS-ARG-GLY-ARG-NH2	119	58	26	0	X
27945	CRABP2 monomer	119	332	119	0	X
5733	SCR3 peptide (34-54)	119	0	0	0	X
36106	arenicin-3 derivative N1	119	58	24	0	X
27195	Ct-Frataxin	119	262	119	0	X
18666	dUTPase homotrimer	119	345	119	0	X
27186	APLF acidic domain	119	190	60	0	X
5953	Human TGFB type II Receptor and Monomeric TGFB3 Complex	119	326	93	0	X
27207	Gcn4 tAD	119	376	119	0	X
4885	HCV NS3 RNA helicase	119	356	119	0	X
4337	Oxidized form of the glycine cleavage system H-protein	119	0	119	0	X
27382	conotoxin_muPIIIA-4	119	0	0	0	X
5954	Human TGFB type II Receptor	119	331	93	0	X
28050	RBD1	119	437	119	0	X
16661	TP-ACP	119	238	119	0	X
25457	Cullin3 - BTB interface	119	0	0	0	X
25838	A3CT monomer	119	153	79	0	X
15551	Dok1	119	0	113	0	X
27904	hFis1	118	466	118	0	X
5510	Transthyretin	118	120	119	0	X
27515	V30M	118	224	118	0	X
25552	PLK4-PB3 monomer	118	266	82	0	X
27511	clobe	118	235	118	0	X
30120	Gap junction beta-2 protein	118	41	0	0	X
25190	malaria short AMA-1 peptide analogue	118	0	0	0	X
11514	C2 domain	118	357	118	0	X
17201	little finger domain of Dpo4	118	200	118	0	X
27825	RNH_Mg_ZW566	118	119	118	0	X
16669	RhoA GTPgS monomer	118	313	117	0	X
25808	KIAA0323 binding with NEDD8	118	0	120	0	X
16718	NI2C monomer	118	274	118	0	X
18644	PawS Derived Peptide 5 (PDP-5)	118	45	0	0	X
19892	OUTER MEMBRANE PROTEIN X IN NANODISC	118	0	117	0	X
27184	hSSB2	118	361	118	0	X
27826	RNH_Mg_YLC2-155	118	124	118	0	X
6952	Violacin A	118	0	0	0	X
5993	DNA duplex	118	0	0	0		X
1204	myoglobin	118	0	0	0	X
1664	conotoxin GIIIA	118	0	0	0	X
30409	barrettide A	118	64	26	0	X
27385	conotoxin_muPIIIA-9	118	32	0	0	X
15774	Rv1761c	118	335	118	0	X
27483	ICP27 1-138	118	391	140	0	X
21074	B3MP	118	0	0	0	X
27384	conotoxin_muPIIIA-6	118	0	0	0	X
4372	apt	117	0	0	0		X
4807	bovine ferric cytochrome b5-N17D	117	89	76	0	X
17618	WALP19-P10 complex	117	0	23	0	X
4341	Iron-containing superoxide dismutase	117	381	117	0	X
26058	d58CI dimer	117	246	117	0	X
6602	cGMP-bound PDE5 GAF A domain	117	363	117	0	X
27365	CSP1	117	32	18	0	X
27440	A6TCR	117	398	115	0	X
6234	PagP in CYFOS-7	117	232	117	0	X
27944	bL12 dimer	117	353	117	0	X
15052	prion protein fragment	117	0	0	0	X
11462	1SS[76-94]	117	0	117	0	X
6788	Ser133-phosphorylated KID	117	177	56	0	X
26953	KLF4 1-130	117	379	116	0	X
15319	Unmodified ASLval3	117	0	0	0			X
16867	VAMP7(1-180)	117	0	117	0	X
20051	Human Obestatin	117	0	0	0	X
15858	29-MER	117	36	0	0			X
17308	dCstF-50(1-65)	117	198	65	0	X
6070	Endothelin-1	117	0	0	0	X
27576	A97S TTR	117	126	117	0	X
6784	KID	117	179	56	0	X
4338	Glycine Cleavage system apoprotein H	117	0	117	0	X
6898	Genome linked protein VPg	117	0	0	0	X
27231	full length Dengue NS4A	117	321	117	0	X
27935	C3 monomer	117	344	117	0	X
19443	EC1	117	310	117	0	X
936	insulin A chain	117	0	0	0	X
17495	Thuricin CD	116	70	29	0	X
27495	phosphorylated DUBA	116	365	116	0	X
4806	bovine ferric cytochrome b5	116	90	76	0	X
18367	W62G	116	0	116	0	X
26732	p38g monomer	116	116	0	0	X
25077	PTPN4 PDZ-linker	116	367	116	0	X
30396	Clavanin-A	116	0	24	0	X
27575	wtTTR	116	125	116	0	X
6948	Fur	116	317	116	0	X
19620	DNA duplex containing N3T-ethylene-N1I	116	0	0	0		X
1654	endothelin	116	0	0	0	X
18914	[Aba3,7,12,16]BTD-2	116	52	0	0	X
30265	Thrombospondin-related sporozoite protein	116	0	0	0	X
25920	Integrin alphaIIb-beta3(A711P) Transmembrane Complex	116	219	76	0	X
25900	NRAS Isoform 5	116	0	0	0	X
4128	cyanobacterial metallothionein gene repressor	116	119	116	0	X
7434	3F5_PABPN1pept_complex	116	228	115	0	X
18931	[Aba5,7,12,14]BTD-2	116	53	0	0	X
19065	RNaseA	116	0	116	0	X
5385	8oxoG:G mismatch	116	0	0	0		X
19865	LASSO PEPTIDE BASED INTEGRIN INHIBITOR: MICROCIN J25 VARIANT WITH RGDF SUBSTITUTION OF GLY12-ILE13-GLY14-THR15	116	0	0	0	X
18452	Synthetic cyclic oligonucleotide	116	0	0	0	X	X
25668	Q343R Mutant of TDP-43 Amyloidogenic Core Region	116	106	42	0	X
4699	HCV TME1	116	0	0	0	X
26752	hSSB1	116	350	116	0	X
30212	Ocellatin-LB2	116	71	22	0	X
16781	dynein microtubule binding domain	116	364	116	0	X
27768	ShkA-Rec1	116	240	116	0	X
27854	DC-SIGN Carbohydrate Recognition Domain	116	219	116	0	X
34315	TRP-TYR-HIS-ARG-LEU-SER-HIS-ILE-HIS-SER-ARG-LEU-GLN-ASP-NH2	116	70	0	0	X
15787	HINT1	116	347	116	0	X
34162	DNA (5'-D(TP(DCP)PGPTPTPCP(DCP)PGPTPTPTPTPTPCPGPTPTPCPCPGP*T)-3')	116	0	0	0		X
4166	C2A domain of synaptotagmin I	115	125	115	0	X
16471	IQGAP1 (401-533)	115	237	115	0	X
4785	Bleomycin resistance protein of S. hindustanus	115	228	115	0	X
27516	V122I Transthyretin	115	122	115	0	X
5227	smMLCK:CaM complex	115	87	25	0	X
16309	holo cL-BABP T91C	115	236	116	0	X
386	phospholipase A2	115	0	0	0	X
19253	tau_K18	115	370	115	0	X
30614	Astrocytic phosphoprotein PEA-15	115	235	115	0	X
27530	apoCaM	115	0	115	0	X
86	alamethicin	115	0	0	0	X
11460	1SS[30-115]	115	0	115	0	X
15892	human alpha-lactalbumin	115	0	115	0	X
7133	CheA P3P4 domain	115	0	115	0	X
21076	BLACB	115	0	0	0	X
6857	FF2 immunodominant peptide	115	66	0	0	X
19923	BuIIB[C5U,C17U,C6A,C23A]	115	0	0	0	X
18610	Ubiquitin	115	287	115	0	X
34444	F1415	115	20	0	0		X
17709	N-myc	115	0	0	0		X
21078	BLACD	115	0	0	0	X
18915	Brevenin	115	0	0	0	X
5938	CP-11in DPC micelles	115	0	0	0	X
34075	GLY-ILE-LEU-SER-SER-LEU-TRP-LYS-LYS-LEU-LYS-LYS-ILE-ILE-ALA-LYS	115	0	16	0	X
27547	H2A/H2B dimer	115	342	115	0	X
30232	Granulin	115	32	0	0	X
36057	Pilosulin-1	114	0	17	0	X
27370	KaisoE535A-MeKBS complex	114	0	114	0	X	X
27708	myrUSH3 AAA	114	365	114	0	X
18023	Cyclo-TC1 Trp-cage	114	0	0	0	X
16394	deltaF508 CFTR NBD1-RE monomer	114	0	114	0	X
27812	NHE1	114	386	114	0	X
25746	DNA G-quadruplex	114	0	0	0		X
26739	SipD	114	114	0	0	X
6326	CREB Binding Protein	114	0	0	0	X
19557	circular g-domain analog from the wheat metallothionein Ec-1	114	0	0	0	X
20108	SecA fragment	114	0	0	0	X
27494	Deubiquitinase A	114	359	114	0	X
27372	Kaiso-MeKBShemi complex	114	0	114	0	X	X
20054	KIA7W tetramer	114	48	0	0	X
19773	E81 deletion mutant from RAP80 tandem UIMs	114	113	58	0	X
26705	SAMSAM monomer	114	360	114	0	X
27369	KaisoE535Q-MeKBS complex	114	0	114	0	X	X
27371	Kaiso-MeKBSsemi complex	114	0	114	0	X	X
19257	Alpha-synuclein	114	245	114	0	X
4552	indolicidin	114	0	0	0	X
27513	Transthyretin	114	121	114	0	X
15481	HOMER3A EVH1 domain	114	0	114	0	X
27368	Kaiso-MeKBS complex	114	0	114	0	X	X
5259	Anticodon Stem-loop of tRNA(Phe)	114	102	13	14			X
4306	Polyandrocarpa lectin	114	119	114	0	X
17581	Solution structure of the skeletal muscle and neuronal voltage gated sodium channel antagonist mu-conotoxin CnIIIC	114	11	0	0	X
5288	Grb7 SH2 domain / phosphorylated peptide complex	114	198	114	0	X
16891	alpha haemoglobin in monomer-dimer equilibrium	113	219	113	0	X
16930	F2	113	343	113	0	X
6827	lah4 monomer	113	0	0	0	X
26531	EDN	113	261	113	0	X
27508	clobe	113	234	113	0	X
19183	Trp-cage 16b P12W: a Hyperstable Miniprotein	113	0	0	0	X
26755	NHE1	113	381	113	0	X
161	leghemoglobin I	113	0	0	0	X
30123	Gap junction beta-1 protein	113	42	0	0	X
30566	Granulin-4	113	0	0	0	X
19864	R1 peptide	113	65	18	0	X
5160	microcin J25	113	79	0	0	X
26557	alpha-synuclein	113	237	114	0	X
17848	hCc	113	302	105	0	X
25183	FSFG-K-6His	113	361	113	0	X
6278	yeast Sed5p	113	341	113	0	X
25189	malaria peptide 1815	113	0	0	0	X
11538	TPI-LPS	113	0	0	0	X
4709	WT1 zinc finger domain	113	353	113	0	X
5859	Microcin J25	113	72	19	0	X
4993	Zervamicin IIB	113	56	16	0	X
16697	REF2-I	113	325	113	0	X
4607	PAPILLOMAVIRUS E6-ASSOCIATED PROTEIN	113	0	0	0	X
6191	SecA	113	25	0	0	X
30620	Tachyplesin-2	113	44	13	0	X
18795	Amylin monomer	112	0	35	0	X
15293	N-Me-Leu8/N-Me-Ser14	112	0	0	0	X
1700	sarafotoxin-S6b	112	0	0	0	X
19856	a peptoid analogue of maculatin G15 in DPC micelles	112	68	0	0	X
36167	brevunsin	112	49	0	0	X
30054	DNA (5'-D(CPGP(SSG)PCPCPGPCPCPGPA)-3'), DNA (5'-D(TPCPGPGPCPGP(SSG)PCPCPG)-3')	112	0	0	18		X
7425	calmodulin	112	217	112	0	X
19623	GA-79-MBP cs-rosetta structures	112	162	55	0	X
19180	Trp-cage Circular Permutant	112	0	0	0	X
21013	RI23	112	0	0	0	X
30146	Designed peptide NC_cEE_D1	112	62	14	0	X
19318	drSTIL	112	172	50	0	X
16011	bovine pancreas ribonuclease A	112	239	112	0	X
19728	A tetrahelical DNA fold adopted by alternating GGG and GCG tracts	112	0	0	0		X
18885	Rpt6	112	299	112	0	X
16022	KIA7W tetramer	112	48	0	0	X
17228	ZNF	112	0	0	0	X
16898	alpha-haemoglobin:AHSP protein complex	112	120	112	0	X
5986	paralytic peptide of Antheraea yamamai	112	0	0	0	X
1616	serum albumin	112	0	0	0	X
27187	H2A-H2B histone dimer	112	342	112	0	X
17619	WALP19	112	0	22	0	X
16500	(1-119)Apomyoglobin pH 2.40	112	341	112	0	X
1874	micrococcal nuclease	112	0	0	0	X
7134	brinker CG9653-PA	112	112	55	0	X
25950	RSLman	112	256	97	0	X
15647	HSV-1 gH protein, gH626-644 fusion peptide	112	0	0	0	X
5501	Hepcidin	112	0	0	0	X
17847	hCc	112	298	104	0	X
11513	C1 domain	112	343	112	0	X
15068	UA159	112	0	0	0	X
7073	Pfam	112	69	68	0	X
27364	Kaiso-MeCG2 complex	111	0	111	0	X	X
27741	bsCopL	111	0	111	0	X
25445	A2A-ct	111	344	122	0	X
19162	p7 channel of Hepatitis C virus, genotype 5a	111	224	58	0	X
30215	Ocellatin-K1	111	68	17	0	X
15284	N-Me-Leu8	111	0	0	0	X
1339	tubulin binding peptide	111	0	0	0	X
1135	tachyplesin I	111	0	0	0	X
15285	N-Me-Lys11	111	0	0	0	X
27367	KaisoE535A-MeCG2 complex	111	0	111	0	X	X
6098	PC4ntd	111	166	53	0	X
27366	KaisoE535Q-MeCG2 complex	111	0	111	0	X	X
12003	neuronal SNARE complex	111	111	0	0	X
25366	crotalicidin-Nt	111	52	0	0	X
1137	synthesized signal peptide	111	0	0	0	X
30218	Ocellatin-LB2	111	56	6	0	X
18583	gp78CUE/K48-Ub2 complex	111	0	111	0	X
18584	gp78CUE/K48-Ub2 complex	111	0	111	0	X
4097	RNase H domain of HIV-1 RVT strain BH10	111	217	111	0	X
5293	Barstar pH 2.7 160 kD aggregate	111	47	21	0	X
21010	extended upain	111	48	0	0	X
19011	C1CT	111	331	111	0	X
27640	KCNE1TVG	111	297	111	0	X
19788	FKBP52	111	341	111	0	X
26735	LARA3	111	359	111	0	X
5277	PULMONARY SURFACTANT-ASSOCIATED PROTEIN B	111	0	0	0	X
18691	tpr1 domain	111	198	111	0	X
18862	Parallel human telomeric quadruplex containing 2'F-ANA substitutions	111	0	0	0		X
27540	Extracellular Adherence Protein Homolog 2	111	319	111	0	X
30262	RNA (41-MER)	110	0	0	0			X
15532	wt1-17mer	110	0	110	0	X
18913	[Aba3,16]BTD-2	110	54	0	0	X
16087	PAF	110	63	53	0	X
27915	p50 homodimer	110	221	110	0	X
25501	SH2-SH3 adapter protein drk	110	293	110	0	X
18948	LASSO PEPTIDE ASTEXIN-1(19)	110	0	0	0	X
4707	WT1 zinc finger domain	110	350	110	0	X
30060	Hylin-K	110	0	0	0	X
25474	Protegrin-3 (PG3)	110	56	14	0	X
15045	BBP+EF in DHPC micelles	110	308	110	0	X
25951	RSLfuc	110	255	96	0	X
27722	Gal3C R	110	71	110	0	X
19844	RNase 4	110	210	110	0	X
26945	Human SMAD4 MH1 domain	110	233	109	0	X
30618	Tachyplesin-3	110	50	13	0	X
19828	CHEMOKINE (C-C MOTIF) RECEPTOR 2	110	71	14	0	X
15827	MSI-594	110	0	0	0	X
19873	D-arm of tRNA(Met)	110	94	0	0			X
6078	IA3	110	109	54	0	X
18704	Siglec5 CRD	110	330	110	0	X
5198	peptide v107 in complex with vascular endothelial growth factor receptor-binding domain dimer	110	82	18	0	X
34053	DNA (5'-D(GPTPGPTPGPGPGPTPGPTP*G)-3')	109	0	0	0		X
15019	DAGK homotrimer	109	320	109	0	X
18861	Antiamoebin I	109	64	14	0	X
4240	Duplex DNA (5'-D(GPGPTPCPAPCPGPAPG)-3') (DOT)(5'-D(CPTPCPGPGPGPAPCPC)-3')	109	0	0	0		X
27079	bcl6	109	228	111	0	X
27930	Kibra WW domain	109	116	70	0	X
30403	Apolipoprotein A-I, GTPase KRas	109	25	84	0	X
27829	d(CGATATCG)2 : C-1305 complex	109	0	0	0		X
18835	dodecamer duplex	109	0	0	0		X
4433	glycine receptor alpha 1 subunit TM2 segment S267Y	109	0	0	0	X
18516	PSD95	109	284	101	0	X
25467	GB1-PLAT (PKD1_PLAT)	109	325	109	0	X
15291	N-Me-Gly13	109	0	0	0	X
5245	5'-D(TPGPTPTPTPGPGPC)-3'	109	0	0	13		X
6289	SecA_Ct	109	55	18	0	X
17231	ArsD homodimer	109	336	109	0	X
25201	1513 MSP-1 peptide	109	0	0	0	X
1656	nucleocapsid protein	109	0	0	0	X
5188	paralytic peptide of Bombyx mori	109	0	0	0	X
15233	hfraG130V	109	0	109	0	X
30109	PSM Alpha1	109	0	0	0	X
19507	CFP10 Monomer	109	317	109	0	X
11557	wild type hPin1 PPIase domain	109	328	109	0	X
5384	Glycine extended gastrin peptide	109	0	0	0	X
387	phospholipase A2	109	0	0	0	X
1442	insulin A chain	109	0	0	0	X
19194	20S-11S proteasome-activator complex	109	247	109	0	X
30211	Ocellatin-K1	109	68	20	0	X
11005	Bent alpha-helix	109	0	0	0	X
20026	F protein	109	0	0	0	X
30119	Gap junction beta-2 protein	109	40	0	0	X
4573	7,8-dihydroneopterin aldolase	109	302	109	0	X
30617	Tachyplesin II	109	46	14	0	X
26578	cytochrome c	109	0	102	0	X
19057	peptide	109	0	0	0	X
30401	Apolipoprotein A-I, GTPase KRas	109	25	84	0	X
20023	SIIIA monomer	109	52	26	0	X
5291	12 amino acid long derivative of the third helix of Antennapedia homeodomain	109	0	0	0	X
34074	GLY-ILE-LEU-SER-SER-LEU-TRP-LYS-LYS-LEU-LYS-LYS-ILE-ILE-ALA-LYS	109	50	16	0	X
25597	Dynorphin 1-13 bound to Kappa Opioid Receptor	109	18	18	0	X
25182	FSFG-K	109	350	109	0	X
15292	N-Me-Ser14	109	0	0	0	X
20102	t11	109	0	0	0	X
20062	Myelin Basic Protein	109	0	0	0	X
27552	m62A-h45	109	2	0	0			X
26727	Doublecortin C-terminal domain monomer	109	417	108	0	X
15282	N-Me-Phe5	108	0	0	0	X
18234	P1-CheY/P2 complex	108	0	108	0	X
36098	analogue peptide VG13P	108	0	0	0	X
17295	EC PROTEIN I/II	108	0	21	0	X
15921	a monomeric form in presence of detergent micelles	108	315	108	0	X
4767	apocytochrome b562	108	303	0	0	X
27408	Axin RGS domain	108	216	108	0	X
28003	FDX2	108	221	108	0	X
15135	ENSA-SDS dimer	108	337	108	0	X
17563	glycyl-tRNA anticodon stem-loops	108	90	0	0			X
27386	conotoxin_muPIIIA-11	108	13	0	0	X
16866	VAMP7(1-118)	108	0	108	0	X
40	myoglobin	108	0	0	0	X
6409	Metal-responsive element-binding transcription factor-1	108	321	108	0	X
17556	yPEPmin of Rsa1p	108	56	14	0	X
25169	Stable Peptide Biomarker RCB-1	108	38	15	0	X
17474	CD147 Ig0 C66M Dimer	108	214	106	0	X
27654	ING5 PHD Zn	108	182	55	0	X
26050	DK17 IN POPC:POPG:CHOLESTEROL:GM1 LUVS	108	0	0	0	X
30400	Apolipoprotein A-I, GTPase KRas	108	25	83	0	X
27916	p50 heterodimer	108	212	108	0	X
16742	Ribonuclease A	108	213	108	0	X
25516	Disulfide-Deleted Mutant of Analgesic Cyclic alpha-Conotoxin Vc1.1	108	13	0	0	X
18786	Erbin PDZ S47	108	215	108	0	X
4708	WT1 zinc finger domain DNA complex	108	227	108	0	X	X
25481	perforin C2 quad mutant	108	211	108	0	X
27063	CTD27-52 monomer	108	425	108	0	X
36087	analogue peptide VG13P	108	0	0	0	X
17761	NTL9	108	161	54	0	X
1138	synthesized signal peptide	108	0	0	0	X
6360	40-61 bovine alpha-hemoglobin fragment	108	0	0	0	X
21015	conotoxin pu14a	108	0	0	0	X
25764	2-stranded parallel beta-sheet	108	0	0	0	X
26894	monomeric SOD1	107	310	107	0	X
18254	apo-azurin	107	0	107	0	X
30214	Ocellatin-LB1	107	68	21	0	X
17506	N-terminal Domain of the Ribosomal Protein L9	107	160	54	0	X
16951	5'-R(GPAPCPAPAPGPUPGPUPCP*A)-3'	107	50	0	10			X
27206	CM2	107	179	61	0	X
15053	prion protein fragment	107	0	0	0	X
19883	peptoid analogue of maculatin G15 - peptoid trans-Nleu at position 13	107	60	0	0	X
26057	Mutant of BMAP-28(1-18)	107	57	0	0	X
25548	DHX36	107	77	17	0	X
3404	amphipathic alpha helix peptide	107	0	0	0	X
18567	S114A mutant of UVI31+	107	314	107	0	X
27983	Ca2+ depleted form 2	107	334	107	0	X
17564	Glycyl-tRNA(UCC)1B anticodon stem-loop	107	87	0	0			X
18576	Griffithsin (GRFT)	107	244	107	0	X
5502	Hepcidin	107	0	0	0	X
36148	G2,7,13A SMAP-18 analogue	107	0	0	0	X
15959	Phosphotyrosine-Binding Domain of Insulin Receptor Substrate-1 Monomer	107	0	107	0	X
26055	BMAP-28(1-18)	107	34	7	0	X
1585	insulin A chain	107	0	0	0	X
27326	Yes1-SH2 (Yes1 SH2 domain in complex with Cdc37-derived phosphopeptide)	107	204	107	0	X
15648	HSV-1 gH protein, R642S gH626-644 fusion peptide	107	0	0	0	X
26051	DK17 IN TBLE LUVS	107	0	0	0	X
25582	Protein and DNA complex	107	76	14	0	X	X
15391	KIA7 peptide tetramer	107	0	0	0	X
6085	hepcidin	107	59	9	0	X
30106	Phenol-soluble modulin Alpha 3	107	0	0	0	X
26049	DK17 IN GM1 LUVS	107	0	0	0	X
11558	C113D mutant human Pin1 PPIase domain	107	325	107	0	X
18585	Griffithsin (GRFT)	107	244	107	0	X
26009	Antimicrobial peptide protegrin PG-5	107	0	0	0	X
27700	NGH1x no salt	107	307	107	0	X
19307	UVI31+Mg	106	321	106	0	X
30189	Thiol:disulfide interchange protein DsbA	106	106	0	0	X
6329	CREB Binding Protein (E.C.2.3.1.48)	106	0	0	0	X
30217	Ocellatin-LB1	106	59	18	0	X
25792	p65dd/p50dd	106	222	106	0	X
18875	[Aba5,14]BTD-2, cyclic peptide	106	54	0	0	X
6	apamin	106	0	0	0	X
1446	designed helical protein	106	0	0	0	X
5463	catestatin	106	0	0	0	X
15287	N-Me-Phe12	106	0	0	0	X
30342	sea anemone toxin Kappa-actitoxin-Ate1a	106	52	17	0	X
25782	Lasso peptide Astexin2-dC4	106	59	0	0	X
5493	Acyl carrier protein synthase	106	312	106	0	X
7222	Link_TSG6 without hyaluronan octasaccharides	106	0	102	0	X
18785	Erbin PDZ WT	106	213	106	0	X
15649	PROTEIN	106	0	0	0	X
4725	metallothionein	106	41	0	0	X
27894	FOXO1	106	198	106	0	X
18340	Bax+vMIA	106	38	11	0	X
19308	UVI31+	106	321	106	0	X
7416	Calmodulin	106	309	106	0	X
25491	Conantokin Rl-B	106	73	17	0	X
20111	SecA fragment	106	0	0	0	X
17281	Alyteserin-1C	106	0	0	0	X
18641	PawS derived peptide 11 (PDP-11)	106	46	0	0	X
17659	stapled peptide SP6	106	0	0	0	X
27844	PAC3	106	0	106	0	X
15235	hfraW155R	106	0	106	0	X
15234	D122Y mutant of the C terminal domain of human frataxin	106	0	106	0	X
19343	OPA60 FROM N. GONORRHOEAE	106	316	106	0	X
1445	designed helical protein	106	0	0	0	X
19466	PICK1 PDZ ASIC1a C-term	105	292	98	0	X
27359	Abl1 SH3 monomer	105	0	50	0	X
17558	CHR/DPC micelle	105	90	25	0	X
11539	PROTEIN	105	0	0	0	X
30530	Citrocin	105	0	0	0	X
392	calmodulin	105	0	0	0	X
19664	EcDsbA-sulfonamide complex	105	106	0	0	X
18239	RNA (5'-R(GPAPGPGPAPCPAPUPAPGPAPUPCPUPUPC)-3')	105	0	0	15			X
7432	IscU(D39A)	105	209	105	0	X
19602	dimer of the metal binding domain 1-16 of human amyloid beta-peptide in complex with Zinc	105	56	16	0	X
26893	monomeric SOD1	105	310	105	0	X
11176	AML22	105	0	0	0			X
27401	Single polypeptide IDP	105	273	105	0	X
15503	MxiM(28-142)	105	216	105	0	X
2852	fibronectin	105	0	0	0	X
30488	CPfox5	105	0	14	0	X
20055	KIA7H tetramer	105	22	0	0	X
26645	single polypeptide chain	105	308	104	0	X
4273	Candidacidal Peptide Domain of MUC7	105	0	0	0	X
27088	ISCU monomer	105	218	105	0	X
1205	myoglobin	104	0	0	0	X
30386	RNA (5'-R(PGPGPCPAPCPUPUPCPGPGPUPGPCPC)-3')	104	0	0	0			X
6796	Smr	104	310	104	0	X
15409	zeta	104	321	104	0	X
7435	HVS ORF57/REF2-I complex	104	0	104	0	X
25592	Vpu cytoplasmic domain	104	142	52	0	X
17294	EC PROTEIN I/II	104	0	20	0	X
16714	AUCG tetraloop hairpin	104	104	30	13			X
6828	MazF homodimer	104	214	104	0	X
18403	UIM-SH3 monomer	104	194	104	0	X
16639	V of beta2-glycoprotein I and ligand-binding module complex	104	0	104	0	X
19902	P15 FLiPS	104	39	20	0	X
19774	tandem UIMs of wild-type RAP80	104	152	55	0	X
15236	CyaYG26KD27SD31K	104	0	104	0	X
6991	TFCD	104	39	19	0	X
19619	lantibiotic NAI-107	104	40	0	0	X
18106	S25p-mAb3c3	104	0	0	0	X
4576	a3T3 hybrid	104	0	0	0		X
18105	S25p	104	0	0	0	X
4618	DNA	104	0	0	0		X
34380	peptide P7	104	0	0	0	X
6993	TFPP	103	33	18	0	X
6413	fragment 40-61	103	0	0	0	X
6651	St II fragments	103	0	0	0	X
30583	Endoplasmic reticulum resident protein 29	103	297	103	0	X
16023	KIA7H tetramer	103	22	0	0	X
25952	RSL	103	249	96	0	X
18310	FliGn-FliFc	103	311	103	0	X
18661	CSGI	103	0	0	0	X
15392	KIA7F peptide tetramer	103	0	0	0	X
81	myelin basic protein	103	0	0	0	X
6327	CREB Binding Protein (E.C.2.3.1.48)	103	0	0	0	X
19192	beta-Hairpin Peptidomimetic Antibiotics	103	28	0	0	X
34054	DNA (5'-D(GPCPGPAPGPGPGPAPGPCPGPAPGPGP*G)-3')	103	0	0	0		X
623	myelin basic protein	103	0	0	0	X
28002	FDX1	103	204	103	0	X
11580	Fusion peptide in DPC micelles	103	17	0	0	X
18157	Avh5	103	323	103	0	X
18938	BTD-2[3,4]	103	53	0	0	X
27982	Ca2+ depleted form 1	103	320	103	0	X
36147	SMAP-18	103	0	0	0	X
7215	J7	103	0	0	0	X
27779	CsD	103	63	0	0	X
2077	epidermal growth factor	103	0	0	0	X
19669	Ms-NbGRP2 monomer	103	190	103	0	X
27707	SLY domain4	103	203	102	0	X
27089	ISCU monomer	103	211	103	0	X
30057	Hylin-Ac	103	0	0	0	X
18137	Fam96a	103	460	105	0	X
27325	Yes1-SH2 (SH2 domain of Yes1 kinase)	102	207	102	0	X
50019	CproIAPP	102	0	0	0	X
6817	Alpha-conotoxin MII	102	0	0	0	X
4874	mSin3B-PAH2 free state	102	296	102	0	X
15244	CyaYE19K,D22K	102	0	102	0	X
17664	ORF57 103-120	102	85	23	0	X
15703	CD69	102	205	102	0	X
19882	a peptoid analogue of maculatin G15 containing cis-Nleu at position 13	102	50	0	0	X
758	cytochrome c551	102	0	0	0	X
19175	[Asp2]RTD-1	102	52	0	0	X
6917	pop5 monomer	102	306	102	0	X
11498	Unique and SH3 domains of mouse Lck	102	335	102	0	X
1655	endothelin	102	0	0	0	X
30059	Hylin-D	102	0	0	0	X
15865	DARPP-32	102	346	102	0	X
34314	TRP-TYR-HIS-ARG-LEU-SER-HIS-ILE-HIS-SER-ARG-LEU-GLN-ASP-NH2	102	61	0	0	X
26764	hTRF1	102	139	50	0	X
4213	retro-inverso peptide	102	0	0	0	X
19995	LysRS Anticodon Binding Domain 72-207	102	317	102	0	X
7230	5'-R(GPGPCPUPAPAPGPAPC)-3', 5'-R(GPUPCPGPAPAPGPCPC)-3'	102	0	0	0			X
30416	Competence-stimulating peptide type 1	102	32	18	0	X
7161	Ezrin FERM C ERMAD Complex	102	293	102	0	X
16922	histidine kinase receptor KdpD	102	257	102	0	X
391	calmodulin	102	0	0	0	X
7214	J3	102	0	0	0	X
27800	CsC	102	62	0	0	X
18359	IscU(D39V)	102	306	102	0	X
27126	SH2B1/JAK2-pep complex	102	102	102	0	X
16509	CR1618	101	193	101	0	X
7318	Monomer	101	202	68	0	X
7212	J1	101	0	0	0	X
27699	NGH1x	101	292	101	0	X
6572	Cytochrome c3	101	0	101	0	X
19759	Tetra-O-GalNAc glycosylated mucin sequence from alpha dystroglycan mucin domain	101	62	10	0	X
18256	monomeric phospholamban (C36A, C41F, C46A)	101	152	50	0	X
19247	plastocyanin	101	188	97	0	X
6018	phosphorylated S100C/A11 fragment	101	0	0	0	X
5271	desulforedoxin	101	48	50	0	X
20053	Insulin A-chain variant peptide	101	46	0	0	X
19176	[Asp11]RTD-1	101	51	0	0	X
17567	TASL2 (monomer)	101	77	0	0			X
27962	FITZAP-8D	101	77	26	0	X
17172	RNase A C-dimer	101	0	98	0	X
26701	T-STAR KH	101	0	101	0	X
36024	Bradykinin-trypsin inhibitor secondary loop chimera	101	0	0	0	X
25035	cChimeraX Ca2+ bound	101	188	101	0	X
6414	amidated fragment 33-52 of bovine alpha-hemoglobin	101	0	0	0	X
19112	MS1	101	66	20	0	X
18757	theta-defensin HTD-2 (retrocyclin 2)	101	49	10	0	X
6273	GTTCACAGAAC DNA hairpin	101	0	0	10		X
6274	GTACACAGTAC DNA hairpin	101	0	0	0		X
27290	yap	101	274	102	0	X
19177	[Asp2,11]RTD-1	101	51	0	0	X
25916	PaDBS1R1	101	75	18	0	X
17884	RAT BETA-AMYLOID	101	35	0	0	X
15169	monomer	101	0	0	0	X
30427	Competence-stimulating peptide type 1	101	32	15	0	X
6905	Zap1 - monomer	101	184	56	0	X
27979	BteA131	101	283	101	0	X
17565	Unmodified Glycyl-tRNA(UCC) anticodon stem-loop	101	82	0	0			X
6833	MazF(E24A)2-MazEp(54-77)2 heterotetramer	101	212	101	0	X
25765	2-stranded parallel beta-sheet	101	0	0	0	X
5214	Y2 selective analogue I of neuropeptide Y	101	0	0	0	X
27752	CsB	101	61	0	0	X
248	metallothionein	101	0	0	0	X
26881	LC3B monomer	101	0	101	0	X
25418	human Cyt c	101	193	99	0	X
30229	Acinetodin	100	0	0	0	X
5731	SCR3 peptide (18-34)	100	0	0	0	X
19823	Lasso Peptide Caulonodin V	100	0	0	0	X
30434	Competence-stimulating peptide type 1	100	30	15	0	X
19161	Amelogenin in SDS	100	369	100	0	X
2545	alamethicin	100	0	21	0	X
18598	LytTR domain	100	302	100	0	X
17256	PROTEIN STE5	100	0	0	0	X
30226	Alpha-conotoxin GID	100	34	0	0	X
36149	LYS-ASN-LYS-SER-ARG-VAL-ALA-ARG-GLY-TRP-GLY-ARG-LYS-CYS-PRO-LEU-PHE-GLY	100	0	0	0	X
15390	HA Fusion Domain Mutant F9A	100	0	0	0	X
18240	Mutant of the sub-genomic promoter from Brome Mosaic Virus	100	0	0	14			X
11375	Tia1 protein	100	0	100	0	X		X
428	collagen	100	0	0	0	X
6328	CREB Binding Protein (E.C.2.3.1.48)	100	0	0	0	X
4601	Zervamicin IIB	100	79	16	0	X
30487	CPfox4	100	0	11	0	X
15936	4 sigma70	100	0	100	0	X
25561	ASC PYD	100	192	100	0	X
19887	Oligonucleotide Model of the MiR-21 Pre-Element	100	0	0	0			X
25099	Hs2 dimer	100	0	0	0		X
11407	CUG-BP- and ETR-3-like factor 1	100	0	100	0	X		X
17046	holoTrpR dimer L75F variant	100	189	100	0	X
19418	PICK1 PDZ GluA2	100	220	100	0	X
30073	Uncharacterized protein	100	17	0	0	X
15969	Hepatitis B core protein homodimer	100	327	97	0	X
15580	NS4A	100	58	0	0
26030	Protein kinase G (PknG) 74-147 rubredoxin domain reduced, metal bound form	100	224	63	0	X
30176	Conantokin	100	60	18	0	X
17699	SOLUTION NMR STRUCTURE OF THE S4S5 LINKER OF HERG POTASSIUM CHANNEL	100	0	0	0	X
5717	XBY6 DNA 14-MER DUPLEX	100	0	0	0		X
30412	Alpha-conotoxin Vc1A	100	42	20	0	X
5216	Y2 selective analogue III of neuropeptide Y	100	0	0	0	X
11406	CUG-BP- and ETR-3-like factor 1	100	0	100	0	X		X
25539	EPI-X4, a human albumin-derived peptide	100	0	0	0	X
20123	NS4A(1-22)	100	58	0	0	X
27924	scAtg8	100	192	100	0	X
17759	murine prion protein (residues 121-232)	100	301	0	0	X
15237	CyaYD31K	100	0	100	0	X
30340	DNA repair protein REV1 (E.C.2.7.7.-)	99	58	55	0	X
15885	UHM domain of Puf60	99	197	99	0	X
252	p55F1 zinc fingerlike domain	99	0	0	0	X
27698	p15CSS	99	208	99	0	X
180	leghemoglobin I	99	0	0	0	X
5593	rat GMEB-2 extended SAND domain	99	195	99	0	X
1144	leghemoglobin II	99	0	0	0	X
25704	lasso peptide chaxapeptin	99	79	16	0	X
6017	S100C/A11 fragment	99	0	0	0	X
17550	RING	99	224	72	0	X
20020	PND_LAI	99	0	0	0	X
27882	ShkA-Rec2	99	183	99	0	X
30429	Competence-stimulating peptide type 1	99	30	19	0	X
4702	C-terminal negative regulatory domain of p53 in complex with Ca2+ -bound S100B(bb)	99	0	0	0	X
19125	BRPF1 momomer	99	317	99	0	X
26625	ASAP1 PH domain	99	1	97	0	X
19190	LptD	99	29	0	0	X
30431	Competence-stimulating peptide type 1	99	30	6	0	X
18635	HbD1	99	61	33	0	X
27111	MSI2 RRM1	99	216	99	0	X
517	transforming growth factor alpha	99	0	0	0	X
17945	TauF4 Fragment	99	214	99	0	X
27539	NS1 effctor domain monomer	99	185	99	0	X
34214	Ephrin type-A receptor 2 (E.C.2.7.10.1)	99	0	0	0	X
5487	Tachyplesin I, tyrosine mutant	99	0	0	0	X
77	val-gramicidin A	99	0	0	0	X
15775	The transmembrane C-terminal domain of the Amyloid Precursor Protein	99	284	99	0	X
4432	glycine receptor alpha 1 subunit TM2 segment	99	0	0	0	X
2118	calcitonin C	99	0	0	0	X
4212	synthetic L-peptide corresponding the the G-H loop of the foot-and-mouth disease virus VP1 protein	98	0	0	0	X
17356	DGD2	98	0	0	0	X
16740	Zn-amicyanin	98	0	96	0	X
15979	Fowlicidin-1	98	0	0	0	X
7429	Phosphotyrosine-Binding Domain of Insulin Receptor Substrate-1 Monomer complex with Interleukin-4 Receptor Phosphopeptide	98	0	98	0	X
27094	CaMC NaV1.2 IQ motif	98	286	98	0	X
16245	IscU monomer	98	0	98	0	X
17552	Ph SAM linker	98	203	98	0	X
5830	Horse cytochrome c (wt) oxidized form	98	0	98	0	X
30509	Unconventional myosin-Ih peptide	98	0	0	0	X
18162	Neurotensin	98	0	0	0	X
34328	DNA (5'-(DC5)PGPAPTP(P)PTPAP(Z)PAPTPCP(DG3))-3')	98	72	0	11		X
36083	uncharacterized protein subterisin	98	57	0	0	X
26929	NCAM FN1	98	308	98	0	X
30225	Alpha-conotoxin GID	98	36	0	0	X
16602	KCNE3	98	264	91	0	X
30453	ALA-TYR-ALA-GLN-TRP-LEU-ALA-ASP-DAL-GLY-PRO-ALA-SER-DAL-NVA-PRO-PRO-PRO-SER	98	0	0	0	X
5318	phospholipase C gamma-1 C-terminal SH2 domain	98	0	98	0	X
11545	aqMutL-CTD homodimer	98	283	98	0	X
444	gene V protein	98	0	0	0	X
18722	BTD-2	98	54	16	0	X
19886	CGACGCGTCG	98	0	0	0		X
18472	Apo form gt CsoR	98	298	98	0	X
677	troponin C	98	0	0	0	X
15667	Peptide	98	0	0	0	X
30489	CPfox6	98	0	0	0	X
4331	Streptomyces subtilisin inhibitor	98	198	98	0	X
5829	Horse cytochrome c (wt) reduced form	98	0	98	0	X
15042	Tritrp5	98	0	0	0	X
21000	MccJ25 RGD	98	0	0	0	X
19568	ISUR	98	136	46	0	X
18470	Cu(I) gt CsoR	98	297	98	0	X
7417	Calmodulin	98	285	98	0	X
16274	SLBP	98	0	17	0	X
16949	PDZ3 of ZO-1	98	193	98	0	X
15758	4-5F1	98	175	96	0	X
19597	Ctrr_sds	98	0	0	0	X
11593	RAM	97	282	97	0	X
17032	CKR-PNG	97	67	17	0	X
16741	holo-amicyanin	97	285	97	0	X
27928	Polypeptide chain	97	0	0	0	X
16799	HCV (JFH-1) NS5A-D3	97	299	97	0	X
27024	Ascl1 trascription factor	97	315	97	0	X
18829	TIA-1 protein	97	199	97	0	X
25500	SH2-SH3 adapter protein drk	97	297	97	0	X
26651	Akt_PHD	97	197	97	0	X
15040	13-mer_analogue_of_Prophenin-1_containing_WWW	97	0	0	0	X
25414	3' splice site influenza A: 11-nt hairpin	97	0	0	10			X
19697	novel venom peptide toxin from sample limited terebrid marine snail	97	46	0	0	X
2327	acid phosphatase	97	0	0	0	X
1676	dynorphin A	97	0	0	0	X
6501	Nsp9 dimer	97	189	97	0	X
25642	cytoskeletal bactofilin BacA	97	418	102	0	X
26762	Elk1	97	321	97	0	X
15521	TTF-1 HD	97	0	86	0	X
18164	Neurotensin	97	0	0	0	X
27216	prothymosin alpha in complex with Histone H1	97	172	102	0	X
30595	Competence-stimulating peptide type 1	97	19	7	0	X
15891	minimal complex of Puf60 and Prp16(201-238)	97	0	97	0	X
25490	Conantokin Rl-B	97	74	18	0	X
5215	Y2 selective analogue II of neuropeptide Y	97	0	0	0	X
50205	FH8-IDR-HP63	97	284	97	0	X
11607	Reverse transcriptase recognition site of transcript of a LINE from Denio Renio, LS-1	97	33	0	0			X
16798	HCV (JFH-1) NS5A-D3	97	306	97	0	X
17240	Influenza HA fusion peptide(G13A)	97	0	0	0	X
4710	WT1 zinc finger domain	97	222	97	0	X	X
4604	THE PEPTAIBOL CHRYSOSPERMIN C BOUND TO DPC MICELLES	97	75	3	0	X
15145	neurotensin	97	0	0	0	X
19576	FAPP1 PH domain monomer	97	274	97	0	X
27119	SH2B1 SH2 Domain	97	97	97	0	X
18405	Sviceucin	97	58	0	0	X
21001	neurotensin	97	0	0	0	X
26693	DHFR-apo	97	276	97	0	X
19294	DNA-binding domain of T. brucei telomeric protein tbTRF	97	0	98	0	X
1704	micrococcal nuclease	96	100	5	0	X
25192	L,D-transpeptidase in complex with a peptidoglycan hexamuropeptide	96	96	96	0	X
15820	RRM1 of hnRNPLL	96	292	96	0	X
12010	flagellar protein FliGc	96	288	96	0	X
19829	CHEMOKINE (C-C MOTIF) RECEPTOR 2	96	39	14	0	X
18163	Neurotensin	96	0	0	0	X
15136	ENSA	96	304	96	0	X
7424	calmodulin	96	265	96	0	X
5076	Cold Shock domain	96	53	36	0	X
30184	RNA	96	0	0	0
30430	Competence-stimulating peptide type 1	96	32	15	0	X
26975	G alphai 3 bound to GDP	96	96	0	0	X
36069	Esculentin-1A	96	0	0	0	X
20103	[Lysine4]XT-7	96	0	0	0	X
4967	Mason-Pfizer Monkey Virus protease	96	204	95	0	X
26866	PDZ domain	96	276	96	0	X
30486	CPfox2	96	0	0	0	X
19603	ctrdpc	96	0	0	0	X
7141	SH2 domain of human Csk with Cbp ligand	96	196	96	0	X
20125	VK22 in DPC micelles	96	0	0	0	X
19889	CGACTAGTCG with AIK-18/51-1	96	0	0	0		X
11374	Tia1 protein	96	0	96	0	X		X
30267	20-mer Peptide	96	58	0	0	X
26655	emerin 67-170	96	202	96	0	X
20105	BI	96	0	0	0	X
20014	CAPISTRUIN	96	0	0	0	X
15882	SPF45 UHM domain	96	196	96	0	X
36079	beta-ginkgotide, beta-gB1	96	0	0	0	X
4711	RNA-binding protein	96	101	96	0	X
7433	CD147	96	194	97	0	X
25769	frog skin-derived peptide Esculentin-1a[Esc(1-21)NH2]	96	0	0	0	X
25731	phosphoenolpyruvate-Enzyme I complex from the bacterial hosphotransferase system	95	0	95	0	X
3032	eglin c	95	0	0	0	X
5486	Tachyplesin I	95	0	0	0	X
15051	Prophenin1	95	0	0	0	X
27196	Igdomain	95	276	95	0	X
25962	PDP-9	95	0	0	0	X
5858	Cu (I) Plastocyanin from Anabaena Variabilis	95	0	95	0	X
25212	protegrin-2 docked to DPC Micelles	95	0	0	0	X
25206	high-activity binding peptide 6505	95	0	0	0	X
5494	PW2 Bound to SDS Micelles	95	0	0	0	X
5394	U2 snRNA - Intron duplex	95	0	0	0			X
4315	Iron-containing superoxide dismutase	95	320	95	0	X
17041	holoTrpR dimer	95	189	95	0	X
15069	TCP3	95	0	0	0	X
27721	Gal3C S	95	58	95	0	X
16621	KCNE3	95	284	96	0	X
11373	Tia1 protein	95	292	95	0	X
11372	Tia1 protein	95	293	95	0	X
1697	neurotensin	95	0	0	0	X
26654	emerin 67-170	95	304	95	0	X
19476	CONOTOXIN LO1A	95	48	0	0	X
7370	Fern plastocyanin	95	0	95	0	X
4724	basic peptide	95	49	0	0	X
16952	5'-R(GPAPCPAPAPGPUPGPUPCP*A)-3'	95	29	5	10			X
17986	cyclic gomesin	95	0	0	0	X
25108	PfI2	95	300	93	0	X
16586	3F5_VHH	95	181	94	0	X
19809	YSCUCN in a micellar complex with SDS	95	55	55	0	X
27084	beta-gB1	95	0	0	0	X
5825	KaiA C-terminal domain	95	177	95	0	X
27312	ASR trimer	95	186	95	0	X
30263	Guavanin 2	94	20	0	0	X
17568	TASL3 (monomer)	94	82	0	0			X
15890	minimal complex of Puf60 and SF3b155(317-357)	94	0	94	0	X
16495	PYD peptide from ErbB2	94	0	0	0	X
6040	Pulmonary surfactant-associated protein B	94	0	6	0	X
30516	PRO-MET-ALA-ARG-ASN-LYS-ILE-LEU-GLY-LYS-ILE-LEU-ARG-LYS-ILE-ALA-ALA-PHE-LYS	94	38	19	0	X
25624	G89A,D91R double mutant of KaiB	94	309	94	0	X
27276	SGTA_Nter-linker	94	246	87	0	X
30428	Competence-stimulating peptide type 1	94	31	15	0	X
34316	TRP-TYR-HIS-ARG-LEU-SER-HIS-ILE-HIS-SER-ARG-LEU-GLN-ASP-NH2	94	56	0	0	X
44	ovomucoid third domain	94	0	0	0	X
27621	DFD mononer	94	310	89	0	X
11582	Internal fusion peptide in DPC micelles	94	15	0	0	X
4258	MCB12T	94	0	0	0		X
7246	PEBP2alpha DNA binding domain	94	96	94	0	X
17837	IscU	94	69	91	0	X
30071	Plastin-2	94	284	95	0	X
18590	S. aureus pepA1 NMR structure	94	0	0	0	X
18284	antifreeze_peptide_1m	94	0	0	0	X
19244	Domain 2 from E. coli HisJ	94	290	94	0	X
16933	FKBP12-rapamycin-FRB	94	185	94	0	X
27541	NS1 effctor domain monomer	94	257	94	0	X
36044	Au-VG16KRKP	94	0	0	0	X
26786	pElk1	94	318	94	0	X
19236	plastocyanin	94	195	94	0	X
4244	alphaT decamer duplex	94	0	0	9		X
25963	PDP-10	94	0	0	0	X
27060	DecP-11	94	0	0	0	X
4392	DNA minor groove binder	94	0	0	0		X
30432	Competence-stimulating peptide type 1	94	31	14	0	X
30601	Competence-stimulating peptide type 1	94	24	9	0	X
27832	tEIC methyls	94	94	0	0	X
18970	peptide	94	44	0	0	X
25420	human Cyt c G41S mutant (ferrous)	94	194	94	0	X
34366	PHE-VAL-CAP-TRP-PHE-SER-LYS-PHE-LEU-GLY-ARG-ILE-LEU-NH2	94	0	0	0	X
18969	S55A mutant of UVI31+	94	288	94	0	X
34367	PHE-VAL-TCP-TRP-PHE-SER-LYS-PHE-LEU-GLY-ARG-ILE-LEU-NH2	94	0	0	0	X
11371	Tia1 protein	93	290	93	0	X
5916	empaf, eumenine mastoparan	93	0	0	0	X
15302	Odorrana	93	0	0	0	X
1699	neurotensin	93	0	0	0	X
6304	SUMO-1	93	0	93	0	X
27348	intrinsically disordered alpha-synuclein	93	273	139	0	X
11527	PriB homodimer	93	282	93	0	X
6290	Nc metallothionein	93	0	0	0	X
16900	MDM4-p53 complex	93	281	93	0	X
27757	SQT-1N monomer	93	290	93	0	X
16069	PilZ	93	184	93	0	X
5395	Unmodified U2 snRNA - Intron duplex	93	0	0	0			X
30483	PHE-LEU-PRO-ILE-ILE-ILE-ASN-LEU-LYS-ALA-LEU-ALA-ALA-LEU-ALA-LYS-LYS-ILE-LEU	93	38	17	0	X
19113	B2709-b2m-pVIPR complex	93	262	93	0	X
15889	minimal complex of Puf60 and SF1	93	0	93	0	X
26966	hLTB	93	256	93	0	X
26976	G alpha i3 bound to GoLoco14	93	93	0	0	X
50099	Nipah virus phosphoprotein, residues 91-190	93	283	93	0	X
18991	[2Fe-2S]Fdx	93	261	89	0	X
1677	melanin concentrating hormone	93	0	0	0	X
7213	J1cc	93	0	0	0	X
530	micrococcal nuclease	93	98	6	0	X
17592	Anabaena Sensory Rhodopsin Transducer with DNA	93	306	93	0	X	X
6500	Siah-Interacting Protein (Residues 74-178)	93	279	93	0	X
27484	ORF57 68-178	93	0	93	0	X
17758	murine prion protein (residues 121-232)	93	283	0	0	X
27205	Hs. Par3 PDZ3 domain	93	190	93	0	X
27304	BAMB5917_HOLO	93	0	93	0	X
5358	Trypsin-Bound Bovine Pancreatic Trypsin Inhibitor	93	109	53	0	X
34406	peptide 3967	93	50	11	0	X
34038	RNA (29-MER)	93	63	18	0			X
4	alamethicin	92	0	0	0	X
11596	gallium ferredoxin	92	275	92	0	X
19123	B2705-b2m-pGR complex	92	0	92	0	X
15888	minimal complex of Puf60 and SF1	92	0	92	0	X
19584	Dvl-2 DEP	92	274	92	0	X
27147	NT-2Rep-CT	92	246	92	0	X
36144	peptide-PEM-2-W5K/A9W	92	0	0	0	X
4398	neuropeptide Y	92	0	0	0	X
25751	VG16KRKP_DIMER	92	0	0	0	X
30178	Conantokin	92	74	19	0	X
5642	SS9	92	75	0	0		X
5582	Type B lantibiotic mersacidin	92	0	0	0	X
30576	Asf1-H3:H4-Rtt109-Vps75 histone chaperone-lysine acetyltransferase complex with the histone substrate	92	92	0	0	X
11581	Pre transmembrane domain in DPC micelles	92	16	0	0	X
34092	TRP-TYR-HIS-ARG-LEU-SER-HIS-ILE-HIS-SER-ARG-LEU-GLN-ASP-NH2	92	55	0	0	X
17048	AP180 M5	92	151	45	0	X
7140	SH2 domain of human Csk	92	179	92	0	X
5644	SS11	92	75	0	0		X
34401	peptide 3967	92	52	0	0	X
26726	Extracellular Adherence Protein	92	181	92	0	X
20001	odorranalectin	92	0	0	0	X
5636	SS3	92	75	0	0		X
5634	SS1	92	75	0	0		X
6996	TFSP253	92	43	21	0	X
27438	Human PIRT	92	141	91	0	X
18362	IscU(S107A)	92	263	90	0	X
17843	GB98-T25I	92	100	48	0	X
7012	18-mer peptide from Thermonuclease (E.C.3.1.31.1)	92	57	0	0	X
25553	SUMO1 and ZZ-domain from CBP	92	14	92	0	X
30490	CPfox7	92	0	0	0	X
27482	NdCd-SET homodimer	91	106	92	0	X
19154	Sungsanpin	91	77	0	0	X
5645	SS12	91	74	0	0		X
30179	Conantokin-R1-B	91	61	19	0	X
1825	Anantin-A peptide	91	0	0	0	X
1893	neurotensin	91	0	0	0	X
34215	Ephrin type-A receptor 2 (E.C.2.7.10.1)	91	0	0	0	X
5637	SS4	91	74	0	0		X
5116	gamma subunit of dissimilatory siroheme-sulfite reductase	91	173	91	0	X
19355	Lassomycin	91	55	19	0	X
20048	Mu-contoxin KIIIA	91	14	15	0	X
25511	cChimeraX-A162H, Ca2+ bound	91	0	91	0	X
6954	Hemagglutinin	91	0	0	0	X
19437	mammalian tachykinin neuropeptide gamma	91	0	0	0	X
5641	SS8	91	74	0	0		X
7367	L-22	91	0	0	0	X
30433	Competence-stimulating peptide type 1	91	30	14	0	X
27583	NGF Pro-domain	91	249	89	0	X
30200	Degenerin mec-4	91	287	91	0	X
5635	SS2	91	74	0	0		X
25465	ConRlBNQO	91	67	19	0	X
15548	stefin B	91	283	91	0	X
25971	poneritoxin, omega-PONTX-Ae1a	91	46	19	0	X
5649	SS16	91	74	0	0		X
15044	none	91	0	0	0	X
5681	CYCLIC OLIGONUCLEOTIDE D(CGCTCATT)	91	0	0	8		X
34091	TRP-TYR-HIS-ARG-LEU-SER-HIS-LEU-HIS-SER-ARG-LEU-GLN-ASP-NH2	91	55	0	0	X
19119	B2709-b2m-pGR complex	91	0	92	0	X
15274	Hdm2-ABD	91	276	91	0	X
18104	S25up	91	0	0	0	X
4179	helix1 from the peripheral subunit binding domain	91	0	0	0	X
27489	rS1-D5	91	220	91	0	X
30284	Adhesion invasion locus	91	94	91	0	X
18309	FliGn homodimer	91	191	91	0	X
5639	SS6	91	74	0	0		X
5647	SS14	91	74	0	0		X
25749	C4VG16KRKP	91	0	0	0	X
5643	SS10	91	74	0	0		X
25422	human Cyt c G41S mutant (ferric)	91	277	91	0	X
50101	Nipah virus phosphoprotein residues 223-319	90	279	90	0	X
18659	peptide epsilon(103-120)	90	0	0	0	X
30593	Competence-stimulating peptide type 1	90	23	13	0	X
17373	pdz domain	90	277	90	0	X
27071	BTHB	90	210	80	0	X
16299	T1 domain tetramer	90	240	90	0	X
25335	VG16KRKP, an antimicrobial peptide in LPS	90	0	0	0	X
5640	SS7	90	73	0	0		X
11584	c-Myb R2R3 C130I	90	195	90	0	X
5638	SS5	90	73	0	0		X
18286	antifreeze_peptide_3	90	0	0	0	X
5585	alpha-conotoxin GID	90	0	0	0	X
27776	GlpG	90	279	90	0	X
5646	SS13	90	73	0	0		X
1816	tendamistat	90	0	0	0	X
6437	lf11 peptide	90	0	0	0	X
5648	SS15	90	73	0	0		X
7168	Dynorphin A in Bicelles	90	0	0	0	X
17964	HIV-1 PR Homodimer	90	172	90	0	X
19468	WR17_LPS	90	0	0	0	X
36022	DNA (5'-D(TPTPTPAPTPTPTPA)-3')	90	0	0	0		X
1851	epidermal growth factor	90	0	0	0	X
25996	J-K region of EMCV IRES	90	0	0	0			X
27712	CaM-N	90	0	83	0	X
15447	Fibronectin fragment	90	0	83	0	X
26064	PawS Derived Peptide 22 (PDP-22)	90	43	11	0	X
7157	HELIX F	90	0	0	0	X
18079	UNAC Tetraloops	90	0	0	0			X
27247	domain swapped dimer	90	256	90	0	X
17996	HIV-1 PR Homodimer	89	181	89	0	X
34305	Trpzip2	89	22	0	0	X
30230	Klebsidin	89	0	0	0	X
18034	UNAC Tetraloops	89	0	0	0			X
25616	KaiB dimer	89	281	89	0	X
26956	Ca-S100A4d9-C-ERMAD complex	89	0	89	0	X
25926	KR-12	89	0	0	0	X
27437	FcRn	89	173	89	0	X
5046	HCV IRES RNA DOMAIN IIIC	89	0	0	0			X
27198	Par3 PDZ3 domain	89	268	89	0	X
15594	calbindin with Yb3+	89	113	52	0	X
25264	60S pre-ribosome	89	176	89	0	X
27346	Nucleosome	89	188	89	0	X
50102	Nipah virus phosphoprotein residues 299-401	89	292	89	0	X
18036	UNAC Tetraloops	89	0	0	0			X
36124	Andersonin-Y1 (AY1)	89	0	0	0	X
17584	Thp5	89	58	19	0	X
30287	ASN-VAL-HIS-THR-PHE-ARG-GLY-ASP-ASN-VAL-HIS-ASN-SER-SER-SER-SER-LEU	89	0	0	0	X
30414	p21	89	0	0	0	X
18780	DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link	89	0	0	0		X
7091	GroES heptamer	89	135	89	0	X
5967	HIV-1 protease (E.C.3.4.23.16)	89	175	89	0	X
15043	none	89	0	0	0	X
27246	single chain monellin	89	263	89	0	X
16221	CBD monomer of MMP2	89	123	43	0	X
6463	LfcinB4-14Disu	89	0	0	0	X
4759	cytochrome b562	89	92	89	0	X
27204	Hs. Par3 PDZ2 domain	89	0	89	0	X
10117	PCP homo tetramer	89	0	0	0	X
6163	v-myc/max heterodimer	88	95	88	0	X
16847	dimer	88	0	89	0	X
12011	flagellar protein FliGc A282T	88	266	88	0	X
20049	Mu-KIIIA[C1A,C9A]	88	15	12	0	X
1709	collagen	88	0	0	0	X
18781	DNA	88	0	0	0		X
27673	rat adx with iron sulfur cofactor	88	85	88	0	X
18608	ASC PYD	88	266	89	0	X
20028	Statherin	88	0	0	0	X
15666	Im7 mutant	88	175	88	0	X
16735	Anthrax Lethal Factor C-terminal	88	264	88	0	X
5580	Type B lantibiotic mersacidin	88	0	0	0	X
17013	Tryptophan apo-repressor	88	182	88	0	X
18629	H-RasT35S mutant protein in complex with Kobe2601	88	77	0	0	X
18138	MDR 769 homodimer	88	177	88	0	X
15973	HGF-binding peptide-10	88	56	0	0	X
30562	SFTI-KLK5 Peptide	88	36	14	0	X
21018	Compstatin_10	88	0	0	0	X
18035	UNAC Tetraloops	88	0	0	0			X
7282	MHA6	88	34	0	0	X
36150	VAL-ALA-ARG-GLY-TRP-GLY-ARG-LYS-CYS-PRO-LEU-PHE-GLY-LYS-ASN-LYS-SER-ARG	88	0	0	0	X
15117	NS1A:dsRNA complex	88	235	87	0	X		X
30547	RNA (5'-R(CPGPGPGPCPAPUPCPCPG)-3')	88	18	0	5			X
30268	RNA (5'-R(CPCPAPGPAPAPAPCPGPGPAPUPGPGP*A)-3')	88	0	0	13			X
16514	syb96	88	272	88	0	X
5253	5'-D(CPCPAPTPGPCPGPTPGPG)-3'	88	0	0	0		X
18736	Conotoxin_TxIB	88	0	0	0	X
25131	Kindlin-2 F2	88	0	0	0	X
17994	HIV-1 PR Homodimer	88	177	88	0	X
30270	Peptide 38136:ASN-VAL-HIS-THR-PHE-ARG-GLY-ILE-ASN-GLY-HIS-ASN-SER-SER-SER-SER-LEU	88	0	0	0	X
34306	Trpzip2	88	40	0	0	X
4124	hPTP1E-Fas receptor complex	88	0	88	0	X
26574	GAT	88	271	88	0	X
15756	2-3F1	88	160	88	0	X
6697	Calbindin D9k monomer	88	167	58	0	X
968	cytochrome c551	87	0	82	0	X
17657	stapled peptide SP2	87	0	0	0	X
7155	HELIX G	87	0	0	0	X
18335	gH625-644	87	0	0	0	X
15572	RNA DUPLEX CONTAINING SINGLE ADENOSINE BULGE	87	57	0	10			X
18361	IscU(N90A)	87	258	87	0	X
30594	Competence-stimulating peptide type 1	87	19	12	0	X
6227	Barstar	87	261	87	0	X
15077	LC8 / Swa complex	87	156	87	0	X
17591	Anabaena Sensory Rhodopsin Transducer with F-tails	87	296	87	0	X
10116	PCP homo tetramer	87	0	0	0	X
27109	alphaA-crystallin (or HSPB1)	87	81	22	0	X
18972	SOLUTION STRUCTURE OF THE SOMATOSTATIN SST3 RECEPTOR ANTAGONIST TAU-CONOTOXIN CnVA	87	51	0	0	X
18723	RTD-1	87	41	12	0	X
15953	H55K mutant of LC8	87	172	88	0	X
26849	Spy	87	260	87	0	X
26973	HCC	87	269	87	0	X
25602	GAT	87	263	87	0	X
15639	monomer	87	0	0	0	X
27598	XRCC1-BRCT1	87	276	87	0	X
19686	ASD-1+RNA	87	185	87	0	X		X
6825	CaM-CaD peptide	87	0	0	0	X
27376	prelamin A C-terminal region	87	170	89	0	X
30110	Antimicrobial peptide KAMP-19	87	44	18	0	X
26066	PawS Derived Peptide 20 (PDP-20)	87	39	13	0	X
25136	S100A4dC	87	298	87	0	X
15076	LC8 dimer	87	87	87	0	X
17047	holoTrpR dimer A77V variant	87	187	88	0	X
1815	kininogen	87	0	0	0	X
30482	ILE-ASN-LEU-LYS-ALA-LEU-ALA-ALA-LEU-ALA-LYS-LYS-ILE-LEU	86	20	15	0	X
490	desulfatohirudin	86	0	0	0	X
6998	TFSP258	86	43	20	0	X
20019	PND MN	86	0	0	0	X
26943	mmTGF-b2	86	272	86	0	X
17793	Abeta(1-42)	86	75	40	0	X
7340	DAGK homotrimer	86	252	86	0	X
25328	HUA2	86	254	86	0	X
50079	BRCA2 190-284	86	269	88	0	X
16783	Smr dimer	86	244	86	0	X
11589	GB1(i635)	86	162	86	0	X
15213	IntCB-DNA complex	86	220	86	0	X	X
15640	monomerp	86	0	0	0	X
30690	competence-stimulating peptide type 1	86	23	12	0	X
17795	Abeta(1-40)	86	71	39	0	X
25880	N-terminus F2 TnC	86	252	86	0	X
15986	89FnI-collagen complex	86	174	86	0	X
25167	Human Shq1 CS domain	86	261	86	0	X
27645	PDZ PTPN3	86	254	86	0	X
20027	brome mosaic virus protein 1a	86	57	17	0	X
26944	mmTGF-b2-7m	86	271	86	0	X
27434	oat phyA3	86	0	0	0	X
5281	A peptide mimetic of human IFN-beta	86	0	0	0	X
6713	PB1 domain of p40phox	86	269	85	0	X
26575	Gli3_1_90	86	256	86	0	X
7153	Lysozyme Loop	86	0	0	0	X
34284	Temporin-B	86	0	0	0	X
237	basic pancreatic trypsin inhibitor	86	0	0	0	X
36126	designed CAY1	86	0	0	0	X
6818	Alpha-conotoxin MII-6	85	0	0	0	X
26652	Akt_PHD in complex with Calmodulin	85	92	85	0	X
17794	Abeta(1-42)	85	77	39	0	X
34272	temporinB_KKG6A	85	0	0	0	X
25329	HUB2	85	252	85	0	X
19357	Met66 BDNF Prodomain	85	264	85	0	X
5883	eumenine mastoparan	85	0	0	0	X
19358	Val66 BDNF Prodomain	85	263	85	0	X
26529	WHB in complex with UBCH10	85	227	85	0	X
30383	SFTI-HFRW-4	85	43	13	0	X
26527	WHB	85	230	85	0	X
34065	Harzianin HK-VI	85	43	0	0	X
17454	PMP22-TDPC micellar complex	85	171	85	0	X
25529	hylin a1	85	0	0	0	X
15078	LC8 / IC complex	85	154	85	0	X
7387	PIP_18	85	0	0	0	X
5008	p13suc1	85	266	85	0	X
25623	G89A,D91R double mutant of dimeric KaiB	85	271	85	0	X
11410	cDNA FLJ40872 fis, clone TUTER2000283, highly similar to Homo sapiens transformer-2-beta (SFRS10) gene	85	0	85	0	X		X
1145	leghemoglobin II	85	0	0	0	X
4772	RBPMS trimer	85	290	85	0	X
388	phospholipase A2	85	0	0	0	X
25941	retro-KR-12	85	0	0	0	X
16786	cis-conomarphin	85	0	0	0	X
1814	kininogen	85	0	0	0	X
30415	p21	85	0	0	0	X
18280	CD81 LEL	85	257	85	0	X
17010	Tryptophan apo-repressor	85	158	85	0	X
6101	BOC-L-NLE-(D-NLE-L-NLE)5-D-NLE(METHYL)-L-NLE-D-NLE-L-NLE METHYL ESTER	85	15	0	0	X
34060	ACE-AIB-ASN-ILE-ILE-AIB-PRO-LEU-LEU-AIB-PRO-LOH	85	41	0	0	X
30380	Trypsin inhibitor HFRW-1	85	41	15	0	X
15041	13-mer_analogue_of_Prophenin-1_containing_WWW	85	0	0	0	X
6992	peptidoglycan	85	59	13	0
181	leghemoglobin II	85	0	0	0	X
16950	5'-R(GPAPCPAPAPGPUPGPUPCP*A)-3'	85	29	4	10			X
19055	ns5a d2 con1	85	285	85	0	X
34066	ACE-AIB-ASN-ILE-ILE-AIB-PRO-LEU-LEU-AIB-PRO-LOH	85	43	0	0	X
27548	SMAD5-MH1	84	196	84	0	X
15389	HIV fusion peptide	84	0	21	0	X
1698	neurotensin	84	0	0	0	X
20046	RAT IAPP-1-19	84	0	0	0	X
186	plastocyanin	84	0	0	0	X
20126	Alpha-conotoxin Vc1.2	84	41	17	0	X
407	bombesin	84	0	0	0	X
15272	M cono-toxin mr12	84	0	0	0	X
25046	DC-SIGNR CRD apo	84	0	84	0	X
17589	Prp24-RRM3	84	253	84	0	X
27702	bHLHZip domain of Myc	84	168	84	0	X
19701	soluble A 17-34 peptide	84	0	0	0	X
4243	DNA (5'-D(TCCCGTTTCCA)-3')	84	0	0	10		X
17796	Abeta(1-40)	84	74	38	0	X
15506	Colicin_N_T_domain	84	238	84	0	X
27701	bHLHZip domain of Myc	84	255	84	0	X
18102	Cysteine Deleted Analog of Tachyplesin-1	84	0	0	0	X
27706	EZH2 SANT1	84	252	84	0	X
25345	PfCDPK3 CLD(B)	84	245	84	0	X
20017	Temporin-SHb	84	51	0	0	X
15887	minimal complex of Puf60 and U2AF65	84	0	84	0	X
27609	FN III 13 module	84	230	81	0	X
11585	c-Myb R2R3 V103L/C130I	84	70	84	0	X
5708	PTS system, glucose-specific IIA component (E.C.2.7.1.69)	84	0	0	0	X
27703	bHLHZip domain of Myc	84	168	84	0	X
27557	Hup	84	245	84	0	X
18868	Human S100A6 (C3S) with V domain of Receptor for Advanced Glycation End products (RAGE)	84	195	84	0	X
20104	xt-7	84	0	0	0	X
36125	designed AY1C	83	0	0	0	X
2948	ocytocin	83	0	0	0	X
27026	Ascl1 trascription factor	83	237	83	0	X
25409	VG16KRKP, an antimicrobial peptide in SDS	83	0	0	0	X
34320	Urotensin-2 receptor	83	0	0	0	X
15638	Rv1567c monomer	83	166	83	0	X
26803	CEACAM1-Igv homodimer	83	247	83	0	X
21011	PROTEIN	83	0	0	0	X
19064	TIAR RRM2	83	246	83	0	X		X
7154	HELIX E	83	0	2	0	X
30407	Cyclin-dependent kinase inhibitor 1	83	0	0	0	X
25220	RNA duplex	83	28	0	9			X
18537	collagelin	83	41	0	0	X
1516	flavodoxin	83	0	0	0	X
50109	d(GTATGGCCATAC)2 DNA duplex	83	0	0	0		X
4550	5'-D(GPCPGPTPTPAPAPCPGPC)-3'	83	0	0	0		X
4723	acidic peptide	83	47	0	0	X
1562	beta-endorphin	83	0	0	0	X
34337	ACE-ARG-PRO-LEU-ASP-THR-VAL-GLN-ARG-PRO-LYS-GLY-TYR-NH2	83	0	0	0	X
26027	Protein kinase G (PknG) 1-75 natively disordered region	83	170	53	0	X
25408	VG16KRKP, an antimicrobial peptide in D8PG micelles	83	0	0	0	X
16054	5'-D(TPCPGPTPTPGPCP*T)-3'	83	0	0	0		X
30274	cyc-MC12	83	29	14	0	X
26884	rhea F0	83	246	83	0	X
25305	titin M10	83	238	83	0	X
18085	Alvinellacin	83	0	0	0	X
19063	TIAR RRM2	83	252	83	0	X
30381	Trypsin inhibitor 1 HFRW-3	83	41	14	0	X
17590	Anabaena sensory rhodopsin transducer	83	281	83	0	X
16784	conotoxin mr3c	83	0	0	0	X
18854	Human S100A6 C3S	83	194	83	0	X
17130	zif268-12bpDNA	82	175	82	0	X	X
20045	HUMAN IAPP-1-19	82	0	0	0	X
20052	Human Insulin A-chain peptide	82	30	0	0	X
26795	Assembly	82	0	0	0	X
20018	Temporin-SHc	82	52	0	0	X
27786	Complex between RNF168-RING domain and Dm. nucleosome (H2A and H2B isotope labeled)	82	82	0	0	X
20112	Gaq-ct only	82	0	0	0	X
34090	GLY-LEU-PHE-ASP-ILE-VAL-LYS-LYS-VAL-VAL-GLY-ALA-LEU-GLY-NH2	82	49	0	0	X
16800	HCV (Con1) NS5A-D3	82	252	82	0	X
27342	VirB10NT	82	373	82	0	X
5581	Type B lantibiotic mersacidin	82	0	0	0	X
17313	dCstF-50(1-92)	82	259	82	0	X
142	atrial natriuretic factor	82	0	0	0	X
16660	Substance P-NK1 complex	82	0	0	0	X
18773	SCIN-B	82	242	82	0	X
17814	DNA Containing an Aristolactam II-dA Lesion	82	0	0	0		X
11370	Tia1 protein	82	246	82	0	X
7	bombesin	82	0	0	0	X
20115	Substance P	82	0	0	0	X
4235	DNA decamer	82	0	0	9		X
25307	SATB1 homeodomain	82	0	73	0	X
26864	ScribPDZ4withp22peptide	82	0	82	0	X
21008	TemporinL	82	0	0	0	X
26863	ScribPDZ4apo	82	176	82	0	X
19890	CGACTAGTCG dimer	82	0	0	0		X
5252	5'-D(CPCPAPCPGPCPGPTPGPG)-3'	82	0	0	0		X
4835	5'-D(GPCPGPTPTPAPAPCPGPC)-3'	82	0	0	0		X
16166	HCV (Con1) NS5A-D3	82	257	82	0	X
36020	DNA (5'-D(CPCPTPGPCPCPTPG)-3')	82	0	0	0		X
19116	B2709-b2m-TIS complex	82	0	82	0	X
20117	Substance P in DMPC/CHAPS/GM1 bicelles	82	0	0	0	X
11411	cDNA FLJ40872 fis, clone TUTER2000283, highly similar to Homo sapiens transformer-2-beta (SFRS10) gene	82	0	82	0	X		X
20116	Substance P in DMPC/CHAPS bicelles	82	0	0	0	X
19888	CGACGCGTCG with 5,6,7,8-TETRAHYDROBIOPTERIN	82	0	0	0		X
26794	Assembly	82	0	0	0	X
664	cytochrome c	81	0	0	0	X
6815	Retrocyclin-2	81	0	0	0	X
6867	Envelope polyprotein GP160	81	110	38	0	X
970	cytochrome c551	81	0	77	0	X
27681	HSPB1 dimer	81	246	81	0	X
16953	5'-R(GPAPCPAPAPGPUPGPUPCP*A)-3'	81	19	0	8			X
25023	Drosophila ELF domain from FANCL	81	0	74	0	X
2066	barnase	81	0	0	0	X
25901	SUMO-2 bound to phosphorylated RAP80 SIM	81	230	81	0	X
27475	DSS1 monomer	81	244	81	0	X
20016	Temporin-SHa	81	48	0	0	X
27338	CAL PDZ	81	80	81	0	X
34152	Bound DREB2A(255-272)	81	49	15	0	X
26797	Assembly	81	0	0	0	X
27201	PB6 full length	81	202	81	0	X
19273	holo-Ferredoxin	81	241	81	0	X
18326	Ni(II)-bound NmtR homedimer	81	69	81	0	X
16212	5'-D(TPCPGPTPTPGPCP*T)-3'	81	0	0	0		X
18198	NIPP1 monomer	81	167	81	0	X
18177	cytosolic region of human VIMP	81	241	81	0	X
1921	phospholipase A2	81	0	0	0	X
18176	cytosolic region of human VIMP	81	169	81	0	X
1727	alpha-mating factor	81	0	0	0	X
20092	csp	81	0	0	0	X
20114	alpha-conotoxin FI	81	0	0	0	X
25196	haloSRC	81	217	81	0	X
6880	Schistocerca gregaria chymotrypsin inhibitor	81	0	23	0	X
25112	circumsporozoite protein peptide	81	0	0	0	X
25094	EcMazE homodimer	81	0	78	0	X
30382	Trypsin inhibitor HFRW-2	81	35	12	0	X
26792	monomer	81	162	81	0	X
27087	Extracellular Adherence Protein domain 3	81	225	81	0	X
18995	Human S100B and Basic Fibroblast Growth Factor (FGF2) Interaction	81	250	81	0	X
21002	Tryptophan Zipper analogue	81	0	0	0	X
4687	cyclic oligonucleotide d	80	0	0	0		X
25954	Bt1.8 peptide	80	0	0	0	X
26796	Assembly	80	0	0	0	X
27791	Complex between RNF168-RING domain and Dm. histone H2A/H2B dimer (H2A isotope labeled)	80	0	80	0	X
27637	Oleate-free Jug r 3	80	220	80	0	X
27926	Polypeptide chain	80	0	0	0	X
4088	Compstatin	80	0	0	0	X
5588	5'-R(GPGPCP(P5P)P(P5P)PGPCPCP*U)-3'	80	0	0	8			X
27792	Complex between RNF168-RING domain and Dm. histone H2A/H2B dimer (H2B isotope labeled)	80	0	80	0	X
16894	MDM4-nutlin3 complex	80	250	80	0	X
30333	Capped-strapped peptide	80	30	0	0	X
17743	IGFBP-2 N-terminal domain	80	234	80	0	X
26772	Core8	80	243	80	0	X
20084	Dirhodium complex	80	44	0	0	X
27834	OSR1 C-terminal Domain	80	247	80	0	X
1919	phospholipase A2	80	0	0	0	X
25788	Influenza-A M2	80	250	59	0	X
17517	Anticodon Stem-loop of Bacillus subtilis tRNATYR	80	35	0	16			X
27046	cHSP27 dimer	80	249	77	0	X
1723	collagen	80	0	0	0	X
18658	peptide a2N(1-17) from Mus musculus V-ATPase	80	0	0	0	X
15563	USRC	80	266	91	0	X
15759	3F3	80	178	80	0	X
17450	AS1p-TarEc	80	0	0	0	X
30435	Competence-stimulating peptide type 1	80	28	15	0	X
15054	HPRP-180-195 PEPTIDE	80	0	0	0	X
19118	B2709-b2m-pLMP2 complex	80	0	80	0	X
19122	B2705-b2m-pLMP2 complex	80	0	80	0	X
30363	(DCY)N(DVA)(DPR)DVYC(DPR)(DSG)KY(DVA)(DPR)	80	0	11	0	X
27270	pNS5A-D2	80	278	80	0	X
15934	M-crystallin in 6M Gdn-HCl	80	0	80	0	X
17658	stapled peptide SP1	80	0	0	0	X
15918	M-crystallin	80	208	80	0	X
28034	HSP27 alpha-crystallin domain monomer	80	167	80	0	X
18360	IscU(E111A)	80	243	80	0	X
5351	acyl-coenzyme A binding protein	80	223	80	0	X
16165	HCV (JFH1) NS5A-D2	80	277	80	0	X
20086	nociceptin Antagonist	80	0	0	0	X
15367	alpha-RgIA	80	0	0	0	X
18645	PawS Derived Peptide 7 (PDP-7)	80	41	0	0	X
7316	Monomer	80	247	80	0	X
25965	N-terminal extramembrane domain of SH protein	80	56	15	0	X
6258	g3pN1 bound TolAIII	80	225	80	0	X
21056	SFTI-TCTR N12 N14 NMeSer6	79	0	0	0	X
30072	Plastin-2	79	239	80	0	X
19121	B2705-b2m-TIS complex	79	0	79	0	X
26861	MS2	79	232	77	0	X
27927	Polypeptide chain	79	0	0	0	X
30371	GLY-LEU-THR-TRP-PHE-ILE-ASN-LYS-PHE-ARG-ILE-VAL-LYS	79	0	0	0	X
11511	structure specific recognition protein 1	79	225	79	0	X
26617	NaK tetramer	79	199	77	0	X
18992	[2Fe-2S]Fdx	79	174	79	0	X
373	galanin	79	0	0	0	X
36023	Bradykinin-trypsin inhibitor secondary loop chimera	79	0	0	0	X
419	basic pancreatic trypsin inhibitor	79	0	0	0	X
27323	C-terminal domain of Cdc37	79	243	80	0	X
19120	B2705-b2m-pVIPR complex	79	0	79	0	X
18631	N-80 ALR reduced	79	231	77	0	X
25618	N-SasA	79	175	79	0	X
4805	bovine ferric cytochrome b5-N17D in complex with horse heart ferric cytochrome c	79	69	76	0	X
660	flavodoxin	79	0	0	0	X
16055	5'-D(PTPCPGPTPTPGPCPT)-3'	79	0	0	0		X
6237	alpha-conotoxin OmIA	79	0	0	0	X
34056	DNA (5'-D(GPCPGPAPGPGPGPAPGPCPIPAPGPGP*G)-3')	79	0	0	0		X
25303	titin M10-obscurin-Ig1	79	0	79	0	X
34340	LEU-GLY-GLN-GLN-GLN-PRO-PHE-PRO-PRO-GLN-GLN-PRO-TYR	79	0	0	0	X
6245	Gastric inhibitory polypeptide	79	0	0	0	X
15435	RgIA	78	33	11	0	X
18772	SCIN-A	78	240	78	0	X
19364	Nupr1	78	247	86	0	X
17817	GPR	78	198	76	0	X
6720	Alpha-conotoxin PIA	78	0	0	0	X
27461	TGIF1	78	149	78	0	X
25301	OBSC-Ig1	78	263	78	0	X
2063	plastocyanin	78	0	0	0	X
27425	EEE-Bcl-2	78	83	78	0	X
25184	FG-N	78	256	78	0	X
20109	15-residue peptide corresponding to the C-terminal domain of the Gq protein alpha subunit (Gaq-Ct peptide)	78	0	0	0	X
25820	Peptide PG-990	78	0	0	0	X
16785	conotoxin cis-mr3c	78	0	0	0	X
6423	sst1-selective somatostatin (analog 1)	78	0	0	0	X
27263	Translocated actin-recruiting phosphoprotein	78	236	78	0	X
15130	alpha-BTX	78	74	0	0	X
15582	NS3	78	44	0	0	X
15363	mr12	78	0	0	0	X
15267	PW2 in DPC micelles	78	0	0	0	X
25478	IL4pSER411	78	0	0	0	X
7397	M-conotoxin_mr12	78	0	0	0	X
569	lysozyme	78	0	0	0	X
4810	bovine ferric cytochrome b5 in complex with ferric horse heart cytochrome c	78	67	75	0	X
17411	CHIP	78	167	78	0	X
27066	pKNL-1	78	233	78	0	X
11412	cDNA FLJ40872 fis, clone TUTER2000283, highly similar to Homo sapiens transformer-2-beta (SFRS10) gene	78	0	78	0	X		X
21079	Influenza Hemagglutinin Peptide	78	51	0	0	X
27057	N terminal 80 residues of of KNL-1	78	232	78	0	X
2014	prothrombin	77	0	0	0	X
28030	Norovirus P dimers	77	77	0	0	X
17844	IscU:IscS	77	77	77	0	X
26799	Assembly	77	0	0	0	X
27525	hTIM3	77	216	77	0	X
25291	RNA duplex	77	48	0	8			X
5586	5'-R(GPGPCP(P5P)PAPGPCPCP*U)-3'	77	0	0	8			X
5587	5'-R(GPGPCPAP(P5P)PGPCPCP*U)-3'	77	0	0	8			X
5614	5'-R(GPGPCPAPAPGPCPCP*U)-3'	77	0	0	8			X
27533	HLS2 Monomer	77	229	77	0	X
16980	5'-R(CPUPAPGPUPUPAPGPCPUPAPAPCPUPAPG)-3'	77	0	0	0			X
34402	peptide 536_2	77	41	0	0	X
21057	SFTI-TCTR N12 N14	77	0	0	0	X
27127	TopN monomer	77	315	77	0	X
20002	RgIA	77	0	0	0	X
15967	IscU-HscB complex	77	0	77	0	X
25622	D91R single mutant of dimeric KaiB (thioredoxin-like fold)	77	244	77	0	X
16133	TolAIII	77	145	77	0	X
6774	Bombinin H2	77	17	0	0	X
2968	cytochrome c551	77	0	0	0	X
19973	potent antifungal peptide Cm-p5	77	46	11	0	X
2116	troponin I	77	0	0	0	X
50103	Nipah virus phosphoprotein residues 387-479	77	253	77	0	X
2117	troponin I	77	0	0	0	X
27485	[P13A]PeIA	77	0	15	0	X
15704	S100A1 bound to calmodulin	77	0	7	0	X
5985	alpha-Conotoxin GIC	77	0	0	0	X
27061	ACPP-monomer	77	228	77	0	X
19028	MBF1-C	77	238	77	0	X
7177	Alpha-conotoxin Vc1A	76	0	0	0	X
25479	Rad6	76	0	76	0	X
4694	cyclic oligonucleotide d	76	0	0	0		X
26860	MS1	76	231	76	0	X
26798	Assembly	76	0	0	0	X
27322	Cdc37 C-terminal domain	76	226	76	0	X
16700	HSV-1 gH protein, gH626-639 fusion peptide	76	0	0	0	X
15056	Antiamoebin-I (single chain polypeptide without ligands)	76	69	14	0	X
17869	MUC2_Mucin_Domain_Peptide, SUGAR (3-MER)	76	48	8	0	X
971	cytochrome c551	76	0	74	0	X
25304	obscurin Ig1 bound to titin M10	76	0	76	0	X
21009	upain-1	76	37	0	0	X
15273	conopeptide mr12 mutant	76	0	0	0	X
20091	rsv analogue	76	0	0	0	X
34343	LEU-GLY-GLN-GLN-GLN-PRO-PHE-PRO-PRO-GLN-GLN-PRO-TYR	76	0	0	0	X
20013	PFR peptide	76	0	0	0	X
27560	protein-gapped DNA complex	76	76	0	0	X	X
25406	H56P	76	0	76	0	X
25911	VG16KRKP	76	0	0	0	X
27561	protein-gapped DNA-nucelotide complex	76	76	0	0	X	X
20012	PFR peptide	76	0	0	0	X
18771	TatA oligomer	76	31	45	0	X
2070	barnase	76	0	0	0	X
27559	Apo DNA Polymerase beta	76	77	0	0	X
16615	HU-beta2	76	239	76	0	X
16499	(1-77)Apomyoglobin pH 2.40	76	227	76	0	X
2071	barnase	76	0	0	0	X
1920	phospholipase A2	76	0	0	0	X
779	chemotactic protein P7K	76	0	0	0	X
25278	RisS	75	247	77	0	X
15141	TC-1 monomer	75	233	75	0	X
26708	NEMO	75	148	75	0	X
11004	Ebola fusion peptide	75	0	0	0	X
25389	holo-wt-cytc	75	0	75	0	X
15978	Fowlicidin-1	75	0	0	0	X
5032	AFX in complex with DNA	75	147	75	0	X	X
17573	Anticodon Stem-loop (coi6y)	75	38	0	0			X
30607	SER-LYS-TRP-ILE-CYS-ALA-ASN-ARG-SER-VAL-CYS-PRO-ILE	75	0	0	0	X
10133	cytochrome c551	75	0	75	0	X
10135	cytochrome c552	75	0	75	0	X
25737	octyl-tridecaptin A1	75	0	0	0	X
15583	RG16	75	0	0	0	X
26783	UBv	75	231	75	0	X
27715	L4Q12	75	52	28	0	X
26065	PawS Derived Peptide 21 (PDP-21)	75	36	12	0	X
15368	alpha-RgIA	75	0	0	0	X
27324	C-terminal domain of Cdc37	75	163	75	0	X
25390	holo-axxa_cytc	75	0	75	0	X
6598	Prion-like protein doppel	75	0	0	0	X
34357	Protegrin-4	75	0	0	0	X
26784	UBv-APC11	75	220	75	0	X
5254	SS cyclic catestatin 15mer	75	43	0	0	X
16659	pSic1_T90X	75	171	75	0	X
15118	YW12 monomer	75	0	0	0	X
34118	DNA (5'-D(TP(DCP)PCPGPTPTPTPCP(PSC)PGP*T)-3')	75	0	0	0		X
6462	Lactotransferrin	75	0	0	0	X
15436	alpha-RgIA	74	0	0	0	X
25708	Ub S65E	74	45	74	0	X
27527	N-terminal domain of FAT10	74	159	74	0	X
18276	PrgI needle	74	380	85	0	X
19104	MS1	74	225	74	0	X
5110	HCYS BETA3-CYS ANALOGUE OF HIV GP41	74	0	0	0	X
4180	Loop1 from the peripheral subunit binding domain	74	0	0	0	X
34283	Temporin-B	74	0	0	0	X
30158	Phosphocarrier protein NPr (E.C.2.7.11.-)	74	152	74	0	X
6112	p27 kinase inhibitory domain	74	82	74	0	X
16407	W2W11 Monomer	74	0	0	0	X
11074	the F1-ATPase in the F1 complex	74	0	74	0	X
30631	OlvA(BC)	74	0	0	0	X
11553	anoplin	74	42	0	0	X
6775	Bombinin H4	74	17	0	0	X
17455	TrJPMP22-TDPC micellar complex	74	82	74	0	X
10132	cytochrome c551	74	0	74	0	X
11572	Smoothelin CH domain	74	352	125	0	X
5111	HSER (ACE)IWGC(BSE)GKLICTTA analogue of HIV GP41	74	0	0	0	X
18510	m-conotoxin	74	39	0	0	X
302	ribonuclease A	74	0	0	0	X
27250	CW domain of ASHH2 methyltransferase	74	144	74	0	X
26591	PcrG9-76	74	145	75	0	X
19105	NB22	74	223	74	0	X
25470	IL4pSER402	74	0	0	0	X
4359	Pbx1 homeodomain	74	71	74	0	X	X
4483	LCA	74	0	0	0	X
30385	Conotoxin	74	0	0	0	X
15195	M conotoxin Mr3.4	74	0	0	0	X
25669	self complementary Xylonucleic Acid duplex	74	72	0	7			X
19478	TNRC6Bm1	73	139	73	0	X
19501	Novel 4/7-Conotoxin LvIA	73	40	0	0	X
27172	Ubiquitin	73	220	73	0	X
27569	HLS1 Monomer	73	216	73	0	X
5109	DabD (Ace)IWG(DAB)SGKLIDTTA ANALOGUE OF HIV GP41	73	0	0	0	X
18126	Z-L2LBT	73	223	73	0	X
20058	YI12WW	73	0	0	0	X
17367	cytotoxic T-lymphocyte antigen_2 (CTLA-2) like protein, crammer	73	224	74	0	X
25741	octyl-tridecaptin A1 in DPC micelles containing Gram-negative lipid II	73	0	0	0	X
17885	DNA_dodecamer	73	0	0	0		X
34342	LEU-GLY-GLN-GLN-GLN-ALA-PHE-PRO-PRO-GLN-GLN-PRO-TYR	73	0	0	0	X
30252	DNA (5'-D(CPGPCP(8OG)PAPAPTPTP(DMC)PGPCPG)-3')	73	0	0	0		X
26957	ICP4N	73	0	34	0	X
7341	CYCLIC MRIA	73	0	0	0	X
10134	cytochrome c552	73	0	73	0	X
27625	CD44ctail	73	218	73	0	X
27866	homodimer	73	115	55	0	X
4503	alpha-conotoxin_SI	73	37	0	0	X
27069	SPIN	73	192	73	0	X
2858	lysozyme	73	0	0	0	X
18109	MmpS4	73	227	73	0	X
25186	Non-reducible analogues of alpha-conotoxin RgIA: [3,12]-cis dicarba RgIA	73	41	11	0	X
5249	desulforedoxin	73	32	35	0	X
18872	ID3 stem	73	59	0	0			X
750	troponin C	73	0	0	0	X
17698	Monomeric HP67 H41F	73	0	67	0	X
665	cytochrome c	73	0	0	0	X
20015	PND SF2	73	4	0	0	X
25813	Peptide PG-989	72	0	0	0	X
27582	Pdx1 apo form	72	0	72	0	X
5108	DapE : (Ace)IWG(Dnp)SGKLIETTA ANALOGUE OF HIV GP41	72	0	0	0	X
4358	Pbx1 homeodomain	72	71	72	0	X
2067	barnase	72	0	0	0	X
18386	HP1 CSDalpha(109-185)	72	0	70	0	X
27649	hnRNPA2_266-341	72	196	72	0	X
4847	alpha-conotoxin Im1(D5N)	72	0	0	0	X
30630	OlvA(BCS)	72	0	0	0	X
16399	W4W9 Monomer	72	0	0	0	X
6039	BOC-(D-NLE-L-NLE)4-D-NLE(METHYL)-L-NLE-D-NLE-L-NLE METHYL ESTER	72	12	0	0	X
27807	Ubiquitin (dimeric)	72	0	72	0	X
20059	YI12WY	72	0	0	0	X
25187	Non-reducible analogues of alpha-conotoxin RgIA: [3,12]-trans dicarba RgIA	72	32	11	0	X
27638	Oleate-bound Jug r 3	72	128	72	0	X
25174	Non-reducible analogues of alpha-conotoxin RgIA: [2,8]-cis dicarba RgIA	72	37	11	0	X
28077	BRCT	72	220	72	0	X
15413	YW12D	72	0	0	0	X
6422	sst1-selective somatostatin (analog 1)	72	0	0	0	X
15780	5'-R(GPUPCPGPAPGPCPUP*G)-3'	72	52	0	7			X
25814	Peptide PG-990 in DPC micelles	72	0	0	0	X
15898	DNA GAAA tetraloop	72	42	0	7		X
18630	N-80 ALR	72	225	81	0	X
18427	2'F-ANA and ANA self-complementary duplex	72	0	0	0		X
27647	Phosphorylated-KID	72	219	72	0	X
15586	toxin	72	0	0	0	X
1164	dihydrofolate reductase	72	0	0	0	X
19925	DNA dodecamer with A:C mismatch	72	0	0	0		X
15047	denatured ubiquitin	72	71	72	0	X
5140	DDab: (ACE)IWGDSGKLI(DAB)TTA analogue of HIV GP41	72	0	0	0	X
27874	D38A AcpP monomer	72	0	72	0	X
2201	epidermal growth factor	72	0	0	0	X
10062	Nedd8 monomer	72	0	72	0	X
27648	KID	72	226	72	0	X
27872	wt AcpP monomer	72	0	72	0	X
18611	Ubiquitin	72	216	72	0	X
171	azurin	71	0	0	0	X
16529	octanoyl-ACP	71	140	71	0	X
17426	SFTI-OPN	71	0	0	0	X
27633	H1 C-terminal domain	71	0	71	0	X
34274	Temporin-B	71	0	0	0	X
16532	tetradecanoyl-ACP	71	131	71	0	X
26623	integrin beta3 TM/CT	71	183	70	0	X
18381	IscU-HscA	71	219	71	0	X
5476	F1	71	0	0	0	X
17982	C-CaM/Ca complex	71	0	71	0	X
11552	anoplin	71	36	0	0	X
1163	dihydrofolate reductase	71	0	0	0	X
6789	E104Q TR2C	71	0	71	0	X
26703	RDPheH25-117	71	152	70	0	X
16506	monomer	71	136	71	0	X
27820	L-SH3AD20	71	76	71	0	X
5138	EDap (Ace)IWGESGKLI(DNP)TTA analogue of HIV GP41	71	0	0	0	X
17566	TASL1	71	62	0	0			X
16531	dodecanoyl-ACP	71	138	71	0	X
16530	decanoyl-ACP	71	131	71	0	X
34273	temporinB_L1FK	71	0	0	0	X
6891	MrIA	71	0	0	0	X
27923	scAtg3FR(86-159)	71	205	71	0	X
682	ribonuclease A	71	0	0	0	X
30608	Forkhead box M1	71	189	71	0	X
27072	TDP-43 NTD	71	0	69	0	X
27711	CaM-C	71	139	71	0	X
18446	Apoform of Hahellin	71	222	71	0	X
19369	calbindin D9k Apo-form	71	219	71	0	X
6412	fragment 48-61of bovine alpha-hemoglobin	71	0	0	0	X
25779	RRM2 monomer	71	131	71	0	X
25898	Decoralin-NH2	71	0	0	0	X
27805	Ubiquitin (monomeric)	71	0	71	0	X
7017	E104Q TR2C ligated w/ 2 calcium ion	71	0	71	0	X
5980	IRES	71	0	0	0			X
1165	dihydrofolate reductase	71	0	0	0	X
27806	Ubiquitin (monomeric)	71	0	71	0	X
26662	c-Myc	71	235	76	0	X
5137	DapD (Ace)IWG(DAP)SGKLIDTTA analogue of HIV GP41	71	0	0	0	X
27814	SH3A	71	83	71	0	X
26663	c-Myc	71	236	83	0	X
17881	C-CaM apo form	71	0	71	0	X
1167	dihydrofolate reductase	70	0	0	0	X
27810	Ubiquitin (dimeric)	70	0	70	0	X
26547	PLK4-PB3/STIL-CC	70	154	70	0	X
15410	ubi	70	214	70	0	X
27804	Ubiquitin (dimeric)	70	0	70	0	X
6425	sst1-selective somatostatin (analog 1)	70	0	0	0	X
1168	dihydrofolate reductase	70	0	0	0	X
27809	Ubiquitin (monomeric)	70	0	70	0	X
26720	pAsh1 420-500	70	210	73	0	X
19917	DNA dodecamer containing the 5-hydroxycytosine	70	0	0	0		X
2272	immunogenic peptide A12-9	70	0	0	0	X
15529	sr360	70	137	70	0	X
27802	Ubiquitin (monomeric)	70	0	70	0	X
5870	BLEOMYCIN A2	70	0	0	0
5136	EDap (Ace)IWGESGKLI(DAB)TTA analogue of HIV GP41	70	0	0	0	X
17439	ubiquitin	70	135	70	0	X
27808	Ubiquitin (monomeric)	70	0	70	0	X
25141	EL_LovR	70	232	70	0	X
1760	insulin B chain	70	0	0	0	X
27803	Ubiquitin (monomeric)	70	0	70	0	X
30291	Turripeptide	70	25	16	0	X
19186	S72-S107 peptide of 18.5 kDa MBP	70	114	34	0	X
20118	C-terminal domain of the Gq protein alpha subunit in the presence of thromboxane A2 receptor	70	0	0	0	X
4889	c-Src SH3 RLP2 peptide complex	70	0	70	0	X
7152	HELIX D	70	0	0	0	X
16134	TolAIII+tdom	70	148	71	0	X
27512	ub	70	142	70	0	X
4888	c-Src SH3 monomer	70	0	70	0	X
19371	calbindin D9k magnesium bound-form	69	212	69	0	X
27016	Gladiolin binding domain monomer	69	230	69	0	X
27585	EV-CH2-SK	69	150	69	0	X
87	bombesin	69	0	0	0	X
30524	Anti-Staphylococcal peptide DFT503	69	14	13	0	X
5376	complex of transducin peptide and rhodopsin	69	36	10	0	X
6219	Cytotoxic linear peptide IsCT	69	0	0	0	X
16533	hexadecanoyl-ACP	69	0	69	0	X
20124	[113-122]ApoJ	69	0	0	0	X
19370	calbindin D9k calcium bound-form	69	218	69	0	X
25566	PrxQ	69	189	69	0	X
25022	Polyglutamine binding peptide 1 (QBP1)	69	44	11	0	X
30282	RNA (5'-R(GPAPCPCPAPGPCPAP*G)-3')	69	0	0	0			X
50198	VAMP2(1-96) in SH-SY5Y Cells	69	0	69	0	X
25619	N-SasA bound to CI	69	235	69	0	X
25471	IL4pSER415	69	0	0	0	X
21014	conotoxin lt14a	69	0	0	0	X
27850	ENDD G5 monomer	69	213	69	0	X
27671	HuR RRM3	69	0	70	0	X
19922	TDP-43 RRM2	69	221	69	0	X
27120	circAFP	69	216	69	0	X
50199	VAMP2(1-96) in HEK-293T Cells	69	0	69	0	X
18289	antifreeze_peptide_4m	69	0	0	0	X
20057	YI12WF	69	0	0	0	X
17981	C-CaM/PEP-19 complex	69	0	69	0	X
27333	Ataxin7N10Q	69	82	39	0	X
18964	Novel Alpha4/6-Conotoxin TxIC	69	0	0	0	X
18668	FeoA	69	223	69	0	X
1887	gp120	69	0	0	0	X
27883	HMGA1a S64C	68	232	79	0	X
20127	nociceptin Agonist	68	0	0	0	X
50078	BRCA2 53-131	68	215	68	0	X
11554	anoplin	68	0	0	0	X
20060	YI12FF	68	0	0	0	X
5139	DDap (Ace)IWGDSGKLI(DNP)TTA analogue of HIV GP41	68	0	0	0	X
20063	Model Peptide	68	0	0	0	X
5282	5'-D(GPCPGPAPAPGP*C)-3'	68	35	9	6		X
6421	sst1-selective somatostatin (analog 5)	68	0	0	0	X
20101	Substance P	68	0	0	0	X
7294	bacillomycin Lc	68	26	0	0	X
25879	C-terminus F2 TnC	68	190	68	0	X
5488	Tachyplesin I, phenylalanine mutant	68	0	0	0	X
36038	analogue peptide VG13P	68	0	0	0	X
11551	anoplin	68	36	0	0	X
19679	CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE6/7	68	39	9	0	X
17156	Thiostrepton(red,14)	68	71	10	0	X
26624	integrin beta1 TM/CT	68	188	68	0	X
6887	hormaomycin	68	55	0	0	X
7278	iG80b ecRNH	67	0	67	0	X
26684	Chica	67	199	67	0	X
17710	DsbA and DsbB	67	1228	288	0	X
27023	Ascl1 trascription factor	67	212	67	0	X
27836	MT Domain	67	118	67	0	X
250	alpha-conotoxin G1	67	0	0	0	X
25845	CYSTEIN KNOT WITH 2FP INTEGRIN AVB6 CANCER RECOGNITION SITE	67	0	0	0	X
19102	M-2 Branch Mini-M Conotoxins	67	36	0	0	X
7016	E104Q TR2C ligated w/ 1 calcium ion	67	0	67	0	X
18493	DsbB C41S	67	552	125	0	X
6220	Cytotoxic linear peptide IsCT	67	0	0	0	X
5905	Sac7d	67	13	66	0	X
17153	thiostrepton	67	71	11	0	X
25844	CYSTEIN KNOT WITH INTEGRIN AVB6 CANCER RECOGNITION SITE	67	0	0	0	X
26719	Ash1 420-500	67	198	70	0	X
185	plastocyanin	67	0	0	0	X
27025	Ascl1 trascription factor	67	208	67	0	X
30591	myosin-VI	67	118	67	0	X
15629	complex pyoverdine PvdI-Ga(III)	67	41	10	0	X
27357	AC12	67	0	0	0	X
19556	C-terminally encoded peptide of the model plant host Medicago truncatula - CEP1	67	25	14	0	X
20047	fusionpeptide	67	0	0	0	X
27684	CXCL3	67	130	67	0	X
1817	tubulin-beta	67	0	0	0	X
18395	DsbB	67	132	67	0	X
17760	p53 N-terminus	67	251	67	0	X
18940	S2	67	0	0	0	X
30362	H(DPR)(DVA)CIP(DPR)E(DLY)VC(DGL)	67	0	8	0	X
34265	RNA (5'-R(UPGPGPUPGPGP*U)-3')	67	44	0	7			X
19573	XANTHOMONIN II	67	0	0	0	X
5908	Sac7d V30I monomer	67	0	66	0	X
18371	EB1 C-terminal domain	67	177	67	0	X
27480	teixobactin:lipid II complex in DPC micelles	66	51	15	0	X
7311	Rat Islet Amyloid Polypeptide	66	103	33	0	X
5651	Txk SH3 domain	66	0	61	0	X
1651	lysozyme	66	0	0	0	X
27478	teixobactin in DPC micelles	66	42	12	0	X
27584	CH2 wild type	66	152	66	0	X
5542	Penetratin	66	0	0	0	X
27618	intrinsically disordered protein	66	204	66	0	X
19663	Somatostatin-14	66	0	0	0	X
1650	lysozyme	66	0	0	0	X
6426	sst1-selective somatostatin (analog 1)	66	0	0	0	X
25626	G88A,D90R double mutant of KaiB	66	208	66	0	X
26599	THAP11 coiled-coil dimer	66	130	66	0	X
15099	CM15 in DPC micelles	66	26	0	0	X
26604	ubiquitin (microcrystal)	66	203	66	0	X
18397	GB1	66	186	61	0	X
16854	eye lens fragment	66	0	0	0	X
16893	MDM4 N-terminal domain	66	215	66	0	X
4108	CspA	66	123	66	0	X
50093	Holo protein	66	137	66	0	X
4846	alpha-conotoxin Im1(R7L)	66	0	0	0	X
15544	YW12D_SDS	66	0	0	0	X
30167	Chi-conotoxin-like PnMRCL-013	66	0	0	0	X
17642	htt17	66	0	0	0	X
15156	GB1	66	274	68	0	X
1514	tolaasin	66	0	0	0	X
25399	Medin	66	144	48	0	X
18077	AbpSH3-Srv12	65	0	65	0	X
25092	MazE-DNA binding	65	0	61	0	X	X
18069	AbpSH3-ArkA_P(0)A	65	0	65	0	X
5890	Hylaseptin P1	65	0	0	0	X
18078	AbpSH3-Srv17	65	0	65	0	X
17872	MUC2_Mucin_Domain_Peptide	65	43	7	0	X
17630	JAZ ZF1	65	72	64	0	X
18070	AbpSH3-ArkA_P(-1)A	65	0	65	0	X
27603	Cse4 protein	65	4	65	0	X
17009	mqsa_cterm	65	288	65	0	X
18055	AbpSH3-ArkA	65	0	65	0	X
1202	myoglobin	65	0	0	0	X
7317	Monomer	65	195	65	0	X
20033	dicarba-ImI	65	34	10	0	X
15095	Alpha-Syn12 bound with Synphilin-1	65	0	0	0	X
17870	MUC2_Mucin_Domain_Peptide, SUGAR (2-MER)	65	37	6	0	X
18076	AbpSH3-Sjl17	65	0	65	0	X
18056	AbpSH3-ArkB	65	0	65	0	X
18057	AbpSH3-ArkA_H(-6)A	65	0	65	0	X
7388	pip17	65	0	0	0	X
18065	AbpSH3-ArkA12	65	0	65	0	X
2957	lysozyme	65	0	0	0	X
18059	AbpSH3-ArkA_K(-3)A	65	0	65	0	X
6424	sst1-selective somatostatin (analog 1)	65	0	0	0	X
6246	daptomycin	65	0	0	0	X
18054	AbpSH3	65	0	65	0	X
27953	PFE0055c	65	132	65	0	X
18062	AbpSH3-ArkA_K(3)A	65	0	65	0	X
17983	C-CaM/PEP-19 complex	65	0	65	0	X
18058	AbpSH3-ArkA_SI	65	0	65	0	X
26810	LIN54	65	176	62	0	X
18071	AbpSH3-Prk17	65	0	65	0	X
18072	AbpSH3-ArkA15_H(-6)A_K(-8)A	65	0	65	0	X
18066	AbpSH3-ArkA_P(-4)A	65	0	65	0	X
666	cytochrome c	64	0	0	0	X
17155	Thiostrepton(epi,9)	64	68	9	0	X
26716	GB1	64	56	60	0	X
10014	helix6 in SRP RNA	64	0	0	0			X
18025	hUBR2 ubr-box	64	0	64	0	X
11453	UHRF1 atypical PHD finger	64	122	64	0	X
25078	CSD1-SXL-18-mer msl2 mRNA	64	91	62	0	X
1347	dihydrofolate reductase	64	0	0	0	X
27775	HLS3	64	188	64	0	X
17205	Cox17y monomer reduced	64	201	67	0	X
4420	ALPHA-CONOTOXIN IM1	64	0	0	0	X
18067	AbpSH3-ArkA_P(2)A	64	0	64	0	X
19451	PNUTS	64	114	64	0	X
18075	AbpSH3-Scp17	64	0	64	0	X
4399	ImI	64	0	0	0	X
934	troponin C	64	0	0	0	X
18064	AbpSH3-ArkA_L(-7)V	64	0	64	0	X
1348	dihydrofolate reductase	64	0	0	0	X
18063	AbpSH3-ArkA_L(-7)A	64	0	64	0	X
21007	alpha-conotoxin ImI Cystathionine 1-3	64	0	0	0	X
17644	htt17	64	0	0	0	X
30168	Chi-conotoxin-like PnMRCL-013	64	0	0	0	X
18068	AbpSH3-ArkA_P(2)V	64	0	64	0	X
27302	Radical-Induced Cell Death1 499-572	64	199	64	0	X
26785	APC11-UBv	64	198	64	0	X
18074	AbpSH3-Scp12	64	0	64	0	X
27449	AV Rop	63	123	63	0	X
4845	alpha-conotoxin Im1(R11E)	63	0	0	0	X
18073	AbpSH3-PRR	63	0	63	0	X
19335	5P12-RANTES-E66S	63	184	68	0	X
27709	MARCH9-TM	63	121	63	0	X
21006	alpha-conotoxin ImI Cystathionine 2-4	63	0	0	0	X
19796	hinge monomer	63	174	61	0	X
15214	MxiH	63	50	63	0	X
1520	ubiquitin	63	0	0	0	X
1660	adrenodoxin	63	0	0	0	X
27543	MARCH9-TM	63	187	63	0	X
26913	HET-s(218-289)	63	98	48	0	X
422	alpha-conotoxin G1	63	0	0	0	X
5737	5'-D(TPTPAPGPGPGP*T)-3'	63	0	0	0		X
17141	HYL1 second dsRBD	63	195	63	0	X
19949	MBP S38-S107 peptide in the presence of Fyn-SH3	63	164	62	0	X
19948	S38-S107 peptide of 18.5 kDa MBP	63	164	62	0	X
19932	peptide ImI1	63	0	0	0	X
27555	Rip2Card	63	185	63	0	X
17154	Thiostrepton(oxi,9)	62	68	9	0	X
50100	Nipah virus phosphoprotein residues 173-240	62	195	62	0	X
6411	amidated fragment 48-61 of bovine alpha-hemoglobin	62	0	0	0	X
19674	CLAVATA encoded peptide of Arabidopsis thaliana - AtCLE10	62	38	11	0	X
477	fibrinogen	62	0	0	0	X
5910	Sso7d monomer	62	0	62	0	X
25364	SLBP/RNA	62	148	62	0	X		X
27451	IVVA Rop	62	183	62	0	X
15443	cC5aR-pa	62	0	0	0	X
1323	cytochrome b5	62	0	0	0	X
5613	bhpW, disulfide cyclized beta-hairpin peptide	62	0	0	0	X
7011	13-mer peptide from Thermonuclease (E.C.3.1.31.1)	62	43	0	0	X
16158	beta1D integrin tail	62	0	55	0	X
5909	Sso7d monomer	62	10	62	0	X
16750	c-src SH3	62	127	62	0	X
20009	CLN025	62	0	0	0	X
7391	GCN4	62	94	32	0	X
20107	conotoxin ImI analogue	62	0	0	0	X
15397	ACTR	62	182	62	0	X
21019	Chikungunya Virus Fusion Peptide	61	0	0	0	X
28060	HP1	61	187	61	0	X
27288	RAP74-CTD	61	188	61	0	X
27203	Dm. Par3 PDZ2 domain	61	129	61	0	X
27450	WT Rop	61	184	61	0	X
2078	epidermal growth factor	61	0	0	0	X
27884	CK2 HMGA1a S64C	61	216	73	0	X
19678	CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE5	61	32	13	0	X
27572	Nisin LipidII Pore	61	130	33	0	X
25620	G89A single mutant of dimeric KaiB	61	199	61	0	X
19675	CLAVATA encoded peptide of Arabidopsis thaliana - AtCLE44	61	29	10	0	X
27992	MYB28 residues 116-197	61	190	63	0	X
25362	Y171W mutant of Adenylate Kinase in complex with Ap5a for state b	61	0	61	0	X
19471	WG12_LPS	61	0	0	0	X
1876	micrococcal nuclease	61	0	0	0	X
19769	Z-L2LBT variant A	61	161	61	0	X
19228	Pdx1	61	184	61	0	X
290	troponin C	61	0	0	0	X
34203	Kininogen-1	61	44	6	0	X
25107	DNA-quercetin	61	0	0	0		X
25084	Cdc5-D3 monomer	60	184	60	0	X
27327	Yes1-SH3 (Yes1 kinase SH3 domain)	60	117	60	0	X
26955	SH3	60	180	60	0	X
5543	Penetratin(W48F,W56F)	60	0	0	0	X
17326	RP1	60	54	0	0			X
30347	D-PHE-ABZ-PHE-D-PHE-ASN-LYS-TYR-VAL-ORN-LEU	60	0	0	0	X
20085	SFT-L1	60	0	0	0	X
15515	daptomycin in DHPC	60	0	0	0	X
18061	AbpSH3-ArkA_K(-3)V	60	0	60	0	X
19649	CD79a cytosolic domain phosphorylated	60	173	60	0	X
16041	FLNCCPGCCMEP_ReAsH_motif	60	0	0	0	X
19580	PAP262-270 in SDS micelles	60	0	0	0	X
19648	CD79a cytosolic domain phosphorylated	60	172	60	0	X
6105	HCO-(D-Nle-L-Nle)3-D-MeNle-L-Nle-D-Nle-L-Nle-OMe	60	10	0	0	X
17377	Sans CEN2	60	0	0	0	X
20032	GBAP	60	0	10	0	X
6420	Daptomycin	60	0	0	0	X
18060	AbpSH3-ArkA_K(-3)R	60	0	60	0	X
18871	chaperone in type III secretion system	60	203	60	0	X
19645	CD79a cytosolic domain	60	173	60	0	X
19336	5P12-RANTES-E66S	60	181	60	0	X
20079	rhodopsin-jue11-complex	60	0	0	0	X
27972	VSV Phosphoprotein 35-106	60	114	60	0	X
6145	3LII in DMSO	60	0	0	2	X
30358	(DPR)PY(DHI)PKDL(DGN)	59	0	0	0	X
21065	Beta-Pro ZZZ	59	38	0	0	X
18494	TM0026 monomer	59	171	59	0	X
17726	conotoxin pc16a	59	33	0	0	X
17559	FZL2 (monomer)	59	59	0	0			X
17915	SH3	59	114	59	0	X
4609	T-tetrad telomere repeats	59	0	0	0		X
2457	proteinase inhibitor IIB	59	0	0	0	X
6106	60S acidic ribosomal protein P2	59	0	0	0	X
19644	CD79a cytosolic domain	59	170	59	0	X
30305	Protein kinase C alpha type (E.C.2.7.11.13), V5-pHM peptide	59	0	0	0	X
27499	sfrs1-rrm1	59	110	56	0	X
27952	PFA0660w	59	123	59	0	X
27272	SGTA_Cter	58	173	53	0	X
19555	C-terminally encoded peptide of the plant parasitic nematode Meloidogyne hapla - CEP11	58	26	12	0	X
17453	ccl5	58	0	59	0	X
1324	cytochrome b5	58	0	0	0	X
16292	2:1 complex	58	0	0	0		X
15031	alpha-conotoxin BuIA	58	0	0	0	X
6897	Alpha-conotoxin ImI	58	0	0	0	X
26959	CzrA homodimer	58	58	0	0	X
18643	PawS Derived Peptide 4 (PDP-4)	58	21	0	0	X
5608	Contryphan-Vn	58	34	6	0	X
26914	UBAP1	58	48	0	0	X
26592	LcrG	58	121	58	0	X
27549	TDP-43 RRM2	58	121	58	0	X
6896	Alpha-conotoxin ImI	58	0	0	0	X
4490	alpha-amylase inhibitor	58	0	0	0	X
30436	SH3 and multiple ankyrin repeat domains protein 1	58	174	58	0	X
25181	Hepatitis C Virus p7	58	61	58	0	X
34019	Amyloid beta A4 protein	58	35	8	0	X
27028	CzrA homodimer	58	58	0	0	X
1154	metallothionein-2	58	0	0	0	X
19103	ar1248	58	36	0	0	X
516	growth hormone releasing factor	58	0	0	0	X
27759	NSL2	57	0	14	0	X
18928	T638E/S657E V5 domain of Protein Kinase C alpha	57	188	57	0	X
20081	complex BK-PGG	57	0	0	0	X
15866	CIN85 Sh3-C domain/ubiquitin complex	57	116	57	0	X
5201	ION-SELECTIVE LIGAND A1	57	21	0	0	X
27479	teixobactin in solution	57	39	7	0	X
11360	Zinc finger CW-type PWWP domain protein 1	57	0	57	0	X
25521	Neuromedin C in 25% TFE	57	34	12	0	X
18927	V5 domain of Protein Kinase C alpha	57	188	57	0	X
97	metallothionein-2	57	0	0	0	X
27817	SH3AD20	57	61	57	0	X
26954	Fyn SH3 V39V/N53P/V55L delta56	57	171	57	0	X
25525	Neuromedin C in presence of SDS micelles	57	34	12	0	X
1346	dihydrofolate reductase	57	0	0	0	X
21066	Beta-Pro ZEZ	57	37	0	0	X
25519	Neuromedin C in water	57	34	12	0	X
11359	Zinc finger CW-type PWWP domain protein 1	57	0	57	0	X
30361	(DAL)Q(DPR)(DCY)(DLY)DS(DTY)(DCY)P(DSN)	57	0	0	0	X
17427	p21 kinase inhibitory domain bound to Cdk2 and Cyclin A	57	92	57	0	X
25520	Neuromedin C in 10% TFE	57	34	12	0	X
50105	Nipah virus phosphoprotein residues 588-650	57	183	58	0	X
5574	KASSININ	57	0	0	0	X
17560	FZL4 (monomer)	57	56	0	0			X
20122	CCAP-vil	57	0	0	0	X
30359	AAR(DVA)(DPR)R(DLE)(2TL)PE	57	0	0	0	X
15122	surfactin	57	0	7	0	X
5133	system_attm	57	56	57	0	X
25759	Quercetin complexed with c-myc G-quadruplex DNA	57	0	0	0		X
25726	R4 peptide	57	0	0	0	X
21067	Beta-Pro ZZE	57	32	0	0	X
26632	Protein G Domain Beta-1 Sequence H	57	167	57	0	X
11361	Zinc finger CW-type PWWP domain protein 1	57	0	57	0	X
1722	collagen	57	0	0	0	X
30346	D-PHE-2-ABZ-PHE-D-PHE-ASN-GLN-TYR-VAL-ORN-LEU	57	0	0	0	X
5403	trp RNA-binding attenuation protein undecamer	57	161	57	0	X
25009	Cysteine Deleted Protegrin-1 (CDP-1): rr14	57	0	0	0	X
1166	dihydrofolate reductase	56	0	0	0	X
25524	Neuromedin C in 90% TFE	56	34	11	0	X
25523	Neuromedin C in 60% TFE	56	34	11	0	X
26640	alpha B crystallin	56	138	55	0	X
25522	Neuromedin C in 40% TFE	56	33	11	0	X
15980	Fowlicidin-1	56	0	0	0	X
25393	IST1 peptide	56	184	56	0	X
1826	Anantin-A peptide	56	0	0	0	X
30357	(DAR)Q(DPR)(DGN)R(DGL)PQ	56	0	9	0	X
5925	SH2-SH3 adapter protein drk	56	56	56	0	X
15460	AK12	56	0	0	0	X
26069	HPV 16 E7 CR3	56	108	37	0	X
11358	Zinc finger CW-type PWWP domain protein 1	56	0	56	0	X
27538	pT-C-H1.0	56	288	98	0	X
19467	PKCalpha C-term	56	0	0	0	X
26630	Protein G Domain Beta-1 Wild-Type	56	165	56	0	X
969	cytochrome c551	56	0	56	0	X
30438	SH3 and multiple ankyrin repeat domains protein 3	56	173	56	0	X
19334	Temporin-1 Ta in lipopolysaccharide micelles	56	0	0	0	X
16843	Abp1p	56	99	57	0	X
2275	cobratoxin	56	0	0	0	X
1773	lysozyme	55	0	0	0	X
6941	XAO	55	28	12	0	X
12026	NZF domain in linear di-ubiquitin-bound form	55	166	55	0	X
6417	hormaomycin	55	55	0	0	X
30437	SH3 and multiple ankyrin repeat domains protein 2	55	173	55	0	X
20022	metastin analog	55	0	0	0	X
17679	JAZ ZF3	55	113	55	0	X
18688	gp78 RING bound to Ube2g2:G2BR	55	0	55	0	X
5575	Eledoisin	55	0	0	0	X
1772	lysozyme	55	0	0	0	X
20113	Temporin-SHf	55	29	0	0	X
18385	H3(1-59)	55	0	55	0	X
4357	Pbx1 homeodomain	55	55	55	0	X
16291	2:1 complex	55	0	0	0		X
21068	Beta-Pro ZZEZ	55	23	0	0	X
15441	IC74	55	111	55	0	X
18929	V5 domain of Protein Kinase C alpha	55	176	55	0	X
27537	C-H1.0	55	284	95	0	X
11542	yeast Tim50 PBD	55	160	55	0	X
19140	R6W-DynA	55	0	0	0	X
19469	WK10_LPS	55	0	0	0	X
27108	NOX1 ativator	55	116	57	0	X
27145	chromatin-associated protein swi6	55	106	55	0	X
410	basic pancreatic trypsin inhibitor	55	0	0	0	X
27818	L-SH3A	54	62	54	0	X
4614	5'-r(GPCPAPGPGPCPGPUPGPC)-3'	54	0	0	0			X
6107	60S acidic ribosomal protein P2	54	0	0	0	X
34319	Urotensin-2	54	0	0	0	X
12033	c-MYC	54	175	54	0	X
16287	2:1 complex	54	0	0	0		X
17875	MUC2_Mucin_Domain_Peptide	54	42	6	0	X
18918	NTL9_V3AI4A	54	160	54	0	X
17871	Mucin Glycoprotein Recognition	54	34	6	0	X
27821	SH3AD20-L	54	59	54	0	X
15620	single polypeptide chain	54	38	0	0	X
28033	LC8/QT2-4 complex	53	149	53	0	X
30360	E(DVA)DP(DGL)(DHI)(DPR)N(DAL)(DPR)	53	0	0	0	X
36062	Synaptotagmin-like protein 4	53	0	0	0	X
25082	Fyn SH2 domain in complex with the natural inhibitory phosphotyrosine peptide	53	0	0	0	X
19677	CLAVATA-like encoded peptide of Meloidogyne hapla - MhCLE4	53	23	11	0	X
25988	PHD domain of human BAZ2B	53	160	53	0	X
5478	F1tbp	53	0	0	0	X
15621	single polypeptide chain	53	37	0	0	X
30283	RNA (5'-R(GPAPCPCPUPGPCPUPGPCPUPGPGPUP*C)-3')	53	0	0	0			X
26754	PHD domain of human BAZ2A	53	160	53	0	X
18420	magainin	53	0	0	0	X
5694	chignolin	53	0	0	0	X
1181	hemoglobin alpha chain	53	0	0	0	X
5518	Turkey Ovomucoid Third Domain	52	51	52	0	X
6168	cyclic hexapeptide RR(NAL)(NAL)RF	52	0	0	0	X
17626	Act2-EF34-palladin complex	52	103	54	0	X
1712	myosin	52	0	0	0	X
50106	Grb2 N-SH3 - Sos1X' conjugate	52	151	52	0	X
11021	CLN025	52	0	0	0	X
18930	T638E/S657E V5 domain of Protein Kinase C alpha, DPV	52	162	52	0	X
19595	oxytocin	52	24	0	0	X
26998	Rabbit Prp 90-231	52	0	52	0	X
6791	Dip-AST5	52	30	0	0	X
338	basic pancreatic trypsin inhibitor	52	0	52	0	X
20121	tubulysin	52	0	0	0	X
25	hemoglobin A alpha chain	52	0	0	0	X
6511	peptide SD	52	0	0	0	X
5519	Indian Peafowl Ovomucoid Third Domain	52	51	52	0	X
27984	Cezanne UBA domain	52	102	52	0	X
485	basic pancreatic trypsin inhibitor	52	0	52	0	X
6169	cyclic hexapeptide KKWWKF	52	0	0	0	X
5923	T22G mutant of the N-terminal SH3 domain of the Drosophila protein drk	51	51	51	0	X
5520	Turkey Ovomucoid Third Domain	51	0	51	0	X
4464	contryphan-Sm	51	0	0	0	X
27819	SH3A-L	51	60	51	0	X
6170	cyclic hexapeptide RRYYRF	51	0	0	0	X
19414	PaDsbA	51	42	0	0	X
6041	c-RW	51	0	0	0	X
1152	adrenodoxin	51	0	0	0	X
4468	contryphan-Sm	51	0	0	0	X
25840	Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dC	51	0	0	0		X
50104	Grb2 N-SH3 - Sos1C complex	51	149	51	0	X
19540	MyT1 F4F5 - DNA complex	51	115	51	0	X	X
11543	[G5,T7,S9]-oxytocin	51	21	0	0	X
3471	parvalbumin	51	0	0	0	X
17873	Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat	51	32	6	0	X
27562	GB1	51	149	51	0	X
4169	pyoverdin G4R	51	0	0	0	X
25621	D91R single mutant of dimeric KaiB	51	168	51	0	X
18617	G8A mutant of the influenza hemagglutinin fusion peptide	51	23	21	0	X
5727	His31Ala-brazzein	50	49	50	0	X
34467	human telomeric G-quadruplexes	50	0	0	0		X
27878	K1-K9 fragments	50	60	50	0	X
5521	Indian Peafowl Ovomucoid Third Domain	50	0	50	0	X
139	enterotoxin	50	0	0	0	X
17195	UBA monomer	50	155	50	0	X
5724	Arg43Ala-brazzein	50	49	50	0	X
50120	EB1linker-4D	50	116	51	0	X
30443	Antifungal peptide	50	22	9	0	X
21062	conotoxin Im10A	50	0	0	0	X
5725	Ala2insertion-brazzein	50	50	50	0	X
21069	Beta-Pro ZEZZ	50	23	0	0	X
50119	EB1linker-wt	50	174	48	0	X
27828	d(CGATATCG)2 : free form	50	0	0	0		X
16290	1:1 complex	50	0	0	0		X
5728	Arg33Ala-brazzein	50	49	50	0	X
2231	lysozyme	50	0	0	0	X
1724	collagen	50	0	0	0	X
25572	Dad2	50	115	49	0	X
19227	Pdx1	50	161	50	0	X
5726	Asp50Ala-brazzein	50	49	50	0	X
27763	FoxM1 TAD	50	185	49	0	X
27764	Phosphorylated FoxM1 TAD	50	142	49	0	X
5723	wt brazzein	50	50	50	0	X
17874	MUC2_Mucin_Domain_Peptide	50	40	5	0	X
18748	Grb2 C-terminal SH3 domain	50	158	50	0	X
27134	C-terminal domain of MSP2	50	98	50	0	X
25222	Phospholamban	49	0	49	0	X
6408	Metal-responsive element-binding transcription factor-1	49	160	49	0	X
17441	LAK160-P710	49	0	0	0	X
18952	Phospholamban	49	0	49	0	X
6006	CCAP	49	0	0	0	X
27341	ICP27 103-155	49	147	49	0	X
5562	CCGCGG	49	0	0	0		X
25011	Cysteine Deleted Protegrin-1 (CDP-1): rr11	49	0	0	0	X
1692	synthesized signal peptide	49	0	0	0	X
17438	LAK160-P7	49	0	0	0	X
27630	FBP21(326-376)/Brr2-CSec63 complex	49	133	49	0	X
16288	1:2 complex	49	0	0	0		X
25625	G89A,D91R double mutant of KaiB bound to CI	49	155	49	0	X
6521	p53 tetramer	49	55	49	0	X
17442	LAK160-P12	49	0	0	0	X
27362	Abl1 SH3 pY89pY134 monomer	49	0	49	0	X
18243	alpha-synuclein fibrils	49	127	48	0	X
30503	Envelope glycoprotein gp160	49	88	49	0	X
27616	CBX8 CD	49	101	49	0	X
34198	CYS-ARG-PRO-LEU-TRP-THR-ALA-CYS-GLY	49	0	0	0	X
16710	spider roll	49	151	49	0	X
3472	parvalbumin	49	0	0	0	X
6522	Mutant p53 tetramerization domain (p53tet-R337H)	49	54	49	0	X
4406	contryphan-R	49	0	0	0	X
6569	Measles virus P protein (amino acids 457-507) bound to the measles virus N protein (amino acids 477-505)	49	0	49	0	X
26676	CP1	48	23	12	0	X
19651	CD79b cytosolic domain denatured	48	139	48	0	X
6568	Measles virus P protein (amino acids 457-507)	48	0	49	0	X
34165	ACE-ARG-ALA-(D)CYS-ARG-BNA-HIS-PEN	48	0	0	0	X
25173	N-terminal dopmain of NikR	48	143	49	0	X
26793	monomer	48	85	48	0	X
21047	AIP-IV peptide	48	0	0	0	X
21025	MDCSGCSRPG + Zn acidic	48	0	0	0	X
16289	d(GCTATAGC)2	48	0	0	7		X
21023	MDCSGCSRPG	48	0	0	0	X
9500	troponin complex	48	92	48	0	X
15832	N-terminal domain of the Y5 receptor	48	0	48	0	X
15768	HCV-C82 monomer	48	157	48	0	X
18148	VEGFR-2	48	0	0	0	X
21022	MDCSGCSRPG	48	0	0	0	X
34017	ACE-ARG-ALA-DCY-ARG-PHE-PHE-CYS	48	0	0	0	X
15767	HCV-C82 monomer	48	157	48	0	X
16282	d(AGAGCTCT)2	48	0	0	7		X
17401	5'-R(CPCPGPCPUPGPCPGP*G)-3'	48	0	0	0			X
26594	hTRF1 monomer	48	141	48	0	X
5477	tF1	48	28	0	0	X
19655	CD79b cytosolic domain phosphorylated	48	139	48	0	X
25915	Photoswitchable G-quadruplex	48	34	0	0		X
19650	CD79b cytosolic domain	48	139	48	0	X
15398	CBP	48	105	48	0	X
18884	CD79b	48	145	48	0	X
16487	HCV-1b Core+1/S	48	157	48	0	X
6728	potassium channel KcsA	48	46	0	0	X
21024	MDCSGCSRPG bound to Cu	48	0	0	0	X
5479	sF1	48	0	0	0	X
21028	MDCSGCSRPG + Zn acidic	48	0	0	0	X
18199	DNA_1	48	0	0	0		X
19174	Regulatory Domain of Human Brain Carnitine Palmitoyltransferase 1	47	91	47	0	X
27948	bL12 dimer	47	0	47	0	X
5812	GGYGGGRRDG monomer	47	0	0	0	X
442	trp repressor	47	0	0	0	X
1153	adrenodoxin	47	0	0	0	X
21026	MDCSGCSRPG + Zn basic	47	0	0	0	X
2232	lysozyme	47	0	0	0	X
15107	GPM12	47	0	0	0	X
19141	Dynorphin A, L5S	47	0	0	0	X
5811	GGRRDGGYGG monomer	47	0	0	0	X
243	cytochrome c	47	0	0	0	X
21027	MDCSGCSRPG + Zn basic	47	0	0	0	X
20061	GG8WF	47	0	0	0	X
27227	mSin3B PAH1	47	0	46	0	X
19656	CD79b cytosolic domain phosphorylated	47	138	47	0	X
674	glucagon	47	0	0	0	X
18889	CD3e	47	152	47	0	X
26573	TBD	47	142	47	0	X
27629	FBP21(326-376)	47	138	47	0	X
5489	Tachyplesin I, alanine mutant	47	0	0	0	X
19933	novel human tachykinin Hemokinin-1 (hHK1)	46	0	0	0	X
15968	Swa2p	46	93	46	0	X
15589	Sperm Whale apoMb(1-77) complex with DnaK-beta	46	47	46	0	X
27580	VapB46	46	148	46	0	X
27421	Human Myc T400D, N353 to A399	46	100	46	0	X
27704	bHLHZip domain of Myc	46	121	46	0	X
26565	Notch1 transmembrane segement	46	137	46	0	X
4469	Des[Gly1]-contryphan-R	46	0	0	0	X
7295	Synthetic Cyclo Peptide (SCP)	46	0	0	0	X
4864	Turkey Ovomucoid Third Domain	46	96	46	0	X
16286	d(CGAGCTCG)2	46	0	0	7		X
6870	Dip-AST8: 9 residue peptide (GGSLYSFGL-NH2)	46	27	0	0	X
1477	tissue plasminogen activator	46	0	0	0	X
236	basic pancreatic trypsin inhibitor	46	0	0	0	X
25012	Cysteine Deleted Protegrin-1 (CDP-1): lr10	46	0	0	0	X
16223	5'-D(DCPDTP(FAG)PDA)-3'	46	0	0	0		X
30355	DDPT(DPR)(DAR)Q(DGN)	46	25	9	0	X
16400	ABC collagen heterotrimer	46	18	5	0	X
27047	Hamster PrP 90-231	46	0	46	0	X
6792	Dip-AST8	46	27	0	0	X
18949	GroES	45	0	43	0	X
30147	Neurogenic locus notch homolog protein 1	45	137	46	0	X
20128	conotoxin qc16a	45	0	0	0	X
27414	Human Myc N353 to A399	45	94	45	0	X
27628	SIRT1_183-233	45	109	45	0	X
30446	Hexapeptide HRFLRH	45	28	0	0	X
30341	ASP-LEU-PHE-VAL-PRO-PRO-ILE-ASP	45	26	0	0	X
27416	Human Myc S373D/T400D, N353 to A399	45	94	45	0	X
4865	Turkey Ovomucoid Third Domain bound to bovine chymotrypsin Aa	45	85	46	0	X
27993	MYB29 residues 118-178	45	151	45	0	X
1182	hemoglobin alpha chain	45	0	0	0	X
25707	Ub in complex with parkin R0RBR	45	45	0	0	X
17631	JAZ ZF2	45	80	45	0	X
21038	AIP-III_DL7 peptide	45	0	0	0	X
27422	Human Myc, N353 to A399, phosphorylated by PAK2	45	90	45	0	X
27374	Progerin C-ter	45	128	45	0	X
27674	AR ctail	45	146	45	0	X
30447	Hexapeptide HRFLRH	45	28	0	0	X
136	micrococcal nuclease	45	0	0	0	X
19131	tIn936M	45	13	0	0	X
21064	Beta-Pro EZZ	45	23	0	0	X
17961	U2U6111	45	0	29	0			X
488	anthopleurin-A	45	0	0	0	X
34222	ACP-HIS-DPHE-ARG-TRP-ASP-NH2	45	0	0	0	X
15218	ATWLPPR heptapeptide	45	27	0	0	X
30449	Hexapeptide HRFLRH	44	28	0	0	X
20069	Cyclic Tetrapeptide 1	44	0	0	0	X
6856	uyp	44	36	7	0	X
606	melittin	44	0	0	0	X
20068	Cyclic Tetrapeptide 1	44	0	0	0	X
26029	Protein kinase G (PknG) 74-147 rubredoxin domain oxidized, metal free form	44	154	44	0	X
18719	beta 2 integrin tail	44	0	44	0	X
27161	Htt monomer	44	142	44	0	X
27375	Progerin C-terminal region	44	127	44	0	X
12002	second LysM domain from Volvox carteri chitinase	44	142	44	0	X
50085	bacteriorhodopsin	44	2	42	0	X
21045	AIP-I	44	0	0	0	X
25873	RSK1 peptide	44	0	44	0	X
27336	N-terminal domain of FOXO1	44	86	44	0	X
30448	Hexapeptide HRFLRH	44	28	0	0	X
26576	Medin	44	0	44	0	X
25617	dimeric KaiB bound to CI	44	144	44	0	X
11000	ATP Synthase Epsilon Chain	44	90	44	0	X
405	gene V protein	44	0	0	0	X
34414	GLN-ASP-VAL-ASN-THR-ALA-VAL-ALA-TRP	44	0	0	0	X
1662	adrenodoxin	44	0	0	0	X
19130	cIn936M	44	13	0	0	X
308	cytochrome b5	43	0	0	0	X
27418	Human Myc S373D, N353 to A399	43	92	43	0	X
17868	MUC2 Mucin Domain Peptide	43	27	5	0	X
18890	CD3g cytosolic domain	43	136	43	0	X
21072	Beta-Proline dimer	43	36	0	0	X
27419	Human Myc S373E/T400E, N353 to A399	43	84	43	0	X
127	lac repressor headpiece	43	0	0	0	X
26677	CP2	43	22	11	0	X
25931	Cytokine Receptor Common Subunit beta	43	119	42	0	X
27863	EVNPPVP heptapeptide	43	23	0	0	X
17472	trpv5_peptide	43	39	25	0	X
15831	N-terminal domain of the Y2 receptor	43	0	43	0	X
34391	ACE-GLU-VAL-ASN-PRO-PRO-VAL-PRO-NH2	43	23	0	0	X
21073	Beta-Proline dimer	43	36	0	0	X
21046	AIP-II peptide	43	0	0	0	X
21071	Beta-Proline dimer	43	36	0	0	X
2050	acyl-coenzyme A binding protein	43	0	0	0	X
15994	XD	43	0	43	0	X
398	ferredoxin I	43	0	0	0	X
21070	Beta-Proline dimer	43	36	0	0	X
1483	microviridin	43	47	0	0	X
25475	Tau(267-312) bound to Microtubules	43	0	0	0	X
34016	ARG-ALA-CYS-ARG-PHE-PHE-CYS	43	0	0	0	X
2274	insulin B chain	43	0	0	0	X
15993	XD	43	0	43	0	X
30451	SER-ARG-PHE-GLU-LEU-ILE-VAL-HIS-GLN-ARG	43	29	0	0	X
15033	cyclic octamer	43	20	0	4		X
27694	FKBP12	42	42	0	0	X
26033	r(CGG) motif	42	0	0	0			X
1476	tissue plasminogen activator	42	0	0	0	X
20008	L7P Con-T	42	0	0	0	X
25932	P441A Mutant of the Cytokine Receptor Common Subunit beta	42	119	41	0	X
30008	Nucleocapsid protein p7	42	125	42	0	X
20067	Cyclic Tetrapeptide 1	42	0	0	0	X
7221	Link_TSG6 with and without hyaluronan octasaccharides	42	0	32	0	X
1866	cytochrome c551	42	0	0	0	X
6858	pal bound to uyp	42	36	7	0	X
644	micrococcal nuclease	42	12	0	0	X
20007	Conopressin-T	42	0	0	0	X
16281	1:1 complex	42	0	0	0		X
34166	ACE-ARG-ALA-(D)CYS-ARG-BNA-HIS-PEN	42	0	0	0	X
30152	[D-Trp3]-Contryphan-Vc2	42	26	7	0	X
26595	hTRF1-DnaK complex	42	120	42	0	X
512	protein kinase inhibitor	42	0	0	0	X
4164	pyoverdin G4R	42	0	0	0	X
20070	Cyclic Tetrapeptide 1	41	0	0	0	X
26678	Amyloid-beta(1-42)	41	83	41	0	X
25676	NS4A_mut	41	134	41	0	X
21036	AIP-III_D4A peptide	41	0	0	0	X
27221	Residues 421-470 of PABPC1	41	114	41	0	X
30365	QDP(DPR)K(2TL)(DAS)	41	0	0	0	X
7389	pip9	41	0	0	0	X
25549	mBMAL2-TAD	41	84	41	0	X
509	protein kinase inhibitor	41	0	0	0	X
25586	wt NS4A N-terminal domain of DENV	41	92	41	0	X
1693	synthesized signal peptide	41	0	0	0	X
36072	Synaptotagmin-like protein 4	41	0	0	0	X
25486	Purotoxin-2 in water	41	0	41	0	X
7169	Dynorphin B in Bicelles	40	0	0	0	X
510	protein kinase inhibitor	40	0	0	0	X
17514	LZ-cJun dimer	40	78	40	0	X
2006	hemoglobin A beta chain	40	0	0	0	X
19132	ctLO959W	40	0	0	0	X
21032	SUGAR (3-MER)	40	27	0	0
21037	AIP-III_DF5	40	0	0	0	X
26679	pEAbeta(3-42)	40	79	40	0	X
11515	goat alpha-lactalbumin	40	0	40	0	X
15497	MxiD	40	80	40	0	X
19442	E7 dimer	39	126	42	0	X
27037	NTD	39	39	13	0	X
27913	KIF4A	39	76	39	0	X
25394	complex of Dvl PDZ domain with ligand	39	24	0	0	X
27337	N-terminal domain of FOXO1 phosphorylated on T24	39	81	39	0	X
30356	T(DLY)NDT(DSG)(DPR)	39	0	8	0	X
5734	SCR3 peptide (27-33)	39	0	0	0	X
27320	N-terminal domain of FOXO1 phosphorylated on S22	39	78	41	0	X
27864	AP peptide EVNAPVP	39	0	0	0	X
2263	endothelin	39	0	0	0	X
20050	D-PAKKR monomer	39	0	0	0	X
25709	Ub S65E in complex with parkin R0RBR	38	38	0	0	X
26032	r(CGG) motif	38	0	0	0			X
513	protein kinase inhibitor	38	0	0	0	X
1770	lysozyme	38	0	0	0	X
21040	AIP-III_L7A peptide	38	0	0	0	X
2476	pancreatic polypeptide	38	0	0	0	X
30349	HIV-1 GP41 Transmembrane Domain	38	77	38	0	X
17433	Integrin beta3	38	118	38	0	X
1771	lysozyme	38	0	0	0	X
190	cytochrome c	38	0	0	0	X
2446	lysozyme	37	0	0	0	X
1101	hemoglobin A alpha chain	37	0	0	0	X
430	collagen	37	0	0	0	X
27862	PA_peptide	37	0	0	0	X
25365	SLBP	37	92	37	0	X
7407	MxiD	37	76	37	0	X
515	protein kinase inhibitor	37	0	0	0	X
19128	cIn936	37	6	0	0	X
1707	gene V protein	37	0	0	0	X
30364	(DHI)P(DAS)(DGN)(DSN)(DGL)P	37	0	6	0	X
1518	tonB protein	37	0	0	0	X
30090	Envelope glycoprotein gp160	37	75	37	0	X
4667	Co(II)-Bleomycin	37	19	0	0	X
26850	Im7_6-45	37	111	37	0	X
15876	LL-37	37	106	36	0	X
4800	isolated reduced c domain of the cytochrome cd1 nitrite reductase	37	0	0	0	X
21035	AIP-III	37	0	0	0	X
27003	human 4E-BP1 (fragment 44 to 87)	37	108	37	0	X
34098	Microtubule-associated protein tau	36	0	0	0	X
20066	Cyclic Tetrapeptide 1	36	0	0	0	X
36073	Self-Assembling Peptide From SARS-CoV E protein	36	0	0	0	X
18718	alpha 4 integrin tail	36	0	36	0	X
17901	Spliceosome	36	17	12	0			X
26997	human 4E-BP1 (fragment 44 to 87) bound to mouse eIF4E	36	72	36	0	X
36074	Self-Assembling Peptide From SARS-CoV E protein	36	0	0	0	X
1183	hemoglobin beta chain	36	0	0	0	X
1519	tonB protein	36	0	0	0	X
27038	CTD	36	36	12	0	X
21	epidermal growth factor	35	0	0	0	X
27676	KcsA Tetramer, WT	35	89	35	0	X
27678	KcsA Tetramer, E71A mutant	35	97	35	0	X
17159	Affibody_Abeta	35	70	35	0	X
19133	ttLO959M	35	0	0	0	X
2062	transcriptional regulator GCN4-p2N	35	0	0	0	X
16218	apoMb(1-119) fragment	35	38	35	0	X
30350	ARG-GLY-PRO-GLY-ARG-ALA-PHE-VAL-THR-ILE	35	30	8	0	X
94	epidermal growth factor	35	0	0	0	X
6878	MTM7	35	14	0	0	X
27756	Endomorphin-1	35	0	0	0	X
19470	KR8_LPS	35	0	0	0	X
19202	CONANTOKIN BK-B	35	23	0	0	X
27214	single polypeptide chain, RSK1 phosphorylated C-terminal peptide (696-735)	35	0	35	0	X
16131	Tdom40-76	35	104	35	0	X
30366	QDP(DPR)K(2TL)(DAS)	35	0	0	0	X
16280	d(GAGCTC)2	35	0	0	0		X
19129	tIn936W	35	7	0	0	X
21039	AIP-III_F5A_peptide	35	0	0	0	X
27213	single polypeptide chain, RSK1 C-terminal peptide (696-735)	35	0	35	0	X
258	troponin C	35	0	0	0	X
30337	PLP-12	35	19	0	0	X
16217	apoMb(1-119) fragment in the presence of DnaK-beta	35	38	35	0	X
95	epidermal growth factor	35	0	0	0	X
20065	Cyclic Tetrapeptide 1	35	0	0	0	X
7422	Galectin-3-LBT	34	0	0	0	X
511	protein kinase inhibitor	34	0	0	0	X
2331	Laticauda semifasciata III	34	0	0	0	X
4408	contryphan-R (minor form)	34	0	0	0	X
514	protein kinase inhibitor	34	0	0	0	X
27679	KcsA Tetramer, E71I mutant	34	79	34	0	X
2173	trp repressor	34	0	0	0	X
2043	trp repressor	34	0	0	0	X
15705	Galectin-3-LBT	34	0	0	0	X
30343	ASP-LEU-PHE-VAL-PRO-PRO-ILE-ASP	33	0	0	0	X
2074	trp repressor	33	0	0	0	X
11520	Villin	33	0	33	0	X
2228	trypsin inhibitor CMTI-III	33	0	0	0	X
30338	GLY-LEU-LEU-GLY-ILE-THR-ASP	33	14	0	0	X
17386	RBM10 ZnF	33	76	33	0	X
19517	E1TM	33	91	33	0	X
30554	Tumor necrosis factor receptor superfamily member 10B	33	67	33	0	X
17387	RBM5 ZnF	33	69	33	0	X
19990	ShK	33	95	32	0	X
2785	micrococcal nuclease	33	22	0	0	X
2784	micrococcal nuclease	33	22	0	0	X
17385	TEX13A ZnF	33	71	33	0	X
16845	cementoin	33	93	33	0	X
25106	CAG RNA	33	0	0	0			X
11519	Villin	33	34	33	0	X
2042	trp repressor	33	0	0	0	X
11521	Villin	33	0	33	0	X
21041	tAIP-III	33	0	0	0	X
5260	desulforedoxin	32	14	17	0	X
17078	tRNALeu monomer	32	0	32	0			X
21042	tAIP-III_D2A	32	0	0	0	X
26965	Htt	32	96	32	0	X
17921	GAAA tetraloop monomer	32	0	22	0			X
34099	Microtubule-associated protein tau	32	0	0	0	X
17380	RBP56 ZnF	32	74	32	0	X
26964	Htt	32	96	32	0	X
30553	Tumor necrosis factor receptor superfamily member 10B	32	66	32	0	X
17672	JAZ ZF4	31	32	31	0	X
16067	RelBc	31	66	31	0	X
25537	Cn-AMP1	31	0	0	0	X
27306	mPER2 FASP	31	100	31	0	X
7143	HEWL	31	0	0	0	X
27680	KcsA Tetramer, E71Q mutant	31	77	30	0	X
18873	Lewisx-sp8 acetate	31	22	0	0
2209	trp repressor	31	0	0	0	X
26994	HSP27	31	102	31	0	X
27746	NaK2K tetramer	31	70	31	0	X
1184	hemoglobin beta chain	31	0	0	0	X
2474	plasminogen kringle 4 domain	31	0	0	0	X
7144	HEWL	31	0	0	0	X
25811	core of the U4/U6 di-snRNA	30	5	25	0			X
11564	RPEL motif of rat MKL1 protein	30	61	30	0	X
2276	bombesin	30	0	0	0	X
19587	alpha-conotoxin Vc1.1: [3,16]-trans dicarba Vc1.1	30	31	11	0	X
27717	L4Q20	30	75	30	0	X
19577	Non-reducible analogues of alpha-conotoxin Vc1.1: [2,8]-cis dicarba Vc1.1	30	31	13	0	X
19748	Lactodifucotetraose (LDFT) beta anomer	30	24	0	0
291	myoglobin	30	0	0	0	X
5548	PANCREATIC POLYPEPTIDE	30	0	30	0	X
20072	cyclo[Trp-Leu-1,5-sub-(1,2,3)-triazole-D-Ala-Aod]	30	0	0	0	X
19578	Non-reducible analogues of alpha-conotoxin Vc1.1: [2,8]-trans dicarba Vc1.1	30	31	11	0	X
26605	UblD in complex with parkin	30	30	0	0	X
2928	ribonuclease A	30	0	0	0	X
20039	Cyclic Pseudotetrapeptide	29	0	0	0	X
292	myoglobin	29	0	0	0	X
20037	Cyclic Pseudotetrapeptide	29	0	0	0	X
21031	Lewis a	29	20	0	0
27410	DNA polymerase beta ternary complex	29	29	0	0	X	X
2040	trp repressor	29	0	0	0	X
393	trp repressor	29	0	0	0	X
27407	DNA polymerase beta	29	29	0	0	X
25867	PKI domain of the honeybee dicistrovirus, Israeli acute paralysis virus (IAPV) IRES	29	0	29	0			X
21034	Lewisx methyl glycoside	29	21	0	0
11565	94P-RPEL motif of rat MKL1 protein	29	61	29	0	X
20041	Cyclic Pseudotetrapeptide	29	0	0	0	X
27409	DNA polymerase beta	29	29	0	0	X	X
16130	Tdom 40-76 TolAIII complex	29	92	29	0	X
17413	TRAP11	29	29	0	0	X
17400	TRAP11	29	29	0	0	X
11567	RPEL motif of rat MKL1 protein	29	60	29	0	X
20038	Cyclic Pseudotetrapeptide	28	0	0	0	X
20042	Cyclic Pseudotetrapeptide	28	0	0	0	X
486	repressor P22 c2	28	28	0	0	X
653	tryptophan synthase	28	0	0	0	X
11566	L105P-RPEL motif of rat MKL1	28	61	28	0	X
595	cardiotoxin CTXIIa	28	0	0	0	X
613	neurotoxin III	28	0	0	0	X
195	434 repressor	28	28	0	0	X
1358	ribonuclease A	28	0	0	0	X
30344	ASP-LEU-PHE-VAL-PRO-PRO-ILE-ASP	28	15	0	0	X
18619	Menk in DMPC SUV	28	0	0	0	X
21033	Lewisx-FimH	28	20	0	0	X
20040	Cyclic Pseudotetrapeptide	28	0	0	0	X
997	insulin B chain	27	0	0	0	X
1011	insulin B chain	27	0	0	0	X
995	insulin B chain	27	0	0	0	X
20043	Cyclic Pseudotetrapeptide	27	0	0	0	X
1013	insulin B chain	27	0	0	0	X
18803	MHV N-linker peptide	27	60	27	0	X
2475	plasminogen kringle 4 domain	27	0	0	0	X
1005	insulin B chain	27	0	0	0	X
1009	insulin B chain	27	0	0	0	X
20036	Cyclic Pseudotetrapeptide	27	0	0	0	X
27464	Protein Phosphatse 1 - C- terminal	27	53	27	0	X
1015	insulin B chain	27	0	0	0	X
1001	insulin B chain	27	0	0	0	X
1007	insulin B chain	27	0	0	0	X
1003	insulin B chain	27	0	0	0	X
25440	Bud31p protein	27	0	0	0	X
2960	growth hormone releasing factor	27	0	0	0	X
999	insulin B chain	27	0	0	0	X
11568	RPEL motif of rat MKL1 protein	27	59	27	0	X
20056	LSEAL-CaMLD complex	27	0	0	0	X
30476	Cyclic tetrapeptide PYPV	26	16	0	0	X
15104	NW domain 8	26	0	26	0	X
30203	Cyclic peptide ALA-ALA-ALA-UN1-ALA-ARG-ALA-ALA-ARG-ALA-ALA-ARG-ALA	26	0	0	0	X
6653	zzf1L	26	89	26	0	X
1025	insulin B chain	26	0	0	0	X
1661	adrenodoxin	26	0	0	0	X
26715	beta-endorphin	26	146	32	0	X
27316	BclxL	26	62	26	0	X
557	insulin B chain	26	0	0	0	X
2277	hemoglobin alpha chain	26	0	0	0	X
17928	AM2-BM2	26	26	26	0	X
5915	Met-enkephalin 1	25	0	0	0	X
18750	IscU	25	16	2	0	X
189	micrococcal nuclease	25	0	25	0	X
3000	HiPIP	25	0	0	0	X
5914	Met-enkephalin	25	0	0	0	X
17444	LR11_SorLA	25	71	25	0	X
940	calbindin	25	0	0	0	X
18754	apo-IscU	25	16	3	0	X
25929	Transmembrane domain of mouse Fas/CD95 death receptor	25	52	25	0	X
238	anthopleurin-A	25	0	0	0	X
939	calbindin	25	0	0	0	X
27716	L4Q16	25	53	25	0	X
25121	Influenza Hemagluttinin Fusion Peptide	24	0	24	0	X
25930	Transmembrane domain of human Fas/CD95 death receptor	24	51	24	0	X
1669	lysozyme	24	0	0	0	X
704	gene V protein	24	0	0	0	X
20004	Leu-enkephalin	24	24	0	0	X
5087	Hydrogenobacter thermophilus cytochrome c-552	24	0	0	0	X
27360	STIM1 CC1 monomer	24	24	11	0	X
20005	Leu-enkephalin	24	24	0	0	X
1360	ribonuclease A	24	0	0	0	X
20064	Cyclic Tetrapeptide 1	24	0	0	0	X
17929	AM2-BM2	24	14	24	0	X
1413	myoglobin	24	0	0	0	X
1206	toxin ATX Ia	24	0	0	0	X
20003	Leu-enkephalin	24	24	0	0	X
1670	lysozyme	23	0	0	0	X
20090	KAAAD	23	0	0	0	X
1726	collagen	23	0	0	0	X
1725	collagen	23	0	0	0	X
1178	maltoporin	23	0	0	0	X
1592	adenylate kinase	23	0	0	0	X
227	cytochrome c	23	0	0	0	X
363	myoglobin	23	0	0	0	X
1127	desulfatohirudin	23	0	0	0	X
17985	BST-2	23	24	23	0	X
2454	acyl carrier protein	23	2	0	0	X
1744	cro repressor	23	0	7	0	X
336	cytochrome c	22	0	0	0	X
337	cytochrome c552	22	0	0	0	X
27695	FKBP12	22	22	0	0	X
4801	isolated oxidized c domain of the cytochrome cd1 nitrite reductase	22	0	0	0	X
5089	Hydrogenobacter thermophilus cytochrome c-552	22	0	0	0	X
15103	NW domain 6	21	0	21	0	X
27303	DREB2A(255-272)	21	55	20	0	X
15157	Duck HBV epsilon apical tetraloop	21	0	2	0			X
5660	oxidized cytochrome c	21	0	0	0	X
676	troponin C	21	0	0	0	X
1102	hemoglobin A beta chain	21	0	0	0	X
1839	glucose oxidase	21	0	0	0	X
26538	Short hydrophobic peptide, 11mer, SS	21	0	0	0	X
240	toxin ATX II	21	0	0	0	X
1066	lac repressor headpiece	21	0	0	0	X
2718	interleukin 1-beta	21	0	0	0	X
16190	cNTnC and WW7	21	21	0	0	X
150	anthopleurin-A	20	0	0	0	X
1745	male-associated protein	20	0	0	0	X
25517	Short hydrophobic peptide, 11mer	20	0	0	0	X
27073	NS5Bd21 monomer	20	20	0	0	X
2068	barnase	20	0	0	0	X
228	cytochrome c	20	0	0	0	X
706	gene V protein	20	0	0	0	X
1702	delta5-3-ketosteroid isomerase	20	0	0	0	X
3525	dihydrofolate reductase	20	0	0	0	X
1552	lac repressor headpiece	20	0	0	0	X
2463	2Fe-2S ferredoxin	20	20	0	0	X
3524	dihydrofolate reductase	20	0	0	0	X
707	gene V protein	20	0	0	0	X
26537	Short hydrophobic peptide, 11mer	20	0	0	0	X
26536	Short hydrophobic peptide, 11mer	20	0	0	0	X
25505	CCR5-ECL2 helical structure, residues Q186-T195	20	30	10	0	X
1192	cytochrome c	20	0	0	0	X
1021	insulin B chain	20	0	0	0	X
5301	Leukosialin (CD43) fragment	20	14	0	0	X
1200	myoglobin	20	0	0	0	X
229	cytochrome c	20	0	0	0	X
25359	BamA	20	41	20	0	X
30170	Toll/interleukin-1 receptor domain-containing adapter protein	19	61	19	0	X
1891	cyclic AMP receptor protein	19	0	0	0	X
661	lac repressor headpiece	19	0	0	0	X
705	gene V protein	19	0	0	0	X
1194	cytochrome c	19	0	0	0	X
1017	insulin B chain	19	0	0	0	X
630	cytochrome c	19	0	0	0	X
25235	FtsH periplasmic N-domain	19	12	3	0	X
2950	che Y protein	19	0	0	0	X
36284	beta 2 adrenergic receptor	19	0	19	0	X
2193	adenylate kinase	19	0	0	0	X
11439	LC4 transmembrane segment of CCR5	19	0	0	0	X
317	cytochrome c	18	0	0	0	X
1649	transcriptional activator GAL4	18	0	0	0	X
27881	YecA Monomer	18	54	18	0	X
276	neurotoxin I	18	0	0	0	X
18720	Dm DCP1 EVH1 domain in complex with the XRN1 DBM peptide	18	524	123	0	X
2052	transcriptional activator GAL4	18	0	0	0	X
1638	transcriptional activator GAL4	18	0	0	0	X
402	fibrinogen	18	0	0	0	X
1072	ribonuclease A	18	0	0	0	X
2396	glutathione transferase	18	0	0	0	X
667	cytochrome c	18	0	0	0	X
364	myoglobin	18	0	0	0	X
2051	transcriptional activator GAL4	18	0	0	0	X
2053	transcriptional activator GAL4	18	0	0	0	X
6881	Schistocerca gregaria chymotrypsin inhibitor complex with bovine alpha-chymotrypsin	18	33	18	0	X
2247	troponin C	18	0	9	0	X
1439	2Fe-2S ferredoxin	17	0	0	0	X
219	cytochrome c	17	0	0	0	X
436	cytochrome c	17	0	0	0	X
417	fibrinogen	17	0	0	0	X
505	copper-zinc superoxide dismutase	17	0	0	0	X
401	fibrinogen	17	0	0	0	X
2473	plasminogen kringle 4 domain	17	0	0	0	X
426	myoglobin	17	0	0	0	X
242	toxin ATX I	17	0	0	0	X
437	cytochrome c	17	0	0	0	X
2951	che Y protein	17	0	0	0	X
218	cytochrome c	16	0	0	0	X
316	cytochrome c	16	0	0	0	X
36	melittin	16	0	0	0	X
813	copper-zinc superoxide dismutase	16	0	0	0	X
339	apamin	16	0	16	0	X
341	apamin	16	0	16	0	X
1785	cytochrome c	16	0	0	0	X
34373	DAL-PRO-GLY-CYS-LYS	16	22	0	0	X
811	copper-zinc superoxide dismutase	16	0	0	0	X
848	lac repressor headpiece	16	0	0	0	X
340	apamin	16	0	16	0	X
27714	L4Q8	16	43	15	0	X
812	copper-zinc superoxide dismutase	16	0	0	0	X
367	cytochrome c2	16	0	0	0	X
26939	ASH1-mRNA	16	0	0	0			X
27361	STIM1 CC1 R304W monomer	16	0	10	0	X
1775	cytochrome c	16	0	0	0	X
20071	cyclo[Trp-Ile-1,4-sub-(1,2,3)-triazole-D-Ala-Aod]	15	0	0	0	X
27860	calredoxin monomer	15	15	0	0	X
1151	anthopleurin-A	15	0	0	0	X
20073	cyclo[Trp-D-Leu-1,5-sub-(1,2,3)-triazole-D-Ala-Aod]	15	0	0	0	X
1646	cytochrome c2	15	0	3	0	X
15773	Human Prolactin	15	9	14	0	X
1019	insulin B chain	15	0	0	0	X
27865	calredoxin monomer	15	15	0	0	X
342	apamin	15	0	15	0	X
36166	GTPase HRas	15	5	0	0	X
1095	cytochrome c	15	0	0	0	X
814	copper-zinc superoxide dismutase	15	0	0	0	X
1647	cytochrome c2	15	0	1	0	X
1761	insulin A chain	14	0	0	0	X
545	cytochrome c	14	0	0	0	X
2425	ribonuclease A	14	0	0	0	X
1487	copper-zinc superoxide dismutase	14	0	0	0	X
1486	copper-zinc superoxide dismutase	14	0	0	0	X
34129	Microtubule-associated protein tau	14	0	0	0	X
27294	Turkey beta-1 adrenergic receptor, Delta5-L190M mutant, Apo form	14	14	0	0	X
668	cytochrome c	14	0	0	0	X
27292	Turkey beta-1 adrenergic receptor, Delta5 mutant, Apo form	14	14	0	0	X
27296	Turkey beta-1 adrenergic receptor, Delta5-L190M mutant, bound to nanobody Nb6B9	14	14	0	0	X
27295	Turkey beta-1 adrenergic receptor, Delta5-L190M mutant, Isoprenaline-bound form	14	14	0	0	X
27328	Human A2A adenosine receptor in complex with ZM241385	14	0	14	0	X
27297	Turkey beta-1 adrenergic receptor, Delta5-L190M mutant, bound to nanobody Nb6B9 and full agonist isoprenaline	14	14	0	0	X
849	lac repressor headpiece	14	0	0	0	X
217	cytochrome c	14	0	0	0	X
6778	CaM-melatonin	14	0	14	0	X
188	micrococcal nuclease	14	0	0	0	X
19733	trimeric Skp	14	14	0	0	X
27713	L4Q4	13	18	13	0	X
34374	DAL-PRO-GLY-CYS-LYS	13	19	0	0	X
1624	glucose permease	13	0	0	0	X
25116	GTPase KRas-GNP:ARafRBD complex	13	13	0	0	X
19730	trimeric Skp with bound tOmpA	13	13	0	0	X
34372	DAL-PRO-GLY-CYS-LYS	13	23	0	0	X
216	cytochrome c	13	0	0	0	X
2798	trypsin inhibitor CMTI-III	13	0	0	0	X
2069	barnase	13	0	0	0	X
2799	trypsin inhibitor CMTI-III	13	0	0	0	X
119	val-gramicidin A	13	0	9	0	X
4441	Anabaena 7120 vegetative Ferredoxin	12	0	0	0	X
862	troponin C	12	0	0	0	X
27293	Turkey beta-1 adrenergic receptor, Delta5 mutant, Isoprenaline-bound form	12	12	0	0	X
2786	lysozyme	12	0	0	0	X
1889	cytochrome c peroxidase	12	0	0	0	X
543	cytochrome c	12	0	0	0	X
4442	Anabaena 7120 vegetative Ferredoxin	12	0	0	0	X
4440	Human Ferredoxin reduced	12	0	0	0	X
25134	AMA1-R1	12	15	12	0	X
948	cytochrome c	12	0	0	0	X
1751	met-myoglobin	12	0	0	0	X
1793	cytochrome c	12	0	0	0	X
1752	myoglobin	12	0	0	0	X
1736	cytochrome c	12	7	0	0	X
34371	DAL-PRO-GLY-CYS-LYS	12	18	0	0	X
286	cytochrome c	12	0	0	0	X
1791	cytochrome c	12	0	0	0	X
5021	ION-SELECTIVE LIGAND A22	12	20	0	0	X
4439	Human Ferredoxin oxidized	12	0	0	0	X
239	anthopleurin-A	12	0	0	0	X
5020	ION-SELECTIVE LIGAND D18	12	19	0	0	X
1210	azurin	11	0	0	0	X
546	cytochrome c	11	0	0	0	X
596	cardiotoxin CTXIIa	11	0	0	0	X
1706	anthopleurin-A	11	0	0	0	X
1777	cytochrome c	11	0	0	0	X
389	phospholipase A2	11	0	0	0	X
285	cytochrome c	11	0	0	0	X
1023	insulin B chain	11	0	0	0	X
1705	anthopleurin-A	11	0	0	0	X
1211	azurin	11	0	0	0	X
220	cytochrome c	11	0	0	0	X
34363	DCY-LEU-GLY-ALA-THR	11	13	0	0	X
25115	K-Ras and membrane scaffold protein	11	11	0	0	X
34369	DAL-PRO-GLY-CYS-LYS	11	11	0	0	X
823	myoglobin	11	0	0	0	X
25114	GTPase KRas-GDP tethered to a lipid-bilayer nanodisc	11	11	0	0	X
1877	micrococcal nuclease	11	0	0	0	X
1783	cytochrome c	11	0	0	0	X
2203	amphiphilic alpha-helix peptide Baa17	11	0	0	0	X
1808	peroxidase	11	0	0	0	X
949	cytochrome c	10	0	0	0	X
1734	cytochrome c551	10	6	0	0	X
1457	myoglobin	10	0	0	0	X
1455	myoglobin	10	0	0	0	X
532	peptidylprolyl isomerase	10	0	0	0	X
2488	cytochrome c	10	0	0	0	X
1465	myoglobin	10	0	0	0	X
332	cytochrome c	10	0	0	0	X
34370	DAL-PRO-GLY-CYS-LYS	10	14	0	0	X
1797	cytochrome c	10	0	0	0	X
1217	azurin	10	0	0	0	X
1471	myoglobin	10	0	0	0	X
26938	ASH1-mRNA	10	0	0	0			X
331	cytochrome c	10	0	0	0	X
2990	ATPase-stimulating-peptide	10	0	0	0	X
6862	calmodulin N-terminal domain (Ca bound)	10	0	0	0	X
2768	ATPase-stimulating-peptide	10	0	0	0	X
1461	myoglobin	10	0	0	0	X
1216	azurin	10	0	0	0	X
1463	myoglobin	10	0	0	0	X
531	peptidylprolyl isomerase	10	0	0	0	X
1795	cytochrome c	10	0	0	0	X
1212	azurin	10	0	0	0	X
34360	DAL-PRO-GLY-CYS-LYS	10	14	0	0	X
241	toxin ATX II	10	0	0	0	X
330	cytochrome c	10	0	0	0	X
1459	myoglobin	10	0	0	0	X
2529	myohemerythrin	10	1	8	0	X
749	troponin C	10	0	0	0	X
3084	carbonic anhydrase II	10	0	0	0	X
5023	5'-R(GPGPUPGPCPUPUPAPGPCPAPCP*C)-3'	10	0	0	0			X
3085	carbonic anhydrase II	10	0	0	0	X
2991	ATPase-stimulating-peptide	10	0	0	0	X
5864	Neurokinin B	10	0	0	0	X
1215	azurin	9	0	0	0	X
2222	HiPIP	9	0	0	0	X
1789	cytochrome c	9	0	0	0	X
1214	azurin	9	0	0	0	X
429	collagen	9	0	0	0	X
1779	cytochrome c	9	0	0	0	X
2221	HiPIP	9	0	0	0	X
2265	subtilisin inhibitor	9	18	0	0	X
500	cytochrome c	9	0	0	0	X
6798	CaM-CaMKI	9	9	0	0	X
499	cytochrome c	9	0	0	0	X
5193	5'-R(GPGPUPGPCPAPUPGPGPCPAPCP*C)-3'	9	0	0	0			X
611	neurotoxin III	9	0	0	0	X
223	cytochrome c	9	0	0	0	X
2958	thioredoxin	9	0	0	0	X
2038	lignin peroxidase	9	0	0	0	X
353	alpha-lactalbumin	9	0	0	0	X
17440	trans-Resveratrol in complex with the cardiac regulatory protein Troponin C	9	0	0	0	X
7018	CaM-Cys-CaMKI	9	9	0	0	X
187	plastocyanin	9	0	0	0	X
6830	calmodulin	9	9	0	0	X
6831	CaM-cNOS peptide comlex	9	9	0	0	X
1781	cytochrome c	9	0	0	0	X
2959	thioredoxin	9	0	0	0	X
6861	calmodulin N-terminal domain	9	0	0	0	X
489	anthopleurin-A	9	0	0	0	X
1787	cytochrome c	9	0	0	0	X
821	ferredoxin	9	0	0	0	X
1012	insulin A chain	8	0	0	0	X
672	cytochrome c	8	0	0	0	X
359	viscotoxin B	8	0	0	0	X
996	insulin A chain	8	0	0	0	X
1002	insulin A chain	8	0	0	0	X
2220	HiPIP	8	0	0	0	X
30202	Cyclic tetrapeptide ALA-ARG-ALA-UN1	8	0	0	0	X
1018	insulin A chain	8	0	0	0	X
556	insulin A chain	8	0	0	0	X
2528	myohemerythrin	8	0	8	0	X
1147	cytochrome c553	8	0	0	0	X
994	insulin A chain	8	0	0	0	X
1014	insulin A chain	8	0	0	0	X
846	troponin C	8	0	0	0	X
50	viscotoxin A3	8	0	0	0	X
1004	insulin A chain	8	0	0	0	X
1713	myosin	8	0	0	0	X
1213	azurin	8	0	0	0	X
1020	insulin A chain	8	0	0	0	X
673	cytochrome c	8	0	0	0	X
7030	CaM-FFW	8	0	0	0	X
7029	CaM-FFF	8	0	0	0	X
2917	lysozyme	8	0	0	0	X
7031	CaM-WF10	8	0	0	0	X
1006	insulin A chain	8	0	0	0	X
1016	insulin A chain	8	0	0	0	X
1022	insulin A chain	8	0	0	0	X
7028	CaM-WFF	8	0	0	0	X
1000	insulin A chain	8	0	0	0	X
6802	CaM	8	0	0	0	X
1010	insulin A chain	8	0	0	0	X
998	insulin A chain	8	0	0	0	X
1008	insulin A chain	8	0	0	0	X
221	cytochrome c	8	0	0	0	X
1028	myoglobin	7	0	0	0	X
2764	trp repressor	7	0	0	0	X
1029	myoglobin	7	0	0	0	X
822	ferredoxin	7	0	0	0	X
418	apamin	7	0	0	0	X
1895	cyclic AMP receptor protein	7	0	0	0	X
1574	phoratoxin A	7	0	0	0	X
1030	myoglobin	7	0	0	0	X
222	cytochrome c	7	0	0	0	X
361	phoratoxin A	7	0	0	0	X
1571	cytochrome b562	7	0	0	0	X
956	cytochrome c	7	0	0	0	X
360	ligatoxin A	7	0	0	0	X
736	lac repressor headpiece	7	0	0	0	X
3079	microglobulin	7	0	0	0	X
4975	B-D-glucospyranosyl-(1,4)-B-D-glucospyranosyl-(1,4)-B-D-glucospyranosyl-(1,4)-B-D-glucospyranosyl-(1,4)-B-D-glucospyranose	7	6	0	0
1841	cytochrome c peroxidase	7	0	0	0	X
2284	toxin AaH III	7	0	0	0	X
1027	myoglobin	7	0	0	0	X
1575	phoratoxin B	7	0	0	0	X
1416	cytochrome c	6	0	0	0	X
760	cytochrome c551	6	0	0	0	X
1149	cytochrome c553	6	0	0	0	X
2436	calmodulin	6	0	0	0	X
2075	epidermal growth factor	6	0	0	0	X
1222	calmodulin	6	0	0	0	X
1227	troponin C	6	0	0	0	X
573	transcriptional activator GAL4	6	0	0	0	X
1620	transcriptional activator GAL4	6	0	0	0	X
2435	calmodulin	6	0	0	0	X
439	cytochrome c	6	0	0	0	X
2437	calmodulin	6	0	0	0	X
438	cytochrome c	6	0	0	0	X
149	anthopleurin-A	6	0	0	0	X
362	phoratoxin B	6	0	0	0	X
288	transcriptional regulator ner	5	0	5	0	X
2076	epidermal growth factor	5	0	0	0	X
1576	phoratoxin A	5	0	0	0	X
151	anthopleurin-A	5	0	0	0	X
1031	myoglobin	5	0	0	0	X
27261	A2A_ZM	5	5	0	0	X
2366	cytochrome c	5	0	0	0	X
2352	hemoglobin	5	0	0	0	X
2367	cytochrome c	5	0	0	0	X
2368	cytochrome c	5	0	0	0	X
2652	Bence Jones protein Nag	5	0	0	0	X
1541	crambin	5	0	0	0	X
27466	FAT10 C-terminal domain	5	6	1	0	X
423	alpha-conotoxin G1	5	0	0	0	X
700	parathyroid hormone	5	0	0	0	X
293	myoglobin	5	0	0	0	X
1033	myoglobin	5	0	0	0	X
1739	cytochrome c3	5	0	0	0	X
90	crambin	5	0	0	0	X
1542	thionin	5	0	0	0	X
1577	phoratoxin B	5	0	0	0	X
1469	myoglobin	5	0	0	0	X
1032	myoglobin	5	0	0	0	X
1148	cytochrome c553	5	0	0	0	X
433	ras gene product	5	0	4	0	X
27570	DGK homotrimer	5	418	112	0	X
432	ras gene product	5	0	4	0	X
244	cytochrome c	5	0	0	0	X
307	cytochrome c oxidase	4	0	0	0	X
1156	basic pancreatic trypsin inhibitor	4	0	0	0	X
1024	insulin A chain	4	0	0	0	X
2348	myoglobin	4	0	0	0	X
233	cytochrome c	4	0	0	0	X
918	adenylate kinase	4	0	0	0	X
1134	seven-iron ferredoxin	4	0	0	0	X
647	cytochrome c	4	0	0	0	X
2434	myoglobin	4	0	0	0	X
600	lytic factor 12B	4	0	0	0	X
648	cytochrome c	4	0	0	0	X
2455	pancreatic secretory trypsin inhibitor	4	0	0	0	X
2433	myoglobin	4	0	0	0	X
3127	CaBP	4	0	0	0	X
109	trypsin inhibitor A-II	4	0	0	0	X
2438	calmodulin	4	0	0	0	X
2432	myoglobin	4	0	0	0	X
1467	myoglobin	4	0	0	0	X
3128	CaBP	4	0	0	0	X
2207	echistatin	4	0	0	0	X
234	cytochrome c	4	0	0	0	X
117	trypsin inhibitor homologue K	4	0	0	0	X
761	cytochrome c551	4	0	0	0	X
645	cytochrome c	4	0	0	0	X
2346	myoglobin	4	0	0	0	X
309	cytochrome b5	4	0	0	0	X
1996	elongation factor Tu	4	0	4	0	X
2001	viral coat protein	4	0	0	0	X
2347	myoglobin	4	0	0	0	X
2345	myoglobin	4	0	0	0	X
2431	myoglobin	4	0	0	0	X
1995	elongation factor Tu	4	0	4	0	X
920	adenylate kinase	4	0	0	0	X
649	cytochrome c	4	0	0	0	X
1998	viral coat protein	4	0	0	0	X
1228	troponin C	4	0	0	0	X
259	troponin C	4	0	0	0	X
1133	seven-iron ferredoxin	4	0	0	0	X
235	cytochrome c	4	0	0	0	X
2338	plastocyanin	4	0	0	0	X
2641	carbonic anhydrase II	4	0	0	0	X
1999	viral coat protein	4	0	0	0	X
2233	parathyroid hormone	4	0	0	0	X
2439	calmodulin	4	0	0	0	X
1226	troponin C	4	0	0	0	X
2440	calmodulin	4	0	0	0	X
646	cytochrome c	4	0	0	0	X
2003	viral coat protein	4	0	0	0	X
919	adenylate kinase	4	0	0	0	X
2642	carbonic anhydrase II	4	0	0	0	X
2002	viral coat protein	4	0	0	0	X
2000	viral coat protein	4	0	0	0	X
2640	carbonic anhydrase II	4	0	0	0	X
1665	conotoxin GIIIA	4	0	0	0	X
1225	troponin C	4	0	0	0	X
355	alpha-lactalbumin	3	0	0	0	X
2513	carboxypeptidase A	3	0	0	0	X
2225	trypsin inhibitor CMTI-III	3	0	0	0	X
102	trypsin inhibitor B-III	3	0	0	0	X
354	alpha-lactalbumin	3	0	0	0	X
1174	phosphoglycerate kinase	3	0	0	0	X
108	trypsin inhibitor B-III	3	0	0	0	X
2325	adenylate kinase	3	0	0	0	X
1177	phosphoglycerate kinase	3	0	0	0	X
2114	trp repressor	3	0	19	0	X
115	trypsin inhibitor E	3	0	0	0	X
781	SWI5 zinc finger	3	0	0	0	X
27202	POR	3	4	0	0	X
2226	trypsin inhibitor CMTI-III	3	0	0	0	X
1892	cyclic AMP receptor protein	3	0	0	0	X
1843	phosphoglycerate kinase	3	0	0	0	X
824	myoglobin	3	0	0	0	X
106	trypsin inhibitor B-III	3	0	0	0	X
2489	cytochrome c	3	0	0	0	X
957	cytochrome c	3	0	0	0	X
107	trypsin inhibitor B-III	3	0	0	0	X
1176	phosphoglycerate kinase	3	0	0	0	X
120	plastocyanin	3	0	0	0	X
105	trypsin inhibitor B-III	3	0	0	0	X
103	trypsin inhibitor B-III	3	0	0	0	X
64	trypsin inhibitor B-III	3	0	0	0	X
506	copper-zinc superoxide dismutase	3	0	0	0	X
2326	adenylate kinase	3	0	0	0	X
116	trypsin inhibitor E	3	0	0	0	X
1058	cytochrome c	3	0	0	0	X
148	anthopleurin-A	3	0	0	0	X
104	trypsin inhibitor B-III	3	0	0	0	X
2324	adenylate kinase	3	0	0	0	X
1845	phosphoglycerate kinase	3	0	0	0	X
1475	cyclophilin	3	0	0	0	X
1441	2Fe-2S ferredoxin	3	0	0	0	X
2443	elongation factor Tu	3	0	0	0	X
478	ras gene product	3	0	3	0	X
1440	2Fe-2S ferredoxin	3	0	0	0	X
1846	phosphoglycerate kinase	3	0	0	0	X
2512	carboxypeptidase A	3	0	0	0	X
1578	phoratoxin B	3	0	0	0	X
1884	lysozyme	3	0	0	0	X
1221	ricin	3	0	0	0	X
413	basic pancreatic trypsin inhibitor	2	0	0	0	X
261	plastocyanin	2	0	0	0	X
411	basic pancreatic trypsin inhibitor	2	0	0	0	X
2625	alpha-lytic proteinase	2	0	0	0	X
2763	tropomyosin	2	0	0	0	X
1049	neurotoxin I (Sh1)	2	0	0	0	X
3065	cro repressor	2	0	0	0	X
1573	cytochrome b562	2	0	0	0	X
254	thioredoxin	2	0	0	0	X
1872	BSPI-2	2	0	0	0	X
1443	insulin A chain	2	0	0	0	X
1337	enhancer-binding protein	2	0	0	0	X
1881	lysozyme	2	0	0	0	X
1175	phosphoglycerate kinase	2	0	0	0	X
2624	alpha-lytic proteinase	2	0	0	0	X
1150	cytochrome c553	2	0	0	0	X
479	ras gene product	2	0	2	0	X
3118	troponin C	2	0	0	0	X
3119	troponin C	2	0	0	0	X
191	phosphoglycerate kinase	2	0	0	0	X
544	cytochrome c	2	0	0	0	X
2627	alpha-lytic proteinase	2	0	0	0	X
1769	ras gene product	2	0	0	0	X
1882	lysozyme	2	0	0	0	X
1587	insulin A chain	2	0	0	0	X
884	insulin B chain	2	0	0	0	X
2617	alpha-lytic proteinase	2	0	0	0	X
1100	myoglobin	2	0	0	0	X
2719	interleukin 1-beta	2	0	0	0	X
1883	lysozyme	2	0	0	0	X
1844	phosphoglycerate kinase	2	0	0	0	X
944	cytochrome c	2	0	0	0	X
1220	ricin	2	0	0	0	X
1039	basic pancreatic trypsin inhibitor	2	0	0	0	X
2547	dihydrolipoamide succinyltransferase	2	0	0	0	X
2620	alpha-lytic proteinase	2	0	0	0	X
883	insulin B chain	2	0	0	0	X
2651	lipoate acetyltransferase	2	0	0	0	X
441	trp repressor	2	0	0	0	X
2618	alpha-lytic proteinase	2	0	0	0	X
1334	cytochrome c551	2	0	0	0	X
2218	myoglobin	2	0	0	0	X
2619	alpha-lytic proteinase	2	0	0	0	X
1179	basic pancreatic trypsin inhibitor	2	0	0	0	X
1871	BSPI-2	2	0	0	0	X
412	basic pancreatic trypsin inhibitor	2	0	0	0	X
1590	anti-NIP IgG3 immunoglobulin	2	0	0	0	X
597	cardiotoxin VII4	1	0	0	0	X
224	cytochrome c	1	0	0	0	X
1821	carbonic anhydrase II	1	0	0	0	X
893	adenylate kinase	1	0	0	0	X
311	cytochrome b5	1	0	0	0	X
2638	carbonic anhydrase II	1	0	0	0	X
225	cytochrome c	1	0	0	0	X
2426	ribonuclease A	1	0	0	0	X
599	cardiotoxin CM2E	1	0	0	0	X
2639	carbonic anhydrase II	1	0	0	0	X
1218	azurin	1	0	0	0	X
2936	myoglobin	1	0	0	0	X
226	cytochrome c	1	0	0	0	X
964	chymotrypsinogen A	1	0	0	0	X
2622	alpha-lytic proteinase	1	0	0	0	X
2623	alpha-lytic proteinase	1	0	0	0	X
255	thioredoxin	1	0	0	0	X
960	chymotrypsinogen A	1	0	0	0	X
1043	copper-zinc superoxide dismutase	1	0	0	0	X
121	plastocyanin	1	0	0	0	X
2935	myoglobin	1	0	0	0	X
1484	micrococcal nuclease	1	1	0	0	X
1822	carbonic anhydrase II	1	0	0	0	X
2853	fibronectin	1	0	0	0	X
2621	alpha-lytic proteinase	1	0	0	0	X
253	thioredoxin	1	0	0	0	X
1819	carbonic anhydrase II	1	0	0	0	X
1400	thioredoxin	1	0	0	0	X
351	tissue plasminogen activator	1	0	0	0	X
2712	hemoglobin A beta chain	1	0	0	0	X
2234	parathyroid hormone	1	0	0	0	X
112	trypsin inhibitor A-II	1	0	0	0	X
2710	hemoglobin A beta chain	1	0	0	0	X
2631	glutamine-binding protein	1	0	0	0	X
1485	micrococcal nuclease	1	1	0	0	X
965	chymotrypsin	1	0	0	0	X
2707	hemoglobin A alpha chain	1	0	0	0	X
967	chymotrypsin	1	0	0	0	X
1591	anti-NIP IgG3 immunoglobulin	1	0	0	0	X
1376	cardiotoxin CTXIIB	1	0	0	0	X
123	toxin ATX Ia	1	0	0	0	X
1099	myoglobin	1	0	0	0	X
1042	copper-zinc superoxide dismutase	1	0	0	0	X
966	chymotrypsinogen A	1	0	0	0	X
2628	alpha-lytic proteinase	1	0	0	0	X
2630	glutamine-binding protein	1	0	0	0	X
2472	2Fe-2S ferredoxin	1	0	0	0	X
945	cytochrome c	1	0	0	0	X
2708	hemoglobin A beta chain	1	0	0	0	X
2711	hemoglobin A alpha chain	1	0	0	0	X
183	transforming growth factor	1	0	0	0	X
1653	lysozyme	1	0	0	0	X
614	neurotoxin III	1	0	0	0	X
888	lysozyme	1	0	0	0	X
598	cardiotoxin VII1	1	0	0	0	X
2709	hemoglobin A alpha chain	1	0	0	0	X
1044	copper-zinc superoxide dismutase	1	0	0	0	X
1045	copper-zinc superoxide dismutase	1	0	0	0	X
1096	basic pancreatic trypsin inhibitor	1	0	0	0	X
963	chymotrypsin	1	0	0	0	X
1098	basic pancreatic trypsin inhibitor	1	0	0	0	X
962	chymotrypsinogen A	1	0	0	0	X
1056	copper-zinc superoxide dismutase	1	0	0	0	X
1820	carbonic anhydrase II	1	0	0	0	X
122	plastocyanin	1	0	0	0	X
350	tissue plasminogen activator	1	0	0	0	X
961	chymotrypsin	1	0	0	0	X
1053	hemoglobin A beta chain	1	0	0	0	X
2442	elongation factor Tu	1	0	0	0	X
753	calbindin	1	0	0	0	X
1219	azurin	1	0	0	0	X
1097	basic pancreatic trypsin inhibitor	1	0	0	0	X
4612	5'-D(TPGPGPGPCPGPGPT)-3'	0	0	0	0
18656	Internal Loop 5'GAGU/3'UGAG	0	0	0	0
4610	5'-D(APGPGPGP*T)-3'	0	0	0	0
11046	5'-D(DTPDAPDCPDG)-3' 10 structures	0	0	0	0	X
10087	59 kDa 2'-5'-oligoadenylate synthetase like protein	0	0	0	0
19266	SNARE	0	0	0	0	X
6186	5'-D(PTPGPAPTPCPA)-3'	0	0	0	0
19226	2'F-RNA/2'F-ANA chimeric duplex	0	0	0	0
5339	5'-D(CPGPTPAPCPG)-3'	0	0	0	0
5721	APH(3')II	0	0	0	0
6307	5'-D(GPGPGPTPTPTPTPGPGPGP*G)-3'	0	0	0	0
11045	5'-D(DTPDAPDCPDG)-3' 10 structures	0	0	0	0	X
5559	3'-stem-loop of human U4 snRNA	0	0	0	0
18080	amyloid precursor protein's transmembrane domain	0	0	0	0
11047	5'-D(DTPDAPDCPDG)-3' 10 structures	0	0	0	0	X
11048	5'-D(DTPDAPDCPDG)-3' 10 structures	0	0	0	0	X
19400	The structure of the Box CD enzyme reveals regulation of rRNA methylation	0	0	0	0	X		X

Back to the initial grid

Top of this page